Odorant receptor gene expression in catfish taste tissue

Chemical Neuroscience 1111 2 3 4 5 6 7 8 9 10111 1 2 3 4 5 6 7 8 9 20111 1 2 3 4 5 6 7 8 9 30111 1 2 3 4 5 6 7 8 9 40111 1 2 3 4 5 6 7 8 9 50111 1 2 3 4 5 6111p

Website publication 21 December 1998

NeuroReport 9, 4103–4107 (1998)

ODORANT receptor expression has been reported in a variety of non-olfactory cells and tissues in several animal models. We therefore investigated the possible expression of odorant receptor genes in taste tissue of channel catfish. Multiple odorant receptor transcripts were amplified by PCR from barbel. In situ hybridization showed that receptors amplified from taste tissue, as well as receptors amplified from olfactory neurons, hybridized to taste epithelium with similar patterns. These results show that odorant receptor transcripts are expressed in catfish taste tissue. Taken with previous data, these results suggest that some members of the odorant receptor superfamily may mediate various chemoreceptive roles in non-olfactory cells. NeuroReport 9: 4103–4107 © 1998 Lippincott Williams & Wilkins.

Odorant receptor gene expression in catfish taste tissue

Key words: Catfish; In situ hybridization; Odorant receptors; PCR; Taste epithelium

Kathryn F. Medler, Anne Hansen1 and Richard C. BruchCA Department of Biological Sciences, Louisiana State University, Baton Rouge, LA 70803, USA; 1 Zoological Institute and Museum, University of Hamburg, Hamburg, Germany CA

Corresponding Author

Introduction

Materials and Methods

Odorant receptor gene expression has been reported in multiple non-olfactory cells and tissues in several animal models. In C. elegans, several odorant receptors were expressed in excretory cells, in the gut and in non-chemsensory neurons and interneurons.1 Odorant receptors are also transiently expressed in the chick notochord during development.2 In mammals, odorant receptor genes were reported to be expressed in spleen,3,4 developing heart,3,5 insulinsecreting cells,3 testicular tissue6,7 and sperm cells.4,6,7 Thomas et al. also reported that identical odorant receptors were expressed in rat taste, olfactory and male reproductive tissues.8 Odorant-like receptors were found in rat circumvallate taste buds and in the surrounding lingual epithelium.9–11 Odorant receptors were also amplified from bovine fungiform and circumvallate taste papillae.12 Immunohistochemistry showed that the odorant-like receptor GUST27 was expressed in taste receptor cells in rat circumvallate papillae.11 Given these various observations of odorant receptor expression in mammalian taste systems, we investigated the possible expression of odorant receptor genes in taste tissue of channel catfish (Ictalurus punctatus). Using PCR and in situ hybridization, we show that odorant receptor transcripts are expressed in catfish taste tissue. To our knowledge, this is the first report of odorant receptor gene expression in taste tissue of an aquatic vertebrate animal. Taken with previous data, our results suggest that some members of the odorant receptor superfamily may mediate recognition of chemical signals in a variety of non-olfactory cells and tissues.

PCR analysis of odorant receptor expression in taste tissue: Juvenile catfish, 15–20 cm in length, were used to isolate total RNA from barbel.13 All procedures involving vertebrates were approved by the Louisiana State University Institutional Animal Care and Use Committee. Random primed reverse transcribed cDNA was used to amplify odorant receptor transcripts by PCR.13 PCR analysis was initiated with Taq polymerase at 90°C. The cDNA was then amplified according to the following schedule: 94°C for 4 min, 38°C for 2 min, and 72°C for 1.5 min for one cycle, then 94°C for 1 min, 38°C for 2 min, and 72°C for 1.5 min for 39 cycles, followed by 72°C for 15 min with termination at 94°C for 15 min. The samples were then slowly cooled to 4°C. PCR was performed using the following primers: the 5′ primer was ACCAAAGAAGCAATG, corresponding to conserved the amino acids TKEAM and the 3′ primer was ATTATCCTATCATTCGCATTT, corresponding to the conserved amino acids NANDRI.14 Negative controls consisted of parallel samples that lacked reverse transcriptase. Positive controls for the PCR consisted of a catfish odorant receptor PCR product amplified from olfactory tissue that shared > 90% amino acid sequence identity to a previously published odorant receptor sequence.14 Amplified products of the appropriate size (400 bp) were cloned and sequenced.13,15 Subsequent experiments utilized taste buds isolated from the maxillary barbel that were provided by Drs L. Liu and T. Gilbertson (Pennington Biomedical Research Center, Baton Rouge, LA). Poly (A)+ RNA samples were obtained

0959-4965 © 1998 Lippincott Williams & Wilkins

Vol 9 No 18 21 December 1998

4103

K. F. Medler, A. Hansen and R. C. Bruch 1111 2 3 4 5 6 7 8 9 10111 1 2 3 4 5 6 7 8 9 20111 1 2 3 4 5 6 7 8 9 30111 1 2 3 4 5 6 7 8 9 40111 1 2 3 4 5 6 7 8 9 50111 1 2 3 4 5 6111p

from taste buds and from olfactory receptor neurons and subjected to reverse transcription to obtain cDNA as described previously.13,15 The cDNA was used to amplify odorant receptor transcripts using the primers and PCR conditions described above. Odorant receptor expression was analysed in additional taste buds by Southern blotting.13,15 In situ hybridization: Odorant receptor PCR products cloned in pCR2.1 (Invitrogen, Carlsbad, CA) were excised with EcoRI, gel purified and subcloned into pBluescript (Stratagene, La Jolla, CA) previously digested with EcoRI. The orientation of the subcloned inserts was determined by DNA sequence analysis. For in vitro transcription, plasmids were linearized with appropriate restriction enzymes and digoxigenin-labelled antisense and sense cRNA transcripts were synthesized with T3 and T7 RNA polymerases. Cryostat sections were prepared from tissues obtained from anesthetized catfish following transcardial perfusion with 4% paraformaldehyde in fish Ringer’s solution. Sections were post-fixed in 4% paraformaldehyde in PBS for 30 min and rinsed three times for 10 min each with PBST (PBS containing 0.1% Tween 20). Sections were digested with 10 mg/ml proteinase K in PBST for 10 min at room temperature and washed twice for 10 min each with PBST. Sections were prehybridized for 1–2 h at 42°C with hybridization mixture, which contained 50% formamide, 5× SSPE, 1× Denhardt’s reagent, 0.2% SDS, 250 ␮g/ml salmon sperm DNA and 250 ␮g/ml poly A. Hybridization was performed overnight at 65°C with labelled probes diluted 1:50 in hybridization mixture. Posthybridization washes consisted of three washes for 10 min each at 60°C with 2× SSC followed by the same washes with 0.2× SSC. Sections were washed twice for 10 min each with 0.1 M Tris/HCl, pH 7.5. For immunohistochemical detection, sections were incubated for 1–2 h at room temperature with blocking solution (10% sheep serum, 0.1 M Tris–HCl, pH 7.5, 0.5% blocking reagent and 0.05% Tween 20). Alkaline phosphatase-conjugated Fab fragments to digoxigenin were diluted 1:1000 in blocking solution and incubated with sections at 4°C overnight. Sections were washed three times for 10 min each in 0.1 M Tris–HCl, pH 7.5 at room temperature followed by two washes of 10 min each in 0.1 M Tris–HCl, pH 9.5, 50 mM MgCl2, 0.1 M NaCl, and 0.1% Tween 20. Hybridization was visualized with NBT and BCIP substrates (Boehringer Mannheim, Indianapolis, IN) at room temperature for up to 2 h. The alkaline phosphatase reaction was stopped by washing sections three times for 10 min each in PBS.

4104 Vol 9 No 18 21 December 1998

Results PCR analysis of odorant receptor expression in taste tissue: To determine whether odorant receptor transcripts were expressed in catfish taste tissue, initial PCR experiments were performed with RNA isolated from barbel. Fourteen PCR products amplified from barbel were identified by partial sequence analysis that corresponded to previously described catfish odorant receptors.14 The complete sequences for four odorant receptor PCR products amplified from barbel are shown in Fig. 1. The receptor sequences amplified from barbel shared 87.5–95% amino acid sequence identity to a previously described catfish odorant receptor cloned from an olfactory cDNA library.14 Negative controls lacking reverse transcriptase did not contain amplified products, indicating that the receptor PCR products were amplified from RNA and not from genomic DNA. To determine whether odorant receptor transcripts were found within taste buds, additional PCR experiments were performed using RNA isolated from individual isolated taste buds. In these experiments, 400 bp products were amplified from single taste buds and from single olfactory receptor neurons that hybridized to a known odorant receptor cDNA probe (Fig. 2). The relatively weak hybridization signal for the taste bud suggested that the receptors were expressed at low levels. Identical results were obtained with two additional taste buds (data not shown). Negative controls lacking reverse transcriptase also did not contain receptor PCR products (Fig. 2). In situ hybridization: Since PCR analysis suggested that odorant receptor transcripts might be expressed in taste buds, maxillary barbel tissue sections were hybridized with odorant receptor cRNA sense and antisense probes to determine the cellular sites of expression of the receptors within taste tissue. Tissue sections probed with an odorant receptor amplified from olfactory neurons or from taste tissue showed a relatively high density of hybridization signals throughout the barbel. Representative results are shown in Fig. 3. The density of receptor hybridization in barbel was unexpectedly high compared to the small number of olfactory neurons that hybridized to this probe in olfactory tissue sections. Hybridization of this probe in olfactory tissue (Fig. 3E) showed that only a small number of neurons were labelled as expected.16 A similar sparse hybridization pattern was also obtained in olfactory tissue with a receptor probe amplified from taste tissue (Fig. 3F). Negative control sections probed with sense cRNA probes did not hybridize in either tissue as expected (Fig. 3C and D). The lack of

1111 2 3 4 5 6 7 8 9 10111 1 2 3 4 5 6 7 8 9 20111 1 2 3 4 5 6 7 8 9 30111 1 2 3 4 5 6 7 8 9 40111 1 2 3 4 5 6 7 8 9 50111 1 2 3 4 5 6111p

FIG. 1. Predicted amino acid sequences of odorant receptor PCR products amplified from barbel. The top sequence in italics is from Ngai et al.14 Sequences 1–4 are odorant receptors amplified from barbel. Differences between the sequences are shown in bold. Roman numerals indicate membrane spanning regions.

hybridization in the negative controls, together with the discrete labelling patterns obtained with antisense probes, also showed that the odorant receptor PCR products were not amplified from genomic DNA. Examination of hybridized barbel sections at higher

magnification showed the unexpected result of receptor hybridization to epithelial cells throughout the barbel but not within taste buds (Fig. 3B). However, some of the labelled epithelial cells appeared to be in close contact with taste buds and may therefore have been isolated together with the taste buds in the PCR experiments described above.

Discussion

FIG. 2. Southern blot analysis of odorant receptor PCR products amplified from isolated taste buds. PCR products amplified from a previously characterized odorant receptor from olfactory neurons15 (lane 1), a taste bud (lane 3) and from an olfactory receptor neuron (lane 4) hybridized with a digoxigenin-labelled odorant receptor cDNA probe. Lane 2 is a negative control lacking reverse transcriptase. The top band is the expected PCR product of ~400 bp while the lower band is a truncated product of ~300 bp.

This study showed that odorant receptor transcripts are expressed in catfish taste tissue. The conclusion that the receptors amplified from taste tissue are in fact members of the catfish odorant receptor family was based on several factors. The receptors amplified from taste tissue were obtained using specific PCR primers to conserved sequences of catfish odorant receptors.14 Using these primers, 14 products were obtained from taste tissue that were identified as odorant receptors by partial sequence analysis. The complete sequences of four of these receptors were at least 87% identical at the amino acid level to previously published odorant receptor sequences.14 Since Vol 9 No 18 21 December 1998

4105

1111 2 3 4 5 6 7 8 9 10111 1 2 3 4 5 6 7 8 9 20111 1 2 3 4 5 6 7 8 9 30111 1 2 3 4 5 6 7 8 9 40111 1 2 3 4 5 6 7 8 9 50111 1 2 3 4 5 6111p

FIG. 3. in situ hybridization of odorant receptor transcripts in barbel and olfactory tissue. (A) Hybridization of an odorant receptor antisense probe in barbel showed an unexpectedly high level of hybridization throughout the barbel (×77). (B) Hybridization of the same probe as in A in barbel shown at higher magnification (×308). Note the lack of hybridization in the taste bud (arrow). (C) Hybridization of the sense receptor probe used in (A) and (B) in barbel (×308) (D) Hybridization of the sense receptor probe used in (A) and (B) in olfactory tissue (×192). Note the lack of hybridization in (C,D). (E) Hybridization of an odorant receptor antisense probe amplified from olfactory neurons in olfactory tissue. (F) Hybridization of a receptor antisense probe amplified from taste tissue in olfactory tissue (×192). The probe corresponds to receptor 4 in Fig. 1. Note the similar hybridization patterns in (E) and (F).

negative control samples lacking reverse transcriptase did not produce receptor PCR products, it is unlikely that the receptors identified in taste tissue were amplified from genomic DNA. In addition, receptor PCR products amplified from isolated taste buds hybridized under stringent conditions13,15 with a known odorant receptor probe amplified from olfactory tissue. In situ hybridization showed that amplified receptors from taste tissue, as well as receptors obtained from olfactory neurons, hybridized to taste and olfactory tissue with similar patterns. The discrete hybridization patterns observed in tissue 4106 Vol 9 No 18 21 December 1998

sections also indicated that the receptor PCR products were not amplified from genomic DNA. In situ hybridization showed that odorant receptors amplified from taste tissue were expressed at relatively high levels compared to their low level of expression in the olfactory epithelium. However, with the probes tested, there was no evidence of labelling within taste buds, although the surrounding epithelium was densely labelled. In mammals, odorant-like receptors have been found within taste buds as well as in the surrounding lingual epithelium.8–12 However, the finding of odorant receptor

Odorant receptors in taste tissue 1111 2 3 4 5 6 7 8 9 10111 1 2 3 4 5 6 7 8 9 20111 1 2 3 4 5 6 7 8 9 30111 1 2 3 4 5 6 7 8 9 40111 1 2 3 4 5 6 7 8 9 50111 1 2 3 4 5 6111p

hybridization signals outside of catfish taste buds was unexpected since we were able to amplify the receptors from isolated taste buds. Because of the proximity of labelled epithelial cells to the taste buds, it is possible that some epithelial cells were isolated with the taste buds. However, the unexpected hybridization pattern in catfish may be due to several additional factors. It is possible that the receptors used as hybridization probes were not expressed by the taste buds within the tissue sections examined. Taste buds extend over the entire cutaneous system of the channel catfish and it is possible that the two receptor probes tested were expressed in taste buds not found on barbels. Since odorant receptor expression in nonolfactory tissue can be transient,2 it is also possible that odorant receptor expression in catfish taste buds may be developmentally regulated or may be related to taste receptor cell turnover or maturation. This study shows for the first time in catfish that olfactory receptors are present in the taste system as well as in olfactory receptor neurons. Since amino acids are taste and olfactory stimuli for catfish, it is perhaps not surprising that the same receptor types are found in both systems, although ligands for specific catfish odorant receptors have not been identified. Further characterization of these receptors in the taste system is needed to determine their role, if any, in taste reception, as well as their physiological role in epithelial cells in taste tissue. There is growing evidence that odorant receptors may belong to a large family of receptors which have other physiological roles in addition to the recognition of odorants. Multiple studies have now shown that receptors very similar to odorant receptors are present in a variety of tissues and during different life stages. Odorant receptors may be members of a larger family of receptors that function as general chemical recognition receptors with distinct ligand specificities possibly determined by the cells in which they are expressed. Thus, these receptors may function by directing developing cells’ migra-

tion in the notochord,2 by detecting taste or olfactory stimuli,8–12,14 or by directing the movement or maturation of sperm cells,4,6,8 depending on their cellular sites of expression. It is becoming apparent that the definition of these receptors may need to be expanded to fully encompass their multiple, physiological roles before a complete understanding of their function is appreciated.

Conclusion Odorant receptor transcripts were found to be expressed in catfish taste tissue. This finding provides the first example of odorant receptor expression in non-olfactory cells in an aquatic vertebrate model. Our results, taken with previous data, suggest that odorant receptors may be members of a large family of receptors that recognize a variety of chemical signals in non-olfactory cells in diverse organisms. References 1. Troemel RE, Chou JH, Dwyer ND et al. Cell 83, 207–218 (1995). 2. Nef S and Nef P. Proc Natl Acad Sci USA 94, 4766–4711 (1997). 3. Blache P, Gros L, Salazar G et al. Biochem Biophys Res Commun 242, 669–672 (1998). 4. Walensky LD, Ruat M, Bakin RE et al. J Biol Chem 273, 9378–9387 (1998). 5. Drutel G, Arrang JM, Diaz J et al. Receptors Channels 3, 33–40 (1995). 6. Vanderhaeghen P, Schurmans S, Vassart G et al. J Cell Biol 123, 1441–1452 (1993). 7. Asai H, Kasai H, Matsuda Y et al. Biochem Biophys Res Commun 221, 240–247 (1996). 8. Thomas MB, Haines SL and Akeson RA. Gene 178, 1–5 (1996). 9. Abe K, Kusakabe Y, Tanemura K et al. FEBS Lett 316, 253-256 (1993). 10. Abe K, Kusakabe Y, Tanemura K et al. J Biol Chem 268, 12033–1203 (1993). 11. Kusakabe Y, Abe K, Tanemura K et al. Chem Senses 21, 335–340 (1996). 12. Matsuoka I, Mori T, Aoki J et al. Biochem Biophys Res Commun 194, 504–511 (1993). 13. Bruch RC and Medler KF. NeuroReport 7, 2941–2944 (1996). 14. Ngai J, Dowling MM, Buck L et al. Cell 72, 657–666 (1993). 15. Medler KF, Tran HN, Parker JM et al. J Neurobiol 35, 94–104 (1998). 16. Ngai J, Chess A, Dowling MM et al. Cell 72, 667–680 (1993). ACKNOWLEDGEMENTS: The authors thank Drs L. Liu and T. Gilbertson for providing catfish taste buds, Dr Gilbertson for critical reading of the manuscript and Dr S. Medler for photographic assistance. This work was supported by NIH grant DC001500 (to R.C.B.).

Received 9 September 1998; accepted 7 October 1998

Vol 9 No 18 21 December 1998

4107