Significant differences in gene expression of GABA receptors in peripheral blood leukocytes of migraineurs

Gene 490 (2011) 32–36

Contents lists available at SciVerse ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

Significant differences in gene expression of GABA receptors in peripheral blood leukocytes of migraineurs Prue N. Plummer, Natalie J. Colson, Joanne M. Lewohl, Rachel K. MacKay, Francesca Fernandez, Larisa M. Haupt, Lyn R. Griffiths ⁎ Genomics Research Centre, Griffith Health Institute, Griffith University, Gold Coast, Queensland, Australia

a r t i c l e

i n f o

Article history: Accepted 25 August 2011 Available online 24 September 2011 Received by A.J. van Wijnen Keywords: Gamma-aminobutyric acid (GABA) Migraine Multi-factorial disorder Cortical hyperexcitability Genetic susceptibility

a b s t r a c t Migraine is a debilitating neurovascular disorder, with a substantial genetic component. The exact cause of a migraine attack is unknown; however cortical hyperexcitability is thought to play a role. As Gamma-aminobutyric Acid (GABA) is the major inhibitory neurotransmitter in the brain, malfunctioning of this system may be a cause of the hyperexcitability. To date, there has been limited research examining the gene expression or genetics of GABA receptors in relation to migraine. The aim of our study was to determine if GABA receptors play a role in migraine by investigating their gene expression using profile in migraine affected individuals and non-affected controls by Q-PCR. Gene expression of GABAA receptor subunit isoforms (GABRA3, GABRB3, GABRQ) and GABAB receptor 2 (GABBR2) was quantified in mRNA obtained from peripheral blood leukocytes from 28 migraine subjects and 22 healthy control subjects. Analysis of results showed that two of the tested genes, GABRA3 and GABBR2, were significantly down regulated in migraineurs (P = 0.018; P = 0.017), compared to controls. Results from the other tested genes did not show significant gene expression variation. The results indicate that there may be specific GABA receptor gene expression variation in migraine, particularly involving the GABRA3 and GABBR2 genes. This study also identifies GABRA3 and GABBR2 as potential biomarkers to select migraineurs that may be more responsive to GABA agonists with future investigations in this area warranted. Crown Copyright © 2011 Published by Elsevier B.V. All rights reserved.

1. Introduction Migraine is classified as a recurrent headache disorder in which sufferers experience episodic headpain lasting four to seventy-two hours. The two major sub-types are (i) migraine with aura (MA) which accounts for ~ 30% of cases; and (ii) migraine without aura (MO) accounting for ~70% of cases. Migraine is accompanied by symptoms of nausea, vomiting, photophobia and in the MA subtype, neurological disturbances (Headache Classification Committee of the International Headache Society, 2004). It is more prevalent in women affecting 18.2% of females in comparison to 6.5% of males in the U.S (Lipton et al., 2001). Migraine has a strong genetic component, showing high familial aggregation (Stewart et al., 1997; Russell et al., 1996) and significant linkage to several chromosomal locations (Colson et al., 2007), including chromosomal regions on 15q11-q13 and Xq28 (Russo et al., 2005; Nyholt et al., 2000).

Abbreviation: GABA, gamma-aminobutyric acid; GABRA3, GABRB3, GABRQ, GABAA receptor subunit isoforms; GABBR2, GABAB receptor 2; MA, migraine with aura; MO, migraine without aura. ⁎ Corresponding author at: Genomics Research Centre, Griffith Health Institute, Griffith University, Gold Coast, Queensland, 9726, Australia. Tel.: +61 7 5552 8664; fax: +61 7 5594 8908. E-mail address: l.griffiths@griffith.edu.au (L.R. Griffiths).

The specific pathophysiology of migraine is unknown, although it may be generated by over-activation of trigeminal nerve axons, resulting in the release of neuropeptides causing inflammation and vasodilatation of blood vessels. This response and the sensitization of nerve endings are understood to be the cause of the head pain (Goadsby and Edvinsson, 1993; Markowitz et al., 1987). There are several possible triggers of trigeminal nerve axon activation. The most notable trigger is hyperexcibility within the cerebral cortex. This theory is supported by a study in 2001, demonstrating that after Transcranial Magnetic Stimulation, MA patients were more susceptible to hyperexcibility in the visual cortex than controls, indicating that MA patients may have a lower level of inhibition in the cerebral cortex than control subjects (Mulleners et al., 2001). Other studies have suggested that this lack of inhibition may be due to defective gamma-aminobutyric acid (GABA) circuits (Palmer et al., 2000; Fierro et al., 2003) Decreased GABAA receptor activation and expression has been demonstrated in several studies to result in decreased inhibition within the brain (Storer et al., 2001, 2004; Schiene et al., 1996), suggesting that GABA receptor activation and expression may be decreased in individuals with migraine. GABA is the major inhibitory neurotransmitter in the brain, being released in approximately one-third of all synapses. It binds and activates GABAA, GABAB and GABAC receptors (Brambilla et al., 2003). The GABAA receptor is a complex of five peptide chain subunits that

0378-1119/$ – see front matter. Crown Copyright © 2011 Published by Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2011.08.031

P.N. Plummer et al. / Gene 490 (2011) 32–36

form an ionotropic transmembrane chloride channel. They are expressed in the brainstem, spinal cord and purkinje neurons of the cerebellum and in peripheral tissues including the adrenal, ovary, testis and small intestine (Brambilla et al., 2003; Akinci and Schofield, 1999). There are six different types of peptide chain subunits, which exist in a number of isoforms (Belelli and Lambert, 2005). The GABAA receptor subunit isoforms investigated in the present study were alpha three (GABRA3), beta three (GABRB3) and theta (GABRQ). GABRA3 and GABRQ have a chromosomal location of Xq28 (Bell et al., 1989) and GABRB3 is located at the 15q11-q13 region (Glatt et al., 1994). These genes were selected for investigation as these chromosomal locations have been previously linked to migraine (Russo et al., 2005; Nyholt et al., 2000). The GABAB receptor is a metabotropic heterodimer of two related 7-transmembrane receptors, GABAB receptor 1 and GABAB receptor 2. In this system the GABA binds to receptor 1, allowing receptor 2 to activate downstream pathways such as inhibition of presynaptic calcium channels. GABAB receptors are expressed in most neuronal cell populations including the spinal cord, hippocampus and cerebellum. It is also expressed in peripheral tissues such as heart, spleen, liver and kidney (Bettler et al., 2004). The GABAB receptor 2 (GABBR2) gene has a chromosomal location of 9q22.1-q22.3, which has been linked to epilepsy, a disorder that shows moderate co-morbidity with migraine (Ng et al., 1999; Deprez et al., 2007). In this study, gene expression of GABRA3, GABRB3, GABRQ and GABBR2 was examined in mRNA isolated from the leukocytes of migraine and healthy control subjects, by Q-PCR analysis. The aim of this study was to determine any correlation between GABA receptor expression and migraine etiology. 2. Methods 2.1. Subjects Blood samples were collected by a qualified phlebotomist under full ethical clearance by the Griffith University Ethics Committee for experimentation on human subjects. Informed written consent was obtained from the participants. All subjects were from the same geographical location (East Coast of Australia) and were recruited through the Genomics Research Centre Clinic. There were 28 migraineurs (20 females, 8 males) and 22 healthy controls (17 females and 5 males). None of the participants were taking prophylactic migraine drugs. Power analysis determined that this sample size, with an alpha level of 0.05, was large enough (97.3% Power) to detect a significant difference, if it occurred. 2.2. RNA extraction and cDNA synthesis Total RNA was extracted using the standard method described in the PAXgene Blood RNA Kit handbook (PreAnalytiX). Briefly, following sample collection in PAXgene blood collection tubes, total RNA was isolated through the use of stabilisation buffers followed by proteinase K digestion and spin column clean up as per the manufacturer's instructions (Qiagen). RNA was stored at −80°C until required. RNA quality was assessed using an Agilent 2100 Bioanalyzer (Agilent Technologies, Inc.) and showed minimal degradation (Mueller, 2008). Samples were reverse transcribed using random hexamers. Briefly, a mix of 1 μl of 500 ng/μl Random Hexamer Primers (Invitrogen), 2ug RNA, and 2 μl of 20 mM dNTPs (New England Biolabs) in a final volume of 13μL with DEPC-treated water, was incubated at 65°C for 5 min and placed on ice for at least 1 min. 8μL 5x first-strand synthesis buffer, 4 μl of 0.1 mM DTT dithiothreitol (Invitrogen), 40U RNaseOUT™ and 200U Superscript™ III (Invitrogen) were added and the solution incubated at 50°C for 1 h. A further 200U of Superscript III was added and the solution was incubated at 50 °C for 1 hour followed by deactivation by heating to 70°C for 15 min. Samples were aliquoted and stored at −70°C

33

until required. All samples were transcribed using the same reverse transcription reaction and conditions and the same amount of total RNA. 2.3. Primer design Primers were designed using Primer Express® v1.5 Software (Applied Biosystems) (Applied Biosystems, 2001) and PrimerBank (Spandidos et al., 2008). Each primer pair was verified for gene specificity using Nucleotide Basic Local Alignment Search Tool from the GenBank non-redundant nucleotide sequence database (National Centre for Biotechnology Information) (National Centre for Biotechnology Information, 2009). The sequence of each primer pair and the expected amplicon size is summarised in Table 1. Real-Time PCR was carried out using the Rotor-Gene 6000 (Corbett Research Pty Ltd.). Primer concentrations were optimized to determine the minimum primer concentration resulting in optimal amplification of the target sequence while minimizing non-specific amplification. Each PCR consisted of 1/50 dilution of cDNA, 12.5μL iQ SYBR® Green Supermix PCR Master Mix (Bio-Rad), 300nM of each pair of oligonucleotide primers (Sigma-Aldrich) in a 25μL final volume. The cycle protocol was as follows: Hold at 95° for 10 min, 40 cycles of 95° for 15 s, 58° for 30 s and 72° for 30 s for 45 cycles. The ramping was from 72° to 95°, rising 1° each step. The pre-melt conditioning was 90s for the first step and 5 s for each melt thereafter. Wells with no template were included for each primer set as a negative control. The amplification plot of fluorescence vs. cycle number was used to set the threshold (T) in the exponential phase of the reaction above the baseline. This was kept constant between runs to allow for analysis between runs. The cycle threshold (CT) was calculated as the cycle number of an amplifying PCR product where it crosses the fixed threshold line. In each experiment, 4 cases and 4 controls were amplified in duplicate for each of the genes of interest and the reference gene. Only average CT values with a standard deviation b0.35 were accepted.

2.4. Statistical analysis The expression of each gene of interest was determined relative to the reference gene TATA box binding protein (TBP). The reference gene was selected using the method described by (Vandesompele et al., 2002) (Vandesompele et al., 2002). To ensure the correct reference gene was selected, the data was analyzed using geNorm© and BestKeeper© programs (Vandesompele et al., 2002; Pfaffl et al., 2004). The difference in the mean CT values of the duplicate samples against the reference gene was calculated using Excel (Microsoft Office 2003) to give the ΔCT. The relative quantitation value was then expressed as 2–ΔCT using the comparative CT method (Applied Biosystems, 1997).

Table 1 Table of primer sequences, NCBI gene ID and amplicon size. Gene

NCBI gene ID

GABRA3

2556

GABRB3

2562

GABRQ

55879

GABBR2

9568

TBP

6908

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

Sequence (5′-3′)

Amplicon size (bp)

CATGAAGATCGTTCCACTTGAACA GGTTCCGTTATCCACCAATC CAACTACATTTTCTTTGGAAGAGGC TTTCGCTCTTTGAACGGTCAT TTGGAAAGATTCACGCTTAGCA GCTGTTCAGAAAGTAGCAGTCAG GGAAGAGGTCACCATGCAG AGTTTCCCAGGTTGAGGATG ATGTTTTTCCCCATGAACCA TGCAATACTGGAGAGGTGGA

136 94 106 100 82

34

P.N. Plummer et al. / Gene 490 (2011) 32–36

Analysis of the data was performed using Statistica (StatSoft Version 7.0 Windows) using the ΔCT values. Analysis of Variance (ANOVA) was followed by the relevant post hoc test where appropriate. Differences in expression were determined between controls and migraineurs and differences between males and females were also determined. The effect of age was determined by regression analysis. Differences between the slopes of the regression lines were also tested. 3. Results Analysis of relative expression levels using Q-PCR is critically dependent on using a reference gene that does not differ significantly in its expression level between cases and controls. Accordingly, the expression of TBP was measured using Q-PCR in each sample included in this study. Comprehensive statistical analysis was carried out on the raw CT values and no significant differences were found in the expression of TBP between controls and migraineurs (F1,48 = 0.8, P = 0.39). All other genes were expressed relative to the CT value of TBP for each sample. The study utilized 20 female migraineurs and 17 female controls, with 8 male migraineurs and 5 male controls. The migraineurs were slightly older than the controls [range (mean): migraineurs 24– 83 years (58y), controls 25–71 years (40 years)]. Thus linear regression analysis was used to determine if the expression of any gene correlated with age. This was done using all subjects combined and with subjects separated into their respective case groups. The analysis showed no significant correlation between the expression of any gene and age for combined cases or for cases separated into their respective groups. Overall the expression of GABRA3, and GABBR2 was significantly lower in migraineurs when compared to controls (GABRA3, F1,45 =6.1, P= 0.018; GABBR2, F1,43 = 6.2, P =0.017; See Fig. 1A and D). However there was no significant difference observed in the expression of GABRB3 (F1,43 = 0.12, P= 0.73) or GABRQ (F1,42 =3.1, P=0.086; See Fig. 1B and C) in the samples examined. Since migraine is more common in women and two of the genes under investigation are located on the X chromosome, we also analyzed the data with each case group divided according to gender.

A

The expression of GABRA3 was significantly lower in female migraineurs compared with female controls (F1,33 = 7.1, P = 0.015, Fig. 2A) but not males (F1,10 = 0.7, P = 0.79, Fig. 3A). The expression of GABRB3 and GABBR2 was significantly lower in male migraineurs compared with male controls (GABRB3, F1,10 = 5.4, P = 0.043, F1,10 = 5.3, P = 0.043, Fig. 3B and d respectively) but not in females (GABRB3, F1,31 = 0.28, P = 0.285; GABBR2, F1,31 = 2.5, P = 0.123, Fig. 2B and D). There was no difference in the expression of GABRQ in either male or female migraineurs when compared to controls (females, F1,34 = 3.4, P = 0.075; males, F1,6 = 1.6, P = 0.24; See Figs. 2C and 3C).

4. Discussion The cause of migraine is unknown, however one theory is that migraine is triggered by over-activation of trigeminal nerve axons due to cortical hyperexcitability. It is also postulated that this hyperexcitability may involve decreased GABA receptor expression. Several studies support this theory (Mulleners et al., 2001; Fierro et al., 2003), however the role of GABA receptors in migraine pathology has not been fully explored. In this study the relationship of GABA receptors in migraine was investigated in mRNA obtained from peripheral blood leukocytes. Q-PCR gene expression analysis demonstrated that two of GABA receptor subunits examined (GABRA3 and GABBR2) were significantly down regulated in case subjects in comparison to control subjects. This is consistent with previous research that has suggested that individuals with migraine have a lower level of inhibition in the brain, and that this may be the result of decreased GABAA receptor activation (Storer et al., 2001; Storer et al., 2004; Schiene et al., 1996). As GABRA3 has a chromosomal location of Xq28, a region previously linked to migraine, this strengthens the implication of this genomic location in migraine etiology. Further research into other GABA receptor genes, including GABAA isoform epsilon, which is also located at Xq28 (Nyholt et al., 2000; Wilke et al., 1997) is therefore warranted. Another plausible gene candidate in this region is the GABAA receptor subunit isoform gamma 2, which like GABBR2 has previously been demonstrated to be associated with epilepsy (Wallace et al., 2001).

B

* C

D

* Fig. 1. Gene expression levels in all subjects, shaded bars represent controls while open bars represent migraineurs A. GABRA3 B. GABRB3 C. GABRQ D. GABBR2. Relative expression is presented as ΔCT means converted to 2−ΔCT ± S.E.M. There is a significant decrease in gene expression for GABRA3 (*P = 0.018) and GABBR2 (*P = 0.017) in migraineurs, with no difference in expression for GABRQ (P = 0.086) and GABBR2 (P = 0.73).

P.N. Plummer et al. / Gene 490 (2011) 32–36

A

35

B

* C

D

Fig. 2. Gene expression levels in female subjects, shaded bars represent controls while open bars represent migraineurs A. GABRA3 B. GABRB3 C. GABRQ D. GABBR2. Relative expression is presented as ΔCT means converted to 2-ΔCT ± S.E.M. There is a significant decrease in gene expression for GABRA3 (*p = 0.015) in female migraineurs, with no difference in expression for GABRB3 (p = 0.285), GABRQ (p = 0.075) or GABBR2 (p = 0.123).

This study also highlights the gender variability associated with migraine gene expression profiles with the expression of GABRA3 shown to be decreased in female migraineurs, but not male migraineurs. In addition our results demonstrated that GABRB3 and GABBR2 expression is decreased in male migraineurs, but not female migraineurs. These results imply different gene expression profiles for specific genes including GABA receptors may have a specific role in migraine dependent upon the sex of the individual. Previous gene expression studies have also demonstrated different gene expression levels in migraine subjects in comparison to control subjects from peripheral blood (Gardiner et al., 1998; Sarchielli et al., 2006). In particular a microarray study by Hershey

A

et al. showed that 40 genes were upregulated in the platelets of migraine subjects in comparison to control subjects (Hershey et al., 2004). Although none of the GABA genes tested in the present study were analyzed on the array by Hershey et al. GABA levels have however previously been shown to be altered in the blood, saliva and cerebrospinal fluid (CSF) of migraine subjects. Two such studies found that GABA levels increased during a migraine attack in the saliva and CSF respectively (Marukawa et al., 1996; Vieira et al., 2006). Furthermore, Hisanori et al. found that migraine subjects had higher levels of GABA between attacks in their blood platelets indicating that GABA may be altered in general in migraineurs (Kowa et al., 1992).

B

* C

D

* Fig. 3. Gene expression levels in male subjects, shaded bars represent controls while open bars represent migraineurs A. GABRA3 B. GABRB3 C. GABRQ D. GABBR2. Relative expression is presented as ΔCT means converted to 2-ΔCT ± S.E.M. There is a significant decrease in gene expression for GABRB3 (*p = 0.043) and GABBR2 (*p = 0.043) in male migraineurs, with no difference in expression for GABRA3 (p = 0.79) or GABRQ (p = 0.24).

36

P.N. Plummer et al. / Gene 490 (2011) 32–36

Our findings here suggest a down regulation of specific GABA genes in migraineurs and these results may have treatment implications including supporting the use of GABA receptor agonists in migraine treatment. It is possible that these drugs may affect GABAA receptor binding and resultant expression (Cutrer et al., 1997). Alteration of GABAB receptor expression suggests that GABAB receptor agonists may also be successful in preventing migraine. This is consistent with previous research demonstrating that the GABAB receptor agonist Baclofen, can prevent migraine onset (Hering-Hanit, 1999). These results imply that both types of receptors are involved in migraine etiology and that treatment could be improved if both receptor types were targeted. However previous research has also revealed that GABA receptor agonists may not be successful for all migraine patients. The GABA analogue Gabapentin was demonstrated to be effective in decreasing migraine frequency and duration in 46.4% of patients (Mathew et al., 2001). This result implies that not all migraine patients may benefit from GABA-targeted treatments. It is possible that quantification of GABA receptor gene expression may be useful in identifying classes of patients likely to respond to these treatments. 5. Conclusion This study has identified significant expression variation in two GABA receptor genes in migraineurs, suggesting that variation in these receptors, in particular GABRA3 and GABBR2 may be involved in the pathogenesis of migraine. This study also identified GABRA3 and GABBR2 as potential biomarkers to select migraineurs that may be more responsive to GABA agonists, with this possibility warranting further investigation. Conflict of interest The authors declare that they have no conflict of interest. Ethical standards Full ethical clearance by the Griffith University Ethics Committee for experimentation on human subjects. Informed written consent was obtained from the participants. Acknowledgments This research was supported by an Australian Research Council Linkage grant, with Corbett Research as an industry partner and a Griffith University New Researchers Grant. References Akinci, M.K., Schofield, P.C., 1999. Widespread expression of GABA(A) receptor subunits in peripheral tissues. Neurosci. Res. 35, 145–153. Applied Biosystems, 1997. User Bulletin No. 2 ABI Prism 7700 Sequence Detection System. Applied Biosystems. Available from http://www3.appliedbiosystems.com/cms/groups/ mcb_support/documents/generaldocuments/cms_040980.pdf. Accessed 30 Sept 2009. Applied Biosystems, 2001. Primer Express®Applications-Based Primer Design Software. Applied Biosystems. Available from http://www3.appliedbiosystems.com/cms/ groups/mcb_marketing/documents/generaldocuments/cms_040956.pdf. Accessed 30 Sept 2009. Belelli, D., Lambert, J.J., 2005. Neurosteroids: endogenous regulators of the GABA(A) receptor. Nat. Rev. Neurosci. 6, 565–575. Bell, M.V., Patterson, M.N., Dorkins, H.R., Davies, K.E., 1989. Physical mapping of Dxs134 Close to the Dxs52 Locus. Hum. Genet. 82, 27–30. Bettler, B., Kaupmann, K., Mosbacher, J., Gassmann, M., 2004. Molecular structure and physiological functions of GABA(B) receptors. Physiol. Rev. 84, 835–867. Brambilla, P., Perez, J., Barale, F., Schettini, G., Soares, J.C., 2003. GABAergic dysfunction in mood disorders. Mol. Psychiatry 8, 721–737. Colson, N.J., Fernandez, F., Lea, R.A., Griffiths, L.R., 2007. The search for migraine genes: an overview of current knowledge. Cell. Mol. Life Sci. 64, 331–344. Cutrer, F.M., Limmroth, V., Moskowitz, M.A., 1997. Possible mechanisms of valproate in migraine prophylaxis. Cephalalgia 17, 93–100.

Deprez, L., et al., 2007. Familial occipitotemporal lobe epilepsy and migraine with visual aura — linkage to chromosome 9q. Neurology 68, 1995–2002. Fierro, B., et al., 2003. 1 Hz rTMS enhances extrastriate cortex activity in migraine — evidence of a reduced inhibition? Neurology 61, 1446–1448. Gardiner, I.M., Ahmed, F., Steiner, T.J., McBain, A., Kennard, C., de Belleroche, J., 1998. A study of adaptive responses in cell signaling in migraine and cluster headache: correlations between headache type and changes in gene expression. Cephalalgia 18, 192–196. Glatt, K., Sinnett, D., Lalande, M., 1994. The human gamma-aminobutyric-acid receptor subunit beta-3 and alpha-5 gene-cluster in chromosome 15q11-Q13 is rich in highly polymorphic (Ca)(N) repeats. Genomics 19, 157–160. Goadsby, P.J., Edvinsson, L., 1993. The trigeminovascular system and migraine — studies characterizing cerebrovascular and neuropeptide changes seen in humans and cats. Ann. Neurol. 33, 48–56. Headache classification committee of the international headache society, 2004. The International Classification of Headache Disorders, 2nd Edn. Cephalalgia 24, 1–160. Hering-Hanit, R., 1999. Baclofen for prevention of migraine. Cephalalgia 19, 589–591. Hershey, A.D., et al., 2004. Genomic abnormalities in patients with migraine and chronic migraine: preliminary blood gene expression suggests platelet abnormalities. Headache 44, 994–1004. Kowa, H., Shimomura, T., Takahashi, K., 1992. Platelet gamma-aminobutyric-acid levels in migraine and tension-type headache. Headache 32, 229–232. Lipton, R.B., Stewart, W.F., Diamond, S., Diamond, M.L., Reed, M., 2001. Prevalence and burden of migraine in the United States: data from the American Migraine Study II. Headache 41, 646–657. Markowitz, S., Saito, K., Moskowitz, M.A., 1987. Neurogenically mediated leakage of plasma-protein occurs from blood-vessels in dura-mater but not brain. J. Neurosci. 7, 4129–4136. Marukawa, H., Shimomura, T., Takahashi, K., 1996. Salivary substance P, 5-hydroxytryptamine, and gamma-aminobutyric acid levels in migraine and tensiontype headache. Headache 36, 100–104. Mathew, N.T., et al., 2001. Efficacy of gabapentin in migraine prophylaxis. Headache 41, 119–128. Mueller, S., 2008. Optimizing real-time quantitative PCR experiments with Agilent 2100 bioanalyzer. Agilent Technologies, Inc. Available from http://www.chem.agilent.com/ enUS/Search/Library/_layouts/Agilent/PublicationSummary.aspx?whid=54545&liid= 1805. Accessed 30 Sept 2009. Mulleners, W.M., Chronicle, E.P., Palmer, J.E., Koehler, P.J., Vredeveld, J.W., 2001. Suppression of perception in migraine — evidence for reduced inhibition in the visual cortex. Neurology 56, 178–183. National Centre for Biotechnology Information, 2009. http://www.ncbi.nlm.nih.gov/. Accessed 30 Sept. Ng, G.Y.K., et al., 1999. Identification of a GABA(B) receptor subunit, gb2, required for functional GABA(B) receptor activity. J. Biol. Chem. 274, 7607–7610. Nyholt, D.R., Curtain, R.P., Griffiths, L.R., 2000. Familial typical migraine: significant linkage and localization of a gene to Xq24-28. Hum. Genet. 107, 18–23. Palmer, J.E., Chronicle, E.P., Rolan, P., Mulleners, W.M., 2000. Cortical hyperexcitability is cortical under-inhibition: evidence from a novel functional test of migraine patients. Cephalalgia 525–532. Pfaffl, M.W., Tichopad, A., Prgomet, C., Neuvians, T.P., 2004. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper — excel-based tool using pair-wise correlations. Biotechnol. Lett. 26, 509–515. Russell, M.B., Iselius, L., Olesen, J., 1996. Migraine without aura and migraine with aura are inherited disorders. Cephalalgia 16, 305–309. Russo, L., et al., 2005. A new susceptibility locus for migraine with aura in the 15q11-q13 genomic region containing three GABA-A receptor genes. Am. J. Hum. Genet. 76, 327–333. Sarchielli, P., et al., 2006. Proinflammatory cytokines, adhesion molecules, and lymphocyte integrin expression in the internal jugular blood of migraine patients without aura assessedictally. Headache 46, 200–207. Schiene, K., et al., 1996. Neuronal hyperexcitability and reduction of GABA(A)-receptor expression in the surround of cerebral photothrombosis. J. Cereb. Blood Flow Metab. 16, 906–914. Spandidos, A., Wang, X.W., Wang, H.J., Dragnev, S., Thurber, T., Seed, B., 2008. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance. BMC Genomics 9, 633. Stewart, W.F., Staffa, J., Lipton, R.B., Ottman, R., 1997. Familial risk of migraine: a population-based study. Ann. Neurol. 41, 166–172. Storer, R.J., Akerman, S., Goadsby, P.J., 2001. GABA receptors modulate trigeminovascular nociceptive neurotransmission in the trigeminocervical complex. Br. J. Pharmacol. 134, 896–904. Storer, R.J., Akerman, S., Shields, K.G., Goadsby, P.J., 2004. GABA(A) receptor modulation of trigeminovascular nociceptive neurotransmission by midazolam is antagonized by flumazenil. Brain Res. 1013, 188–193. Vandesompele, J., et al., 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3, 1–11. Vieira, D.S.S., et al., 2006. Cerebrospinal fluid GABA levels in chronic migraine with and without depression. Brain Res. 1090, 197–201. Wallace, R.H., et al., 2001. Mutant GABAA receptor γ2-subunit in childhood absence epilepsy and febrile seizures. Nat. Genet. 28, 49–52. Wilke, K., Gaul, R., Klauck, S.M., Poustka, A., 1997. A gene in human chromosome band Xq28 (GABRE) defines a putative new subunit class of the GABAA neurotransmitter. Genomics 45, 1–10.