MAP Kinase Kinase 6 –p38 MAP Kinase Signaling Cascade Regulates Cyclooxygenase-2 Expression in Cardiac Myocytes In Vitro and In Vivo Norbert Degousee, Joshua Martindale, Eva Stefanski, Martin Cieslak, Thomas F. Lindsay, Jason E. Fish, Philip A. Marsden, Donna J. Thuerauf, Christopher C. Glembotski, Barry B. Rubin Abstract—Cyclooxygenase-2 (COX-2) catalyzes the rate-limiting step in delayed prostaglandin biosynthesis. The purpose of this study was to evaluate the role of the MAP kinase kinase 6 (MKK6)–p38 MAPK signaling cascade in the regulation of myocardial COX-2 gene expression, in vitro and in vivo. RT-PCR analysis identified p38␣ and p382 MAPK mRNA in rat cardiac myocytes. Interleukin-1 induced the phosphorylation of p38␣ and p382 MAPK in cardiomyocytes and stimulated RNA polymerase II binding to the COX-2 promoter, COX-2 transcription, COX-2 protein synthesis, and prostaglandin E2 (PGE2) release. Infecting cardiomyocytes with adenoviruses that encode mutant, phosphorylation-resistant MKK6 or p382 MAPK inhibited interleukin-1–induced p38 MAPK activation, COX-2 gene expression, and PGE2 release. Treatment with the p38␣ and p382 MAPK inhibitor, SB202190, attenuated interleukin-1–induced COX-2 transcription and accelerated the degradation of COX-2 mRNA. Cells infected with adenoviruses encoding wild-type or constitutively activated MKK6 or p382 MAPK, in the absence of interleukin-1, exhibited increased cellular p38 MAPK activity, COX-2 mRNA expression, and COX-2 protein synthesis, which was blocked by SB202190. In addition, elevated levels of COX-2 protein were identified in the hearts of transgenic mice with cardiac-restricted expression of wild-type or constitutively activated MKK6, in comparison with nontransgenic littermates. These results provide direct evidence that MKK6 mediated p38 MAPK activation is necessary for interleukin-1–induced cardiac myocyte COX-2 gene expression and PGE2 biosynthesis in vitro and is sufficient for COX-2 gene expression by cardiac myocytes in vitro and in vivo. (Circ Res. 2003;92:757-764.) Key Words: MAP kinase kinase 6 䡲 prostaglandins 䡲 recombinant proteins 䡲 transgenic mice
C
yclooxygenase (COX) catalyzes the rate-limiting step in prostaglandin (PG) biosynthesis.1 Two isoforms of COX have been identified, COX-1 and COX-2.2 In myocardium, COX-1 is constitutively expressed, whereas COX-2 expression is induced by proinflammatory cytokines, such as interleukin-1 (IL-1).3 Serum IL-1 and myocardial COX-2 levels are elevated in patients with congestive heart failure4,5 and ischemia,6 and COX-2 colocalizes with areas of myocardial inflammation and scarring.5 Therefore, IL-1–induced COX-2 gene expression and prostaglandin biosynthesis may play a role in the pathogenesis of some cardiac diseases. In contrast, COX-2 metabolites protect against endotoxininduced cardiac contractile dysfunction7 and oxidantmediated cardiomyocyte injury,8 and mediate the protective effects of ischemic preconditioning.9 Therefore, COX-2 may exert both beneficial and deleterious effects in the heart.6 Mitogen-activated protein kinase (MAPK) enzymes, including p38 MAPK, p42/44 MAPK, and c-Jun N-terminal
kinase (JNK), have been implicated in the regulation of COX-2 gene expression in a variety of tissues.8,10,11 However, the signal transduction pathways and transcription factors that regulate the induction of COX-2 gene expression are extremely diversified and are both cell- and species-specific.11 For example, the promoter region of the rat COX-2 gene contains a binding site for NF-B,10 whereas the mouse COX-2 promoter does not,11 and a cAMP response element (CRE) is necessary for the induction of COX-2 transcription in murine fibroblasts,12 whereas the rat COX-2 promoter lacks a CRE.11 Similarly, the transcription factor C/EBP is essential for the inducible expression of the COX-2 gene in murine macrophages, but not in murine fibroblasts.13 These findings emphasize the differences that exist in the regulation of COX-2 gene expression in different cells and illustrate the need to specifically evaluate the molecular mechanisms that regulate COX-2 gene expression in cardiac myocytes.
Original received September 23, 2002; resubmission received February 4, 2003; revised resubmission received March 6, 2003; accepted March 11, 2003. From the Division of Vascular Surgery (N.D., E.S., M.C., T.F.L., B.B.R.), Toronto General Hospital, Toronto, Ontario; San Diego State University Heart Institute and the Department of Biology (J.M., D.J.T., C.C.G.), San Diego State University, San Diego, Calif; and Renal Division and Department of Medicine (J.E.F., P.A.M.), St Michael’s Hospital and University of Toronto, Toronto, Ontario. Correspondence to Barry B. Rubin, Division of Vascular Surgery, 200 Elizabeth St, EC5-302a, Toronto General Hospital, Toronto, Ontario, Canada M5G-2C4; e-mail
[email protected] or Christopher C. Glembotski, Department of Biology, San Diego State University, 5500 Campanile Dr, San Diego, CA 92182; e-mail
[email protected] © 2003 American Heart Association, Inc. Circulation Research is available at http://www.circresaha.org
DOI: 10.1161/01.RES.0000067929.01404.03
757 Downloaded from http://circres.ahajournals.org/ by guest on January 24, 2016
758
Circulation Research
April 18, 2003
Plasmids pcDNA3 FLAG-MKK6(Glu) codes for activated human MKK6 and has Glu substitutions at Ser207 and Thr211. pcDNA3 HA-MKK6b(A) contains Ala substitutions at Ser207 and Thr211. Sr3 HA-p38-2 codes for wild-type human p38-2 MAPK. p38-2 MAPK is distinct from p38␣, p38␥, and p38␦ but is identical to human p382 MAPK.17 pcDNA3 HA-p38-2(AGF) was prepared by converting Thr181 and Tyr 183 to Ala and Phe, respectively, using site-directed mutagenesis.18
Adenoviruses
Figure 1. IL-1 induces p38␣ and p382 MAPK phosphorylation in rat cardiomyocytes. A, RT-PCR analysis of DNA-free RNA from rat cardiomyocytes for p38␣ and p382 MAPK. Molecular weight markers (bp) are shown. Western blots for B, phosphorylated p38␣ MAPK and C, total p38␣ MAPK. After anti-p382 MAPK immunoprecipitation, Western blots for D, phosphorylated threonine residues, and E, total p382 MAPK. Representative results from ⱖ3 independent experiments are shown.
Studies with pharmacological inhibitors have suggested a role for p38 and p42/44 MAPK in the regulation of IL-1– induced cardiomyocyte COX-2 gene expression in vitro,3 but may be complicated by the potential lack of specificity of the pharmacological agents that were employed.14,15 p38 MAPK activity is increased by phosphorylation on Thr181 and Tyr183 by two MKK enzymes, MKK3 and MKK6. MKK6 activity is increased by phosphorylation on Ser207 and Thr211. By overexpressing a phosphorylation-resistant MKK6 mutant, we showed that MKK6-mediated p38 MAPK phosphorylation is necessary for IL-1 induced group IIA phospholipase A2 (PLA2) expression in rat cardiomyocytes.16 The role of MKK6 activation in COX-2 gene expression in cardiomyocytes in vitro, and the molecular events that regulate COX-2 expression in the heart in vivo have not been explored. In this study, we show that activation of the MKK6 –p38 MAPK signaling cascade: (1) stimulates COX-2 mRNA transcription and promotes COX-2 mRNA stability, (2) is sufficient to induce COX-2 gene expression by cardiomyocytes in vitro and transgenic mice in vivo, and (3) is necessary for IL-1–induced COX-2 gene expression and prostaglandin biosynthesis by cardiomyocytes in vitro.
Materials and Methods Cell Culture and Experimental Protocol Rat neonatal cardiac myocytes were isolated from the hearts of 1- to 2-day-old Sprague-Dawley rats.16 Cells were incubated with inhibitors or adenoviral vectors, as indicated in the Figure legends, and then treated with vehicle or IL-1 (10 ng/mL) for up to 48 hours. In all studies, isolated cells had characteristic features of cardiac myocytes and beat spontaneously. The methodology for RNA isolation, Northern, and Western blot analysis has been described.16 All studies were approved by the Animal Care Committee of the Toronto General Hospital.
The preparation of recombinant adenoviruses encoding FLAGtagged human MKK6(wt) [ad-MKK6(wt)], ad-MKK6(Glu), adMKK6(A), HA-tagged p382 MAPK(wt) [ad-p382 MAPK(wt)], and ad-p382 MAPK(AGF) was performed as described.16 Viral titers were determined by observing GFP fluorescence of primary cultures of neonatal cardiomyocytes, and the minimum quantity of viral stock that afforded 100% infection efficiency was used. The RT-PCR analysis of p38␣ and p382 MAPK mRNA, assessment of phosphorylated and total p38␣ and p382 MAPK levels, FLAG immunoprecipitation and MKK6 kinase assay, HA immunoprecipitation and p38 MAPK kinase assay, measurement of RNA Pol II recruitment to the COX-2 promoter, nuclear run off assays, assessment of COX-2 mRNA stability, generation of MKK6(wt) and MKK6(Glu) transgenic mice, preparation of lysates of cultured rat cardiomyocytes and ventricular tissue from transgenic mice, and statistical analysis are described in the expanded Materials and Methods available in the online data supplement at http://www.circresaha.org.
Results IL-1 Induces COX-2 mRNA Expression, COX-2 Protein Synthesis, and PGE2 Release by Rat Neonatal Cardiomyocytes COX-2 mRNA was not detected in unstimulated cardiomyocytes after incubation for up to 48 hours. Treatment with IL-1 induced an increase in COX-2 mRNA that peaked by 24 hours, and had no effect on GAPDH mRNA levels (online Figures 1A and 1B, available in the online data supplement at http://www.circresaha.org). IL-1 had no effect on cellular COX-1 protein levels, but resulted in a progressive increase in COX-2 protein and PGE2 release, which peaked after 24 hours (online Figures 1C through 1E, respectively). These results are consistent with the notion that IL-1 induces COX-2 mRNA transcription, COX-2 protein synthesis, and PGE2 release by cardiomyocytes.
p38␣ and p382 MAPK Are Both Phosphorylated in Rat Neonatal Cardiomyocytes After Exposure to IL-1
To determine if p38␣ and/or p382 MAPK exist in rat myocardium, RT-PCR analysis of rat neonatal cardiac myocyte RNA was carried out. RT-PCR products of approximately 700 and 600 bp were identified when primer sets based on the sequences of rat p38␣ MAPK and mouse p382 MAPK were used (Figure 1A). Sequence analysis demonstrated 100% homology of the 706-bp RT-PCR product with nucleotides 33 to 738 of rat p38␣ MAPK mRNA, and 94% homology of the 602-bp RT-PCR product with nucleotides 128 to 729 of mouse p382 MAPK. These results are consistent with the notion that rat cardiomyocytes express p38␣ and p382 MAPK mRNA.
Downloaded from http://circres.ahajournals.org/ by guest on January 24, 2016
Degousee et al
MKK6 and p38 MAPK Regulate COX-2 Gene Expression
759
Treatment with IL-1 induced the phosphorylation of p38␣ MAPK, but had no effect on total cellular p38␣ MAPK protein levels (Figures 1B and 1C). The phospho-p38 MAPKspecific antiserum that was used to identify phosphorylation of p38␣ MAPK did not reliably detect p382 MAPK phosphorylation, and we are not aware of any phospho-p382 MAPK-specific antiserum. To identify p382 MAPK phosphorylation, cell lysates were immunoprecipitated with antip382 MAPK antiserum, followed by Western blotting with anti-phosphothreonine antiserum. IL-1 induced p382 MAPK threonine phosphorylation (Figure 1D), but had no effect on total cellular p382 MAPK protein levels (Figure 1E). These results demonstrate that IL-1 induces the phosphorylation of both p38␣ and p382 MAPK in rat neonatal cardiomyocytes.
Infection With ad-MKK6(A) Inhibits IL-1–Induced COX-2 mRNA Expression, COX-2 Protein Synthesis, and PGE2 Release by Cardiomyocytes Infection with the adenovirus encoding the constitutively activated MKK6 mutant, ad-MKK6(Glu), leads to a 6-fold increase in p38 MAPK phosphorylation and an 8-fold increase in MAPKAP-K2 activity in rat neonatal cardiac myocytes.16,18 In contrast, infection with the adenovirus encoding the phosphorylation-resistant MKK6 mutant, adMKK6(A), which functions as a dominant-negative mutant for IL-1–induced group IIA PLA2 expression in neonatal cardiac myocytes,16 abrogates IL-1–induced increases in cellular MKK6 activity and p38 MAPK phosphorylation, as described later. Infection with ad-MKK6(wt) or ad-MKK6(Glu) resulted in the expression of COX-2 mRNA in the absence of IL-1 (Figure 2A). The IL-1 induced increase in COX-2 mRNA was augmented by infection with ad-MKK6(Glu), but was significantly attenuated by infection with ad-MKK6(A) (Figure 2A). ad-GFP, ad-MKK6(wt), ad-MKK6(A), or adMKK6(Glu) infection did not have a significant effect on cellular GAPDH mRNA levels (Figure 2B). Infection with ad-MKK6(Glu), and to a lesser extent ad-MKK6(wt), led to COX-2 protein synthesis in the absence of IL-1. In the presence of IL-1, ad-GFP–, ad-MKK6(wt)–, and adMKK6(Glu)–infected cells expressed markedly elevated levels of COX-2 protein. In contrast, infection with adMKK6(A) significantly attenuated the IL-1–induced increase in COX-2 protein synthesis (Figure 2C). IL-1– and ad-MKK6(Glu)–induced COX-2 protein synthesis were both attenuated by preincubation with the p38␣ and p382 inhibitor, SB20219019 (online Figure 2). To document the functionality of ad-MKK6(wt), adMKK6(A), and ad-MKK6(Glu), lysates of infected cardiomyocytes were immunoprecipitated with anti-FLAG antiserum, and the ability of the immunoprecipitate to phosphorylate the kinase-dead MKK6 substrate, HA-p382 MAPK(K53R), was assessed. Infection with ad-MKK6(Glu) resulted in more HA-p382 MAPK(K53R) phosphorylation than when cells were infected with ad-MKK6(wt), whereas no HA-p382 MAPK(K53R) phosphorylation was noted in ad-MKK6(A)–infected cells (Figure 3D). HA-p38  2 MAPK(K53R) phosphorylation was not detected in lysates of
Figure 2. MKK6 regulates COX-2 mRNA expression, COX-2 protein synthesis, and PGE2 release by cardiomyocytes. Cells were infected with ad-GFP, ad-MKK6(wt), ad-MKK6(A) ,or ad-MKK6(Glu) and incubated with (⫹) or without (⫺) 10 ng/mL IL-1. A, COX-2 and (B) GAPDH mRNA levels, Northern blot analysis. C, COX-2 levels, Western blot analysis. D, anti-FLAG immunoprecipitation and incubation with HA-p382 MAPK(K53R), Western blot analysis with anti-phospho p38␣/2 MAPK antiserum. E, Western blots with anti-FLAG or (F) antitubulin antiserum. Representative results from 4 independent experiments are shown. G, Cells were incubated with vehicle (open bars) or IL-1 (filled bars), and PGE2 release was measured by ELISA. Results are the mean⫾SD of 3 independent experiments, measured in duplicate. RM-ANOVA, P⬍0.0002. *P⬍0.007, ad-MKK6(Glu) vs ad-GFP; **P⬍0.004, ad-MKK6(wt) or ad-MKK6(Glu) vs ad-GFP; ***P⬍0.002, ad-MKK6(A) vs ad-GFP.
ad-GFP infected cells, as these cells do not contain FLAGtagged MKK6. IL-1 increased HA-p382 MAPK(K53R) phosphorylation in ad-MKK6(wt)–infected cells, and had no effect on HA-p382 MAPK(K53R) phosphorylation in adMKK6(Glu)–infected cells. In contrast, no HA-p382 MAPK(K53R) phosphorylation was identified in adMKK6(A)–infected, IL-1–treated cells. To assess total cellular MKK6 activity (ie, FLAG-tagged and endogenous MKK6), lysates were incubated with HA-p38  2 MAPK(K53R) and then evaluated by Western blotting with anti-phospho p38 MAPK antiserum. We found that total cellular MKK6 activity was identical to the MKK6 activity measured with the FLAG-IP assay (data not shown). Differences in cellular COX-2 mRNA expression, COX-2 protein synthesis, and MKK6 activity in cells infected with adMKK6(wt), ad-MKK6(Glu), or ad-MKK6(A) were not due to differences in the expression of the wild-type or mutant MKK6 enzymes (anti-FLAG immunoblot, Figure 2E). Infection with ad-GFP, ad-MKK6(wt), ad-MKK6(Glu), or adMKK6(A) had no effect on cellular levels of tubulin, a constitutively expressed protein (Figure 2F). To assess the role of MKK6 in cardiac myocyte PGE2 release, cells were infected with ad-GFP, ad-MKK6(wt),
Downloaded from http://circres.ahajournals.org/ by guest on January 24, 2016
760
Circulation Research
April 18, 2003
Figure 3. p38 MAPK regulates COX-2 mRNA expression, COX-2 protein synthesis, and PGE2 release by cardiomyocytes. Cells were infected with ad-GFP, ad-p382 MAPK(wt), or ad-p382 MAPK(AGF) and incubated with (⫹) or without (⫺) 10 ng/mL IL-1. A, COX-2 and (B) GAPDH mRNA levels, Northern blot analysis. C, COX-2 protein levels, Western blot analysis. D, HA immunoprecipitation, phosphorylation of ATF-2, Western blot analysis (index of p382 MAPK activity). E, HA and (F) tubulin levels, Western blot analysis. Representative results from ⱖ3 independent experiments are shown. G, Cells were incubated with vehicle (open bars) or IL-1 (filled bars), and PGE2 release was measured by ELISA. Results are the mean⫾SD of 3 independent experiments, measured in duplicate. RM-ANOVA, P⬍0.0005. *P⬍0.006, ad-p382 MAPK(wt) vs ad-GFP; **P⬍0.008, ad-p382 MAPK(wt) vs ad-GFP; ***P⬍0.002, ad-p382 MAPK(AGF) vs ad-GFP.
ad-MKK6(Glu), or ad-MKK6(A) and treated with vehicle or IL-1. Infection with ad-MKK6(Glu), without IL-1, resulted in PGE2 release (Figure 2G). IL-1–induced PGE2 release was significantly increased by infection with adMKK6(wt) or ad-MKK6(Glu) in comparison with ad-GFP– infected cells. In contrast, infection with ad-MKK6(A) decreased IL-1–induced PGE2 release by approximately 50% (Figure 2G). These results provide direct evidence that (1) MKK6 activation is sufficient for COX-2 mRNA expression, COX-2 protein synthesis, and PGE2 release by cardiomyocytes, and (2) that MKK6 activation is necessary for IL-1– induced COX-2 mRNA expression, COX-2 protein synthesis, and PGE2 release by cardiomyocytes in vitro.
Infection With ad-p382 MAPK(AGF) Inhibits IL-1–Induced COX-2 mRNA Expression, COX-2 Protein Synthesis, and PGE2 Release by Cardiomyocytes
Infection with the adenovirus encoding wild type p382 MAPK, ad-p382 MAPK(wt), leads to a dramatic increase in cellular p38 MAPK activity. Conversely, infection with the adenovirus encoding the phosphorylation-resistant p382 MAPK mutant, p382 MAPK(AGF), which functions as a
dominant-negative mutant for ␣B-crystallin gene expression in neonatal cardiac myocytes,18 abrogates IL-1–induced increases in cellular p38 MAPK activity, as described later. Infection with ad-p382 MAPK(wt) induced COX-2 mRNA expression in the absence of IL-1 (Figure 3A). COX-2 mRNA levels were higher in ad-p382 MAPK(wt)– infected, IL-1–treated cells than ad-GFP–infected, IL-1– treated cells, but were significantly attenuated in ad-p382 MAPK(AGF)–infected, IL-1–treated cells (Figure 3A). Infection with ad-GFP, ad-p382 MAPK(wt), or ad-p382 MAPK(AGF) had no effect on cellular GAPDH mRNA levels (Figure 3B). Exposure to IL-1 or infection with ad-p382 MAPK(wt) both induced COX-2 protein synthesis. The IL-1–induced increase in COX-2 protein synthesis was significantly attenuated by infection with ad-p382 MAPK(AGF) (Figure 3C). To measure the kinase activity of HA-tagged p382 MAPK(wt) and HA-tagged p382 MAPK(AGF), cell lysates were immunoprecipitated with an anti-HA antibody, and phosphorylation of the p382 MAPK substrate ATF2 was assessed. Infection with ad-p382 MAPK(wt) resulted in significant cellular p382 MAPK activity, which was abrogated when cells were infected with ad-p382 MAPK(AGF) and then treated with vehicle or IL-1 (Figure 3D). ATF2 phosphorylation was not detected in lysates of ad-GFP– infected cells, which do not contain HA-tagged p382 MAPK (Figure 3D). Differences in cellular p382 MAPK activity, COX-2 mRNA expression, and COX-2 protein synthesis in cells infected with ad-p382 MAPK(wt) or ad-p382 MAPK(AGF) were not due to differences in cellular levels of the expressed wild-type or mutant HAtagged p382 MAPK enzymes (anti-HA immunoblot, Figure 3E). Infection with ad-GFP, ad-p382 MAPK(wt), or adp382 MAPK(AGF) had no effect on cellular levels of tubulin (Figure 3F). To assess the role of p382 MAPK in cardiac myocyte PGE2 release, cells were infected with ad-GFP, ad-p382 MAPK(wt), or ad-p382 MAPK(AGF) and then treated with vehicle or IL-1. Infection with ad-p382 MAPK(wt), in the absence of IL-1, resulted in PGE2 release (Figure 3G). Infection with ad-p382 MAPK(wt) significantly increased IL-1–induced PGE2 release, whereas infection with adp382 MAPK(AGF) decreased IL-1–induced PGE2 release 65% (Figure 3G). These results provide direct evidence that p382 MAPK activation is sufficient for COX-2 mRNA expression, COX-2 protein synthesis, and PGE2 release by unstimulated cardiomyocytes, and that p382 MAPK activation is necessary for IL-1–induced COX-2 mRNA expression, COX-2 protein synthesis, and PGE2 release by rat cardiomyocytes in vitro. Infection with ad-MKK6(A) or ad-p382 MAPK(AGF) obliterated IL-1–induced p38 MAPK(K53R) (Figure 2) and ATF2 phosphorylation, respectively, but only partially inhibited IL-1–induced COX-2 protein synthesis and PGE2 release. Therefore, signaling cascades other than the MKK6 – p38 MAPK pathway are likely to participate in the regulation of IL-1–induced COX-2 protein synthesis and PGE2 biosynthesis in cardiac myocytes.
Downloaded from http://circres.ahajournals.org/ by guest on January 24, 2016
Degousee et al
MKK6 and p38 MAPK Regulate COX-2 Gene Expression
Figure 4. IL-1–stimulated COX-2 mRNA transcription is partially regulated by p38 MAPK. A, Cells were treated with 0.1% DMSO or 10 ng/mL IL-1 for 4 hours. Number of copies of the COX-2 promoter immunoprecipitated by the RNA Pol II antibody was determined by real-time quantitative PCR. Fold enrichment was determined by subtracting the number of copies of COX-2 promoter bound in a no antibody control immunoprecipitation, normalizing for input. Results from one of 3 representative experiments, performed in triplicate, are shown. B, Cells were preincubated with (⫹) or without (⫺) 10 mol/L SB202190 for 30 minutes, treated with (⫹) or without (⫺) 10 ng/mL IL-1 for 4 hours, and the transcription of COX-2 and GAPDH mRNA was assessed by nuclear run off assay. C, COX-2/GAPDH mRNA ratio in 3 separate runoff experiments. 0.1% DMSO (open bars), SB202190 (filled bars). RM-ANOVA, P⬍0.008. *P⬍0.01 vs DMSO; **P⬍0.01 vs IL-1⫹DMSO.
IL-1 Induces RNA Pol II Recruitment to the COX-2 Promoter In order to elucidate the effect of IL-1 treatment on RNA Pol II recruitment to the COX-2 proximal promoter, chromatin immunoprecipitation was performed using an RNA Pol II-specific antibody. No significant loading of RNA Pol II was detected at the COX-2 promoter in unstimulated cells. In contrast, treatment with IL-1 for 4 hours led to an increase in RNA Pol II association with the rat COX-2 promoter (Figure 4A).
p38 MAPK Partially Regulates COX-2 mRNA Transcription and COX-2 mRNA Stability To define the potential role of p38 MAPK in COX-2 mRNA transcription, cells were preincubated with vehicle or SB202190 for 30 minutes and then incubated with DMSO or IL-1 for 4 hours. COX-2 and GAPDH mRNA transcriptions were then assessed by nuclear run-off assay.20 IL-1 increased COX-2 transcription 16-fold (Figures 4B and 4C), a result consistent with the robust increase in RNA Pol II recruitment to the COX-2 promoter after exposure to IL-1. Preincubation with SB202190 had no effect on COX-2 transcription in vehicle-treated cells, but decreased COX-2 transcription 58% in cells treated with IL-1 (Figures 4B and 4C).
761
To assess the potential role of p38 MAPK in the stabilization of COX-2 mRNA, cells were incubated with IL-1 for 16 hours, treated with vehicle or SB202190, and then incubated with actinomycin D, which arrests transcription. Exposure to actinomycin D for 1 hour decreased the ratio of COX-2 to GAPDH mRNA by 40%. In contrast, treatment with SB202190 and subsequent exposure to actinomycin D for 1 hour decreased the ratio of COX-2 to GAPDH mRNA by 90% (Figures 5A and 5B). To selectively study the role of p38 MAPK in COX-2 mRNA stability, cells were infected with ad-p382 MAPK(wt) for 16 hours, treated with vehicle or SB202190, and then incubated with actinomycin D. Exposure to actinomycin D for 1 hour decreased the ratio of COX-2 to GAPDH mRNA by 48%. In contrast, infection with ad-p382 MAPK(wt), followed by incubation with SB202190 and subsequent exposure to actinomycin D for 1 hour, decreased the ratio of COX-2 to GAPDH mRNA by 87% (Figures 5C and 5D). Taken together, these results provide direct evidence that p38 MAPK partially regulates COX-2 mRNA transcription and COX-2 mRNA stability in rat neonatal cardiomyocytes.
Cardiac-Restricted Expression of MKK6(wt) or MKK6(Glu) Results in Ventricular COX-2 Protein Synthesis To begin to assess the role of the MKK6 –p38 MAPK signaling cascade in myocardial COX-2 expression in vivo, ventricular tissue from tg-MKK6(wt) or tg-MKK6(Glu) mice, or from nontransgenic control littermates, was evaluated for COX-2, MKK6, and tubulin protein levels. Trace amounts of COX-2 protein were identified in ventricular tissues from nontransgenic mice (Figure 6A). In contrast, there was a marked increase in COX-2 protein in ventricular tissue from both tg-MKK6(wt) and tg-MKK6(Glu) mice. MKK6 protein was not identified in ventricular tissue from control mice, was significantly elevated in ventricular tissue from tg-MKK6(wt) mice, and was about 5-fold lower in ventricular tissue from tg-MKK6(Glu) mice, in comparison with tg-MKK6(wt) mice (Figure 6B). This is consistent with the observation that ventricular tissue from tg-MKK6(wt) mice has approximately 3- to 5-fold higher MKK6 activity, as measured by the ability of ventricular lysates to phosphorylate p382 MAPK(K53R), than ventricular tissue from tg-MKK6(Glu) mice (J. Martindale, C. Glembotski, unpublished data, 2003). All mice expressed similar levels of tubulin in ventricular tissue (Figures 6C). Taken together, these results constitute the first direct evidence that overexpression of MKK6(wt) or MKK6(Glu) is sufficient to induce COX-2 protein synthesis in ventricular tissue in vivo.
Discussion In this study, we have presented 3 independent lines of evidence that demonstrate that activation of the MKK6 –p38 MAPK signaling cascade is sufficient to induce COX-2 expression in cardiac myocytes. First, overexpression of MKK6(wt), MKK6(Glu), or p382 MAPK(wt) increased COX-2 mRNA expression and COX-2 protein synthesis by cardiomyocytes in the absence of IL-1. Second, infection with ad-MKK6(Glu) induced an increase in COX-2 protein
Downloaded from http://circres.ahajournals.org/ by guest on January 24, 2016
762
Circulation Research
April 18, 2003
Figure 6. Cardiac-restricted expression of MKK6(wt) or MKK6(Glu) induces myocardial COX-2 gene expression. A, COX-2, (B) MKK6, and (C) tubulin protein levels in ventricular tissue from tg-MKK6(wt), tg-MKK6(Glu), or nontransgenic littermates, Western blot analysis. Representative results from 3 nontransgenic, tg-MKK6(wt), and tg-MKK6(Glu) mice are shown.
Figure 5. p38 MAPK partially regulates COX-2 mRNA stability. Cells were incubated with A, IL-1 for 16 hours, treated with (⫹) or without (⫺) 10 mol/L SB202190 and immediately incubated with (⫹) or without (⫺) 5 g/mL actinomycin D for up to 6 hours, followed by Northern blot analysis for COX-2 and GAPDH mRNA levels. B, COX-2/GAPDH mRNA ratio in 3 separate experiments. IL-1 (filled bars), IL-1⫹SB202190 (open bars). *P⬍0.001 vs IL-1. C, Cells were infected with ad-p382 MAPK(wt) for 16 hours, treated with (⫹) or without (⫺) 10 mol/L SB202190, and then immediately incubated with actinomycin D. COX-2 and GAPDH mRNA levels were measured by Northern blot analysis. D, COX-2/GAPDH mRNA ratio in 3 separate experiments. ad-p382 MAPK(wt) (filled bars), ad-p382 MAPK(wt)⫹SB202190 (open bars). *P⬍0.001 vs IL-1.
synthesis that was attenuated by the selective p38␣ and p382 MAPK inhibitor, SB202190.19 Third, cardiacrestricted expression of MKK6(wt) or MKK6(Glu) in transgenic mice, which results in increased ventricular MKK6 protein levels (Figure 6) and increased MKK6 activity (J. Martindale, C. Glembotski, unpublished data, 2003), induced
myocardial COX-2 protein synthesis in vivo. To our knowledge, this is the only study that has documented the role of MKK6 in COX-2 gene expression in cardiomyocytes, in vitro or in vivo. Exposure to IL-1 led to recruitment of RNA Pol II to the COX-2 promoter and to transcription of the COX-2 gene. We have presented 3 independent lines of evidence that demonstrate that activation of the MKK6 –p38 MAPK signaling cascade is necessary for IL-1–induced COX-2 gene expression in cardiomyocytes. Thus, overexpression of either MKK6(A) or p382 MAPK(AGF), mutated enzymes that cannot be phosphorylated and activated by their respective upstream kinases, inhibited IL-1–induced increases in COX-2 mRNA expression, COX-2 protein synthesis, and PGE2 release by cardiomyocytes. Therefore, MKK6(A) and p382 MAPK(AGF) functioned as dominant-negative mutants for IL-1–induced COX-2 gene expression and prostaglandin biosynthesis by cardiomyocytes. In addition, pretreatment with the p38 MAPK inhibitor SB202190 attenuated IL-1–induced cardiac myocyte COX-2 mRNA transcription in vitro and COX-2 protein synthesis in intact cardiac myocytes. These results provide direct evidence that IL-1 stimulates MKK6 –p38 MAPK– dependent myocardial COX-2 gene expression and PGE2 biosynthesis. The findings that p38 MAPK regulates COX-2 gene expression in cardiac myocytes by increasing COX-2 mRNA transcription and by stabilizing COX-2 mRNA are consistent with previous reports in other cell types.21,22 Whereas our results provide clear evidence that the MKK6 –p38 MAPK signaling cascade participates in the regulation of COX-2 gene expression, 4 independent lines of evidence support the notion that other signaling cascades also participate in the regulation of the COX-2 gene in cardiac myocytes. First, infection with ad-MKK6(A) or ad-p382 MAPK(AGF), which obliterated IL-1–induced p382 MAPK(K53R) and ATF2 phosphorylation, respectively, only partially inhibited IL-1–induced COX-2 protein synthesis and PGE2 release. Second, COX-2 mRNA and COX-2 protein levels, and PGE2 release, were significantly higher in ad-GFP–infected, IL-1  –treated cells than in adMKK6(Glu)–infected, vehicle-treated cells (Figure 2). Third, ad-MKK6(Glu)-infected, IL-1–treated cells had signifi-
Downloaded from http://circres.ahajournals.org/ by guest on January 24, 2016
Degousee et al
MKK6 and p38 MAPK Regulate COX-2 Gene Expression
cantly higher levels of COX-2 mRNA and COX-2 protein, and released more PGE2 than ad-MKK6(Glu)–infected, vehicle-treated cells, but had similar degrees of MKK6 activity. Fourth, treatment with PD098059, which inhibits MEK1,2-mediated extracellular signal-regulated kinase (ERK) 1,2 and MEK5-mediated ERK5 phosphorylation,14 has been shown to inhibit IL-1–induced COX-2 protein synthesis in cardiomyocytes.3 Taken together, these finding indicate that IL-1–induced COX-2 gene expression and PGE2 release by cardiomyocytes involves the activation of p38 MAPK and additional signaling molecules, such as ERK or JNK, which participate in the regulation of COX-2 gene expression in some cells.23 p38␣ MAPK may promote cardiomyocyte apoptosis, whereas p382 MAPK may induce myocardial hypertrophy and cell survival.24 Therefore, it is possible that p38␣ and p382 MAPK, which are both phosphorylated after cardiac myocytes are treated with IL-1, may play distinct roles in the regulation of myocardial genes, such as COX-2. Overexpression of p382 MAPK(AGF) inhibited IL-1–induced COX-2 gene expression in cultured cardiomyocytes (Figure 3), thereby implicating the p382 MAPK isoform in the regulation of myocardial COX-2 gene expression. p382 MAPK(AGF) overexpression did not inhibit IL-1–induced p38␣ MAPK phosphorylation in rat neonatal cardiomyocytes (N. Degousee, B. Rubin, unpublished observation, 2003). However, the results of these experiments do not permit us to definitively conclude that p382 MAPK selectively regulates cardiac myocyte COX-2 gene expression, as the comparatively high levels of p382 MAPK(AGF) that are expressed in myocytes that were infected with ad-p382 MAPK(AGF) could competitively inhibit the activity of phosphorylated p38␣ MAPK in these cells. Pharmacological inhibitors that selectively attenuate p38␣ or p382 MAPK activity, or viable animals with functional deletions of the p38␣ or p382 MAPK genes, are required to delineate the precise roles of p38␣ and p382 MAPK in the regulation of myocardial COX-2 gene expression. PGE2 synthesis is catalyzed by the sequential action of PLA2, COX, and PGE2 synthase. The coordinate, MKK6 –p38 MAPK-dependent expression of group IIA PLA216 and COX-2 induced by IL-1 may synergistically increase myocardial PGE2 biosynthesis, as cotransfection of group IIA PLA2 and COX-2 in HEK293 cells dramatically increases IL-1–induced prostanoid biosynthesis.25 Group IV PLA2 (cPLA2) may also supply arachidonic acid to COX-2 in cardiac myocytes, as exposure to IL-1 increases cPLA2 expression in these cells,16 and cotransfection of cPLA2 and COX-2 increases IL-1–induced PGE2 biosynthesis.25 Delayed PGE2 synthesis is mediated by a functional association between COX-2 and membrane PGE2 synthase (mPGES).26 As mPGES colocalizes with COX-2 in the perinuclear envelope, and mPGES expression is induced by IL-1,26 it is likely that mPGES catalyzes the conversion of PGH2 to PGE2 in IL-1–treated cardiomyocytes. Treating cardiomyocytes with IL-1 likely results in more PGE2 biosynthesis than infection with ad-MKK6(Glu) or ad-p382 MAPK(wt) (Figures 2 and 3) because IL-1 induces mPGES expression in rat cardiac myocytes, whereas adMKK6(Glu)
763
and ad-p382 MAPK(wt) do not (N. Degousee, B. Rubin, unpublished observation, 2003). Recently, p38 MAPK (and ERK1,2) were shown to regulate IL-1–induced mPGES expression in orbital fibroblasts.27 The role of the MKK6 – p38 MAPK signaling cascade in IL-1–induced mPGES expression in cardiac myocytes is currently being explored. In summary, our results provide direct evidence that activation of the MKK6 –p38 MAPK signaling cascade is sufficient to induce COX-2 gene expression by cardiac myocytes, in vitro and in vivo. In addition, we have shown that activation of the MKK6 –p38 MAPK signaling cascade is necessary for IL-1–induced cardiac myocyte COX-2 gene expression and PGE2 biosynthesis in vitro. These observations may lead to the development of novel pharmacogenomic therapies that could be used to modulate the expression of COX-2, the rate-limiting enzyme in prostaglandin biosynthesis in the heart.
Acknowledgments This work was supported by grants from the Heart and Stroke Foundation of Canada (NA-4387, B.B.R.), the Canadian Institutes of Health Research (53297 and 37778, B.B.R. and P.M., respectively), the physicians of Ontario through The P.S.I. Foundation (98-049 and 01-12, T.F.L. and B.B.R., respectively), and the National Institutes of Health (HL-63975 and NS/HL-25037, C.C.G.). B.B.R. is a Wylie Scholar in Academic Vascular Surgery, Pacific Vascular Research Foundation, San Francisco.
References 1. Smith WL, DeWitt DL, Garavito RM. Cyclooxygenases: structural, cellular, and molecular biology. Annu Rev Biochem. 2000;69:145–182. 2. Feng L, Sun W, Xia Y, Tang WW, Chanmugam P, Soyoola E, Wilson CB, Hwang D. Cloning two isoforms of rat cyclooxygenase: differential regulation of their expression. Arch Biochem Biophys. 1993;307: 361–368. 3. LaPointe MC, Isenovic E. Interleukin-1 regulation of inducible nitric oxide synthase and cyclooxygenase-2 involves the p42/44 and p38 MAPK signaling pathways in cardiomyocytes. Hypertension. 1999;33: 276 –282. 4. Orus J, Roig E, Perez-Villa F, Pare C, Azqueta M, Filella X, Heras M, Sanz G. Prognostic value of serum cytokines in patients with congestive heart failure. J Heart Lung Transplant. 2000;19:419 – 425. 5. Wong SC, Fukuchi M, Melnyk P, Rodger I, Giaid A. Induction of cyclooxygenase-2 and activation of nuclear factor-B in myocardium of patients with congestive heart failure. Circulation. 1998;98:100 –103. 6. Wu KK. Cyclooxygenase-2 induction in congestive heart failure: friend or foe? Circulation. 1998;98:95–96. 7. Grandel U, Fink L, Blum A, Heep M, Buerke M, Kraemer HJ, Mayer K, Bohle RM, Seeger W, Grimminger F, Sibelius U. Endotoxin-induced myocardial tumor necrosis factor-␣ synthesis depresses contractility of isolated rat hearts: evidence for a role of sphingosine and cyclooxygenase-2-derived thromboxane production. Circulation. 2000;102: 2758 –2764. 8. Adderley SR, Fitzgerald DJ. Oxidative damage of cardiomyocytes is limited by extracellular regulated kinases 1/2-mediated induction of cyclooxygenase-2. J Biol Chem. 1999;274:5038 –5046. 9. Shinmura K, Tang XL, Wang Y, Xuan YT, Liu SQ, Takano H, Bhatnagar A, Bolli R. Cyclooxygenase-2 mediates the cardioprotective effects of the late phase of ischemic preconditioning in conscious rabbits. Proc Natl Acad Sci U S A. 2000;97:10197–10202. 10. Sirois J, Levy LO, Simmons DL, Richards JS. Characterization and hormonal regulation of the promoter of the rat prostaglandin endoperoxide synthase 2 gene in granulosa cells: identification of functional and protein-binding regions. J Biol Chem. 1993;268:12199 –12206. 11. Wadleigh DJ, Reddy ST, Kopp E, Ghosh S, Herschman HR. Transcriptional activation of the cyclooxygenase-2 gene in endotoxin-treated RAW 264.7 macrophages. J Biol Chem. 2000;275:6259 – 6266.
Downloaded from http://circres.ahajournals.org/ by guest on January 24, 2016
764
Circulation Research
April 18, 2003
12. Xie W, Herschman HR. v-src induces prostaglandin synthase-2 gene expression by activation of the c-Jun N-terminal kinase and the c-Jun transcription factor. J Biol Chem. 1995;270:27622–27628. 13. Gorgoni B, Caivano M, Arizmendi C, Poli V. The transcription factor C/EBP is essential for inducible expression of the cyclooxygenase-2 gene in macrophages but not in fibroblasts. J Biol Chem. 2001;267: 40769 – 40777. 14. Kamakura S, Moriguchi T, Nishida E. Activation of the protein kinase ERK5/BMK1 by receptor tyrosine kinases: identification and characterization of a signaling pathway to the nucleus. J Biol Chem. 1999;274: 26563–26571. 15. Clerk A, Sugden PH. The p38-MAPK inhibitor, SB203580, inhibits cardiac stress-activated protein kinases/c-Jun N-terminal kinases. FEBS Lett. 1998;426:93–96. 16. Degousee N, Stefanski E, Lindsay TF, Ford DA, Shahani R, Andrews CA, Thuerauf DJ, Glembotski CC, Nevalainen TJ, Tischfield J, Rubin BB. p38 MAPK regulates group IIA phospholipase A2 expression in interleukin-1 stimulated rat neonatal cardiomyocytes. J Biol Chem. 2001;276:43842– 43849. 17. Enslen H, Raingeaud J, Davis RJ. Selective activation of p38 mitogenactivated protein (MAP) kinase isoforms by the MAP kinase kinases MKK3 and MKK6. J Biol Chem. 1998;273:1741–1748. 18. Hoover HE, Thuerauf DJ, Martindale JJ, Glembotski CC. ␣B-crystallin gene induction and phosphorylation by MKK6-activated p38: a potential role for ␣B-crystallin as a target of the p38 branch of the cardiac stress response. J Biol Chem. 2000;275:23825–23833. 19. Lee JC, Laydon JT, McDonnell PC, Gallagher TF, Kumar S, Green D, McNulty D, Blumenthal MJ, Heys JR, Landvatter SW. A protein kinase involved in the regulation of inflammatory cytokine biosynthesis. Nature. 1994;372:739 –746. 20. Bitzan MM, Wang Y, Lin J, Marsden PA. Verotoxin and ricin have novel effects on preproendothelin-1 expression but fail to modify nitric oxide
21.
22.
23.
24.
25.
26.
27.
synthase (ecNOS) expression and NO production in vascular endothelium. J Clin Invest. 1998;101:372–382. Ridley SH, Dean JL, Sarsfield SJ, Brook M, Clark AR, Saklatvala J. A p38 MAP kinase inhibitor regulates stability of interleukin-1-induced cyclooxygenase-2 mRNA. FEBS Lett. 1998;439:75– 80. Faour WH, He Y, He QW, de Ladurantaye M, Quintero M, Mancini A, Di Battista JA. Prostaglandin E2 regulates the level and stability of cyclooxygenase-2 mRNA through activation of p38 mitogen-activated protein kinase in interleukin-1 treated human synovial fibroblasts. J Biol Chem. 2001;276:31720 –31731. Subbaramaiah K, Chung WJ, Dannenberg AJ. Ceramide regulates the transcription of cyclooxygenase-2: evidence for involvement of extracellular signal-regulated kinase/c-Jun N-terminal kinase and p38 mitogen-activated protein kinase pathways. J Biol Chem. 1998;273:32943–32949. Zechner D, Thuerauf DJ, Hanford DS, McDonough PM, Glembotski CC. A role for the p38 mitogen-activated protein kinase pathway in myocardial cell growth, sarcomeric organization and cardiac-specific gene expression. J Cell Biol. 1997;139:115–127. Murakami M, Kambe T, Shimbara S, Kudo I. Functional coupling between various phospholipase A2s and cyclooxygenases in immediate and delayed prostanoid biosynthetic pathways. J Biol Chem. 1999;274: 3103–3115. Murakami M, Naraba H, Tanioka T, Semmyo N, Nakatani Y, Kojima F, Iikeda T, Fueki M, Ueno A, Oh S, Kudo I. Regulation of prostaglandin E2 biosynthesis by inducible membrane-associated prostaglandin E2 synthase that acts in concert with cyclooxygenase-2. J Biol Chem. 2000;275: 32783–32792. Han R, Tsui S, Smith TJ. Up-regulation of prostaglandin E2 synthesis by interleukin-1 in human orbital fibroblasts involves coordinate induction of prostaglandin-endoperoxide H synthase-2 and glutathione-dependent prostaglandin E 2 synthase expression. J Biol Chem. 2002;277: 16355–16364.
Downloaded from http://circres.ahajournals.org/ by guest on January 24, 2016
Page 1, MS #5349 / R1 Online supplemental information, N. Degousee et al. Manuscript title: The MAP kinase kinase 6 - p38 MAP kinase signaling cascade regulates cyclooxygenase-2 expression in cardiac myocytes in vitro and in vivo
Materials The selective p38α/β2 MAP kinase inhibitor SB202190 and mouse monoclonal antiserum specific for phosphothreonine (Clone 14B3) were obtained from Calbiochem (San Diego, CA). Rabbit polyclonal primary antibodies raised against p38α MAPK (sc-535), p38α/β2 MAPK (sc7149) and α-tubulin (sc-5546), as well as goat polyclonal primary antibodies raised against COX-1 (sc-1754), COX-2 (sc-1747), p38β2 MAPK (sc-6176) and MKK6 (sc-6073), and Protein G Plus-Agarose were from Santa Cruz Biotechnology Inc. (Santa Cruz, CA). Rabbit polyclonal antiserum specific for phospho-p38 MAPK (#9211), phospho-specific ATF2 (#9221) and GSTATF2 were from Cell Signaling Technology Inc. (Beverly, MA). Mouse monoclonal anti-HA and anti-FLAG antisera (clones HA-7 and M2, respectively) were from Sigma-Aldrich (Oakville, ONT). Horseradish peroxidase-linked anti-rabbit, anti-mouse or anti-goat secondary antibodies were from Pierce, Rockford, IL. Recombinant human IL-1β was from PeproTech Inc. (Rocky Hill, NJ). Taq Polymerase was from MBI Fermentas (Burlington, ONT) and mouse GAPDH cDNA was from Ambion (Austin, TX). LipofectAMINE 2000 was from Invitrogen Life Technologies (Burlington, ONT). The PGE2 ELISA kit was from Amersham Biosciences (Pointe Claire, PQ). The kinase-dead, MKK6 specific substrate GST-HA-p38β2 (K53R) MAPK was prepared as previously described (1). All other reagents were analytical or tissue culture grade, and were obtained from Sigma-Aldrich (Oakville, ONT). Dr. Brian P. Kennedy, MSD (Pointe Claire, PQ) kindly provided the rat COX-2 cDNA. pcDNA3 FLAG-MKK6(Glu) was obtained
Page 2, MS #5349 / R1 from R. J. Davis, University of Massachusetts (Worcester, MA) (2). MKK6(Glu) selectively phosphorylates p38 MAPK in cardiac myocytes, and does not phosphorylate either JNK1 or ERK2 in vitro (3,4). pcDNA3 HA-MKK6b(A) was originally obtained from J. Han, Scripps Institute (La Jolla, CA) (5). Sr3 HA-p38-2 was obtained from B. Stein, Signal Pharmaceuticals Inc. (San Diego, CA) (6).
Cell culture and experimental protocol When chemicals were dissolved in DMSO or ethanol, the identical concentrations of these solvents was added to controls. When indicated, cells were pretreated with the p38α/β2 MAPK inhibitor, SB202190 (10 µmol/L) for 30 min before the addition of DMSO or IL-1β, at 10 ng/ml, for up to 48 h. All experiments were done in triplicate and repeated 2-6 times. In all studies, cytotoxicity was assessed by monitoring the extracellular release of LDH and CK. Studies in which the release of LDH or CK exceeded > 5% of total cellular activity were excluded from further analysis.
RT-PCR analysis of p38α α and p38β β 2 MAPK Total cellular RNA was extracted from cardiac myocytes, treated with DNase I RNase-free and then converted to cDNA mixtures, exactly as described (7). PCR was performed in a 50 µl reaction containing 75 mmol/L Tris-Hcl, pH 8.8, 20 mmol/L (NH4)2SO4, 1.5 mmol/L MgCl2, 0.01% Tween 20, dNTP mix (0.2 mmol/L each), 2 units of Taq Polymerase (MBI Fermentas, Burlington, ON) and 0.4 µmol/L of the specific primers for p38α MAPK (forward primer: TTCTACCGGCAAGAGCTGAA; backward primer: CTGGGGTTCCAACGAGTCTT) and p38β2
MAPK
(forward
primer:
ACGCGCGGCTGCGCCAGAAG;
backward
primer:
Page 3, MS #5349 / R1 ACTGGGCGTGCCCACCAC CT). Primers were designed using EMBL DNA sequences corresponding to rat p38α MAPK (NM_031020) and mouse p38β2 MAPK (NM_011161). Expected sizes for the PCR products were 706 bp for p38α MAPK and 602 bp for p38β2 MAPK. After 4 min at 95C, 32 cycles of amplification with a PTC-100 Thermal Cycler (MJ Research, Waltham, MA) was carried out as follows: 30 s at 95C, 45 s at 60C, and 45 s at 72C followed by 10 min at 72C. Reverse transcription-PCR products were analyzed by 2.5% (w/v) agarose gel electrophoresis, and specificities were confirmed by DNA sequence analysis with an ABI Prism 377 DNA Sequencer (Applied Biosystems, Foster City, CA).
FLAG immunoprecipitation and MKK6 kinase assay Cells infected with ad-GFP, ad-MKK6(wt), ad-MKK6(Glu) or ad-MKK6(A) were lysed in buffer A, centrifuged, incubated with anti-FLAG antiserum for 16 hrs and immunoprecipitated with protein G Plus-Agarose for 3 hrs at 4C. Immunoprecipitates were washed 3 times with buffer A and resuspended in kinase buffer (25 mmol/L HEPES, pH 7.4, 25 mmol/L glycerophosphate, 25 mmol/L MgCl2, 0.5 mmol/L dithiothreitol, 0.1 mmol/L Na3VO4). Kinase reactions were initiated by addition of 2 µg of GFP-HA-p38β2 MAPK(K53R) and 200 µmol/L ATP in 40 µl of kinase buffer. After boiling in Laemmli buffer, samples were separated by SDSPAGE, transferred to PVDF and probed with anti-phospho p38 MAPK antiserum.
HA immunoprecipitation and p38 MAPK kinase assay Cells were infected with ad-p38β2 MAPK(wt) or ad-p38β2 MAPK(AGF), lysed, incubated with anti-HA antibody for 16 hrs and immunoprecipitated with protein G Plus-Agarose for 3 hrs at 4C. Immunoprecipitates were washed 3 times with buffer A and once with kinase buffer.
Page 4, MS #5349 / R1 Kinase reactions were initiated by addition of 1 µg of GST-ATF2 and 200 µmol/L ATP in 40 µl of kinase buffer. After 30 min at 30C, reactions were terminated by addition of Laemmli buffer and boiling. Phosphorylation of ATF2 was evaluated by western blot analysis with an antiphospho-ATF2 antibody.
Generation of MKK6(wt) and MKK6(Glu) transgenic mice The generation of transgenic mice with cardiac restricted expression of FLAG-MKK6(wt) [tg-MKK6(wt)] or FLAG-MKK6(Glu) [tg-MKK6(Glu)], and the phenotypic characterization of these mice, will be reported elsewhere.1 Mice that were non-transgenic littermates served as controls for studies with transgenic mice.
Preparation of total cell lysates of cultured rat cardiac myocytes In selected studies, cells were incubated in ice-cold lysis buffer A (50 mmol/L HEPES pH 7.5, 150 mmol/L NaCl, 1% Triton X-100, 10% glycerol, 10 mmol/L MgCl2, 1 mmol/L PMSF, 1 mmol/L Na3VO4, 25 mmol/L NaF, 0.5 mmol/L nitrophenyl phosphate, 5 mmol/L glycerophosphate, 2 mmol/L EDTA, 2 mmol/L EGTA, 10 µg/ml aprotinin, 10 µg/ml pepstatin and 10 µg/ml leupeptin). After 30 min the cell lysates were passed through a 21-gauge needle and centrifuged at 14,000×g for 10 min at 4C. Supernatants were stored at –20C for subsequent immunoblotting studies.
1
J. Martindale and C. Glembotski, submitted for publication.
Page 5, MS #5349 / R1 Preparation of lysates of ventricular tissue from transgenic mice 50 mg of ventricular tissue from 20 week old mice was placed in 0.5 ml of ice-cold lysis buffer A, homogenized for 2 min (Ultra-Turrax), dispersed by ultrasonication (Branford, 20% of maximum power) for 1 min on ice and centrifuged at 14,000×g for 10 min at 4C. The supernatant was then pre-cleared with 100 µl of protein G Plus-Agarose for 30 min at 4C, centrifuged at 5,000×g for 3 min at 4C and used for western blotting studies. The protein content of supernatant was determined using the BCA protein kit (Pierce).
Assessment of phosphorylated and total endogenous p38α α MAPK Cultured cardiac myocytes were solubilized in 1 ml of ice-cold lysis buffer A and centrifuged at 14,000×g for 10 min at 4C. The supernatant was then evaluated by western blot analysis with anti-p38α MAPK or anti-phospho p38α MAPK antisera.
Assessment of phosphorylated and total endogenous p38β β MAPK Cultured cardiac myocytes were solubilized in 1 ml of ice-cold lysis buffer A and centrifuged at 14,000×g for 10 min at 4C. The supernatant was then incubated with polyclonal anti-p38β2 MAPK antisera for 16 hrs, followed by protein G Plus-Agarose precipitation for 3 hrs at 4C. Immunoprecipitates were washed 3 times with buffer A, resuspended in Laemmli sample buffer, boiled and evaluated by western blot analysis with anti-p38β2 MAPK or anti-phospho-threonine antisera.
Page 6, MS #5349 / R1 Assessment of COX-2 mRNA stability To assess the role of p38 MAPK in the stability of COX-2 mRNA transcripts, confluent cardiac myocytes were infected with ad-GFP or ad-p38β2 MAPK(wt), and then treated for 16 hrs with vehicle or IL-1β at 10 ng/ml. Cells were then incubated with 0.1% DMSO or 10 µM SB202190 and immediately exposed to actinomycin D (5 µg/ml). Total cellular RNA was extracted at 0, 1, 3 and 6 hours after the addition of actinomycin D and analyzed by northern blotting using radiolabeled [32P] rCOX-2 cDNA probe prepared by the random priming method. Blots were then re-probed with a radiolabeled rGAPDH-cDNA probe to ensure equal loading, and COX-2 mRNA transcript levels were normalized to GAPDH mRNA levels.
Chromatin Immunoprecipitation (ChIP) ChIP was performed using the ChIP Assay Kit (Upstate Biotechnology). Approximately 5×106 cardiac myocytes were used for the RNA polymerase II ChIP or a no antibody control (NAC). Formaldehyde was added directly to the media to a final concentration of 1% and incubated at room temperature for 10 minutes. The media was removed and the plates were washed twice with PBS (with added protease inhibitor (Complete Mini EDTA-free, Roche, 1 tablet per 10 ml solution)), and transferred to a 14 ml Falcon tube. Cells were then pelleted at 2000 rpm for 4 minutes at 4°C. Cells were resuspended in 0.8 ml of ChIP lysis buffer (50 mM Tris-HCl, pH 8.0, 85 mM KCl, 0.5% NP40 with protease inhibitor) and incubated on ice for 10 min. Following centrifugation at 4800 rpm for 5 min, the supernatant was discarded and 0.8 ml of SDS lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl, pH 8.1) was added and the cells were incubated for 10 minutes on ice. To generate single monosomes sonication was performed on ice using a Sonics and Materials Vibra-Cell sonicator with a 3 mm tip set at 30% maximum
Page 7, MS #5349 / R1 power using 25 ten second pulses with a 30 second interval between sonications. Samples were centrifuged at 4800 rpm for 10 minutes and the supernatant was divided into two by adding 350 ml of the supernatant to 1.65 ml of ChIP dilution buffer (to which protease inhibitor tablets were added) in two separate 2 ml tubes. A 20 ml aliquot (1% of total) was removed to serve as an input sample. Chromatin was precleared with 80 ml of Salmon Sperm DNA/Protein A at 4°C with rotation for 30 min, followed by the addition of 25 ml of 0.2 mg/ml anti RNA Polymerase II antibody (sc-899, Santa Cruz Biotechnology) or a NAC. Immunoprecipitation was performed overnight with rotation. To collect immune complexes, 60 ml of Salmon Sperm DNA/Protein A was added and incubated at 4°C with rotation for one hour followed by centrifugation at 1000 rpm for 2 minutes. Washing was then performed with 1 ml of low salt complex wash buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, pH 8.1, 150 mM NaCl), high salt immune wash buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, pH 8.2, 500 mM NaCl), LiCl immune complex wash buffer (0.25 M LiCl, 1% NP40, 1% deoxycholate, 1 mM EDTA, 10 mM Tris-HCl, pH 8.1) and twice with 1 ml of 1’TE (10 mM Tris-HCl, 1 mM EDTA, pH 8.0), each for 3 minutes, followed by two elutions with 250 ml of 1% SDS, 0.1 M NaHCO3. Formaldehyde cross-links were reversed in immunoprecipitated samples and the input chromatin sample by addition of 20 ml 5 M or 2 ml of NaCl, respectively, and incubation at 65°C for 4 hours. Following chloroform extraction and ethanol precipitation, DNA was resuspended in 25 ml of water.
Real-time Quantitative PCR of genomic DNA The amount of target DNA was quantified on an ABI 7900HT Sequence Detection System using the Sybr green methodology and the following primers directed against the rat COX-2
Page 8, MS #5349 / R1 proximal promoter (accession number L11611): rCOX-2prom5 (5’-TGC AGC TCT CTT GGC ACC ACT T-3’) and rCOX-2prom3 (5’-CGC AAA TGA GCC CAG AGA AGC-3’), amplifying from -172 to -126 (with respect to the start site of transcription). Determinations were performed in triplicate on 2 ml of bound chromatin and 2 ml of a tenfold dilution of input chromatin in a 25 ml reaction using the following cycling parameters: 95°C 10 min, followed by 40 cycles of 95°C 15 sec and 60°C 1 min. The number of copies of the COX-2 promoter was determined by comparison to a standard curve using known amounts of a COX-2 promoter-containing plasmid (-628/32PGS-CAT, kindly provided by Dr. J. Sirois, Laval University, Ste-Foy, Quebec). The fold enrichment of the rat COX-2 promoter was determined by subtracting the number of target DNA molecules in the no antibody control sample from thenumber in the RNA polymerase II immunoprecipitated samples, and dividing by the number in the diluted input sample. Results are expressed as mean ± SEM of a representative experiment. ChIP analysis were performed on three independent myocyte preparations, each with comparable findings.
Nuclear run-off analysis Studies were performed as described previously (8). Briefly, confluent vehicle and IL-1β treated cultured cardiac myocytes were washed with sterile PBS and lysed in situ with ice-cold lysis buffer (10 mM Tris-HCl, pH 7.9, 0.15 M NaCl, 1 mM EDTA, and 0.6% (v/v) Nonidet P-40) for 10 min on ice. Cell lysates were centrifuged for 5 min at 500×g at 4°C, and the nuclear pellet resuspended in 100 µl of chilled nuclear buffer containing 0.3 M (NH4)2SO4, 100 mM Tris-HCl (pH 7.9), 4 mM MgCl2, 4 mM MnCl2, 0.2 M NaCl, 0.4 mM EDTA, 0.1 mM PMSF and 40% (v/v) glycerol. Seventy five µl of 1× cold transcription buffer (0.3 M (NH4)2SO4, 100 mM TrisHCl [pH 7.9], 4 mM MgCl2, 4 mM MnCl2, 0.2 M NaCl, 0.4 mM EDTA, and 0.1 mM PMSF)
Page 9, MS #5349 / R1 containing 0.2 mM DTT, 40 U RNasin, 0.2 mM ATP, CTP and GTP, and 125 µCi [32P]UTP (3,000 Ci/ mmol) was added to the nuclear suspension and incubated for 30 min at 28°C. 150 U of RNase-free DNase 1 and 125 µg tRNA were then added and incubated for 10 min at 37°C, followed by digestion with proteinase K at a final concentration of 300 µg/ml in buffer with 10 mM Tris-HCl, pH 7.9, 10 mM EDTA, and 0.5% SDS for 30 min at 42°C. Nuclear transcripts were isolated by the guanidinium thiocyanate phenol-chloroform method (9) and purified on Micro-30 spin columns (Biorad). After denaturation by boiling, the labeled RNA was resuspended at 2×106 cpm/ml in northern hybridization buffer (5×Denhard’s solution, 0.5% SDS, 5×SSPE, 50% formamide and 100 µg /ml denatured salmon sperm). Equal amounts (1 µg) of gel-purified cDNA were denatured by boiling in 0.4 M NaOH, 10 mM EDTA and neutralized with equal volumes of 2 M ammonium acetate, pH 7.0, and then slot blotted onto Nylon filters (Hybond N). A rGAPDH insert (1 kb) and rCOX-2 (full size fragment, 1.9 kb) were used as probes for the slot blots. Hybridization was performed for 48 - 72 h at 42°C in northern hybridization buffer. Hybridized filters were washed extensively and subjected to autoradiography and quantitation as described for northern blot experiments.
Measurement of PGE2 release by cardiac myocytes PGE2 levels in the supernatant of cardiac myocytes were assayed with an ELISA kit, as described by the manufacturer (Amersham Biosciences, Pointe Claire, PQ).
Statistical analysis All results are expressed as the mean ± SD of 3 to 5 experiments, carried out in triplicate. Comparisons between groups were made by repeated measures analysis of variance, followed by
Page 10, MS #5349 / R1 post-hoc analysis with paired t-tests. When multiple comparisons between groups were made, a Bonferroni correction was applied. A p value
