Cellular Biology Hypoxia-Inducible Factor-2␣ Transactivates Abcg2 and Promotes Cytoprotection in Cardiac Side Population Cells Cindy M. Martin, Anwarul Ferdous, Teresa Gallardo, Caroline Humphries, Hesham Sadek, Arianna Caprioli, Joseph A. Garcia, Luke I. Szweda, Mary G. Garry, Daniel J. Garry Abstract—Stem and progenitor cell populations occupy a specialized niche and are consequently exposed to hypoxic as well as oxidative stresses. We have previously established that the multidrug resistance protein Abcg2 is the molecular determinant of the side population (SP) progenitor cell population. We observed that the cardiac SP cells increase in number more than 3-fold within 3 days of injury. Transcriptome analysis of the SP cells isolated from the injured adult murine heart reveals increased expression of cytoprotective transcripts. Overexpression of Abcg2 results in an increased ability to consume hydrogen peroxide and is associated with increased levels of ␣-glutathione reductase protein expression. Importantly, overexpression of Abcg2 also conferred a cell survival benefit following exposure to hydrogen peroxide. To further examine the molecular regulation of the Abcg2 gene, we demonstrated that hypoxia-inducible factor (HIF)-2␣ binds an evolutionary conserved HIF-2␣ response element in the murine Abcg2 promoter. Transcriptional assays reveal a dose-dependent activation of Abcg2 expression by HIF-2␣. These results support the hypothesis that Abcg2 is a direct downstream target of HIF-2␣ which functions with other factors to initiate a cytoprotective program for this progenitor SP cell population that resides in the adult heart. (Circ Res. 2008;102:1075-1081.) Key Words: Abcg2 䡲 cardiac SP 䡲 HIF-2␣ 䡲 oxidative stress
S
ide population (SP) cells are isolated from embryonic and adult tissues using Hoechst 33342 and dual-wavelength fluorescence-activated cell sorting (FACS) analysis.1– 4 This strategy defines a rare population of progenitor cells that can adopt alternative fates in permissive environments.1–3 We have verified that the ability of SP cells to efflux Hoechst 33342 dye is dependent on the expression of Abcg2, which is a member of the family of ATP-binding cassette (ABC) transporters.3,5,6 Although the functional role of the ABC transporters remains ill-defined,7 we established that Abcg2 was able to confer the SP phenotype in a striated muscle cell line.3 Stem and progenitor cell populations, including SP cells, are exposed to environmental stress by virtue of their physical location. Although oxidative stress attributable to unchecked levels of free radical– derived reactive oxygen species (ROS) can damage DNA, proteins, and lipids,8 oxidative stress caused by modestly increased ROS can activate specific signal transduction pathways, leading to either senescence or apoptosis.9 Previous transcriptome analyses of embryonic, hematopoietic, and neural stem cells revealed a common signature of gene expression in these stem cell populations. This profile includes transcripts that function as cytoprotective factors to provide resistance against environmental stress.10 –12 Recent studies that examined circulating, blood-
derived endothelial progenitor cells reveal enrichment for the expression of genes encoding for antioxidative factors that reduce sensitivity toward ROS-induced cell death.13 Regulation of cytoprotective factors during injury states would be beneficial for survival and expansion of stem and progenitor cell populations. Members of the hypoxia-inducible factor (HIF) family are activated by multiple environmental stimuli. HIF-1␣, a master regulator for hypoxia-inducible gene expression, regulates gene expression to promote energy production as well as oxygen delivery in response to hypoxia.14 –16 HIF-2␣, also known as endothelial PAS domain protein 1 (EPAS1), has many similarities with HIF-1␣.17–19 However, several molecular, biochemical, and physiological studies have established that HIF-1␣ and HIF-2␣ are not redundant but have distinct functional roles.17–19 HIF-2␣ transcriptional activity is induced in specific tissues (vascular endothelial cells, neural crest cell derivatives, cardiac myocytes, and stem cell populations)17 and is important in ROS homeostasis, apoptosis, and lung and hematopoietic development.18,19 Furthermore, studies have demonstrated that HIF-2␣ plays the major role in oxidative stress defense mechanisms specifically in the regulation of antioxidant enzymes. Recent studies have also demonstrated that HIF-2␣ and not HIF-1␣ is a direct up-
Original received August 10, 2007; revision received February 26, 2008; accepted March 7, 2008. From the Departments of Internal Medicine (C.M.M., A.F., C.H., H.S., A.C., J.A.G., M.G.G., D.J.G.), Pathology (T.G.), and Molecular Biology (D.J.G.) and Donald W. Reynolds Clinical Cardiovascular Center (D.J.G.), University of Texas Southwestern Medical Center, Dallas; Lillehei Heart Institute (C.M.M., A.F., M.G.G., D.J.G.), University of Minnesota, Minneapolis; and Oklahoma Medical Research Foundation (L.I.S.), Oklahoma City. Correspondence to Daniel J. Garry, MD, PhD, Lillehei Heart Institute, University of Minneapolis, 420 Delaware St SE, MMC 508, Minneapolis, MN 55455. E-mail
[email protected] © 2008 American Heart Association, Inc. Circulation Research is available at http://circres.ahajournals.org
DOI: 10.1161/CIRCRESAHA.107.161729
1075 Downloaded from http://circres.ahajournals.org/ by guest on October 14, 2015
1076
Circulation Research
May 9, 2008
stream regulator of Oct-4, a transcription factor required for pluripotency of embryonic stem cells. This latter regulatory role for HIF-2␣ provides a mechanism for HIF-2␣– dependent regulation of stem cell function.17 In the present study, we define the response of the cardiac SP cells following injury. We undertake a transcriptome analysis to define the common transcriptional signature of the SP cell populations isolated from embryonic and adult lineages. We further define the transcriptional regulation of Abcg2 by HIF-2␣. Collectively, these studies enhance our understanding of the cardiac SP cell population and provide insight regarding the functional role as well as regulation of Abcg2.
Materials and Methods FACS Analysis and Transcriptome Analyses Cells were cultured, harvested, and analyzed as described in the online data supplement, available at http://circres.ahajournals.org. Oligonucleotide array hybridizations were carried out according to the Affymetrix protocol, as previously described.20,21
Western Blot Analysis Protein extracts from Abcg2-overexpressing SP cells and respective control cell populations were prepared, and Western blot analysis was preformed as previously described.24,25 Blots were probed with a polyclonal rabbit anti– glutathione reductase serum (BD PharMingen; 1:2000) and the polyclonal rabbit ␣-tubulin serum (Sigma-Aldrich; 1:2000 dilution).24,26
H2O2 Consumption Assays
Following the addition of 250 mol/L H2O2 to the sample of interest, 100 L was removed at specific time points and added to 2.0 mL of 25 mmol/L K2HPO4, 0.1%Triton X-100 (pH 7.25) with 500 mol/L hydroxyphenyllactic acid (Sigma) and 2.0 U/mL horseradish peroxidase (added shortly before use).27
Glutathione/Oxidized Glutathione Measurements Abcg2-overexpressing SP cells and respective control cell populations were pelleted, and glutathione (GSH) and oxidized glutathione (GSSG) were extracted with 75 L of 5% meta-phosphoric acid. Following centrifugation, GSH and GSSG present in the supernatant were resolved by reverse-phase high-performance liquid chromatography and quantified by electrochemical detection as previously described.28
Results Quantitative RT-PCR Analyses cDNA synthesis and quantitative (q)RT-PCR reactions were performed as previously described.20 All primer pairs sequences are listed in the online data supplement.
Myocardial Cryoinjury A transmural cryoinjury was induced as described in the online data supplement. At specified days following injury, the mice were euthanized and prepared for FACS, molecular, or immunohistochemical analyses and compared with uninjured littermates. All mice were maintained in a pathogen free facility according to the animal care guidelines at the UT Southwestern Medical Center.
Immunohistochemistry Adult hearts were fixed, embedded in paraffin, and sectioned as previously described.22 Antibodies were used as follows: polyclonal rabbit anti-ABCG2 serum (kindly provided by Susan Bates [National Institute of Health, Bethesda, Md; 1:800 dilution])7 anti–␣sarcomeric actinin serum (1:150 dilution; Sigma, St. Louis, Mo).
Cell Culture and Overexpression of Abcg2 C2C12 and mouse embryo fibroblast (MEF) cells were cultured as previously described.23 Cells were transfected with EGFP-N1 plasmid (Clontech) or the pG2-IRES-EGFP bicistronic construct. The cells were analyzed as described in the online data supplement.
Electrophoretic Mobility-Shift Assay and Chromatin Immunoprecipatation Assay C2C12 cells were transfected with hemagglutinin (HA)-tagged HIF-2␣. After 24 hours, nuclear extracts were prepared and used for electrophoretic mobility-shift assay (EMSA) as previously described.23 Chromatin immunoprecipatation assays for evaluating Abcg2 promoter binding of HIF-2␣ were performed as described in the online data supplement.
Reporter Gene Assays Luciferase assays were performed as previously described.23 C2C12 myoblast cells were transfected with control (pGLT-Luc) or Abcg2Luc constructs with or without increased amounts of HA-tagged HIF-1␣ or HIF-2␣ overexpression plasmids, as described in online data supplement.
We have previously reported that Abcg2 is expressed in cardiac SP cells that are resident in the developing and adult murine heart.3 The ability of SP cells to efflux Hoechst 33342 dye is dependent on the expression of Abcg2.3,4 Using FACS, cardiac SP cells were isolated from the unperturbed adult murine heart and at 3, 7, and 14 days after cryoinjury (Figure 1). We observed that the cardiac SP cells increased 3.3-fold by day 3 following injury. The increase was sustained through day 7 (after cryoinjury), which revealed a 3.1-fold increase compared with baseline (ie, the unperturbed adult heart) but then returned to near baseline levels by day 14 following injury. Analysis of the CD45⫹ (a pan-hematopoietic marker) cell population of the cardiac SP cells using FACS analysis, revealed that the percentage of CD45⫹ cells was not significantly changed at any of the time points (Figure 1C). This suggests that the increase in the number of cardiac SP cells is largely from proliferation of the resident cardiac SP cell pool. Future studies will be necessary to further verify the source(s) of the cardiac SP cells following injury. The increase in the number of cardiac SP cells following injury was further confirmed using immunohistochemical techniques. Abcg2expressing cells were observed rarely (within the interstitium) in the unperturbed heart and at 1 and 14 days following cryoinjury of the adult heart (Figure 1E and 1H). At 3 days following injury, there is a significant increase in the cardiac Abcg2-positive cells at low magnification (Figure 1F) and high magnification (Figure 1G). Statistical analysis of the sections revealed an ⬇10-fold increase in the Abcg2-positive cells at day 3 (after cryoinjury) compared with days 1 and 14 (following injury) (29.7⫾4.2 versus 3.2⫾1.5 and 2.5⫾1.9 respectively; n⫽6; * P⬍0.001; Figure 1D). These results support the conclusion that Abcg2-expressing cardiac SP cells increase in number following myocardial injury. To define the molecular signature of the cardiac SP cells following injury, we isolated cardiac SP cells at 3 and 7 days following injury and analyzed the respective transcriptome using Affymetrix array technology. The results were then
Downloaded from http://circres.ahajournals.org/ by guest on October 14, 2015
Martin et al
A
Regulation and Functional Role of Abcg2
B 4
Blue
CSP Fold increase
FTC(+)
FTC(-)
3 2 1 0
Red
4.4% CD45+ FL1
E
7D post-injury
FL2
FL2
3D post-injury
FL2
Uninjured
5.5% CD45+
5.0% CD45+
FL1
F
3 7 14 Day post-injury
D 35 CSP Fold increase
0
C
1077
25 20 15 10 5 0 1 3 14 Day post-injury
FL1
G
*
30
H
compared with cardiac SP cells harvested from the uninjured adult murine heart. The analysis of the transcriptome profiling experiments revealed a common molecular program of significantly expressed transcripts that were induced at both days 3 and 7 following myocardial injury. As shown in the Venn diagram, 333 transcripts were significantly induced in cardiac SP cells isolated on days 3 and 7 following injury (Figure IA in the online data supplement). The fold induction of representative transcripts that were commonly increased in cardiac SP cells isolated at both time periods following myocardial injury is presented in supplemental Figure IB. Interestingly, not only were there higher numbers of Abcg2expressing SP cells, but the increased Abcg2 transcript expression was observed in individual SP cells. The transcriptome results were confirmed using qRT-PCR for several candidate genes on separately harvested samples of cardiac SP cells isolated from adult hearts 3 and 7 days following injury (supplemental Figure IC). To define a common SP cell signature, SP cells were harvested from murine embryonic stem cells, adult mouse bone marrow, skeletal muscle, or cardiac tissue (Figure 2A through 2H), and the molecular signature was defined using Affymetrix array technology. The array data from the SP cells isolated from these lineages were compared with their respective main population (MP) and significantly upregulated transcripts are illustrated in the Venn diagrams in Figure 2I. Each SP cell population displayed a distinct pattern of transcript enrichment, although a common SP cell program was also defined. The fold changes of representative significantly enriched transcripts are shown in supplemental Figure IIA. The transcriptome results were confirmed using qRT-
Figure 1. Expansion of the cardiac SP cell pool following injury. A, Dual-wavelength FACS profiles of adult heart reveals cardiac SP cells are located in the gated region. Inhibition of the SP cell phenotype is observed with addition of FTC, a specific inhibitor of Abcg2. B, Quantitation of cardiac SP cells (CSP) using FACS at distinct time periods following myocardial cryoinjury. An increase in the number of cardiac SP cells is noted following cryoinjury of the adult heart, with the peak increase observed between 3 and 7 days following cryoinjury. C, Using FACS, no significant increase is observed in the percentage of CD45-positive cardiac SP cells in the uninjured mouse heart (4.4%) compared with the 3-day postinjured mouse heart (4.4%) and the 7-day postinjury mouse heart (5.0%). D, Quantitation of CSP using immunochemistry at distinct time periods following myocardial cryoinjury. An increase in the number of CSP is again noted at 3 days following cryoinjury (n⫽6; *P⬍0.001). E through H, Immunohistochemical techniques reveal rare numbers of Abgc2positive cells (green) in the adult mouse heart 1 day (E) and 14 days (H) following myocardial cryoinjury. At 3 days following injury, there is a significant increase in the cardiac Abcg2-positive cells. Magnification, ⫻10 (F) and ⫻40 (G).
PCR for several candidate genes on separately harvested samples (supplemental Figure IIB). These results support the conclusion that the common SP molecular program includes cell cycle regulatory genes (ie, p21), signaling pathways (Tgfb), and cytoprotective factors (Jun, Smad7, Myc, Ndrg1, and Txnl1). The transcripts that were commonly expressed in SP cell populations isolated from embryonic and adult lineages were largely associated with the cellular response to oxidative stress. Although these transcripts were commonly expressed in the SP cell populations, the transcriptome analysis could not distinguish, whether expression of these factors was a direct effect of Abcg2 itself or whether stem/progenitor cells were expressing a common program that included Abcg2 expression. To further examine whether the common transcript expression could be a direct effect of Abcg2, we overexpressed Abcg2 in C2C12 cells and isolated the Abcg2expressing SP cells as well as MP cells (Figure 3A). Native C2C12 cells lack Abcg2 expression and therefore lack SP cells (Figure 3A). Following forced expression of Abcg2 in C2C12 myoblasts, a significant increase in the number of SP cells was observed and the ability of these cells to efflux Hoechst dye was completely blocked with fumitremorgin (FTC), a specific Abcg2 inhibitor (Figure 3A). To determine whether Abcg2 expression affects the transcriptome, the molecular signature of the Abcg2-expressing C2C12 SP cells was compared with the native C2C12 MP cells. The fold changes of representative significantly enriched transcripts in the C2C12 SP cells are shown in supplemental Figure IIIA. Many of the same transcripts (that function as cytoprotective factors/pathways) that were significantly expressed in the common SP cell molecular program
Downloaded from http://circres.ahajournals.org/ by guest on October 14, 2015
1078
A
B
Circulation Research
ES
C
ES+FTC
I
D
May 9, 2008
E
BM
F
BM+FTC
ESSP (1418)
SKM
SKM+FTC
546
484
BMSP (1993)
441
191
377
624
670
624 322
563
298
BMSP (1862)
689
424
CSP (1933)
SMSP (2105)
the oxidative stress pathway. These results indicate that either Abcg2 expression was itself cytoprotective or that the expression (or overexpression) of Abcg2 results in an oxidative stress that activates oxidative stress signaling pathways. We note that no difference in cell death was observed between the experimental and control samples, indicating that Abcg2 expression does not result in unchecked oxidative stress (data not shown). Although there was not significant oxidative stress to cause cell death in the Acbg2-overexpressing cells,
in ES, bone marrow, skeletal muscle, and cardiac SP cells were also enriched in the Abcg2-expressing C2C12 SP cells. Transcripts such as Atf3, Ndr1, Gsta4, and Ddit3 were significantly upregulated in the Abcg2-expressing C2C12 SP cells compared with the native C2C12 MP cells. This induction of gene expression was further confirmed using qRTPCR analysis (supplemental Figure IIIB). The Abcg2-expressing C2C12 SP cell transcriptome data indicate that Abcg2 expression results in the upregulation of C2C12
A
B
C2C12+ABCG2
C2C12+ABCG2+FTC
C
25
Figure 2. A common SP cell molecular program is observed in SP cells isolated from a number of lineages. A through H, Using FACS analysis, representative SP cell profiles were obtained from embryonic stem (ES) cells, adult mouse bone marrow (BM), adult mouse skeletal muscle (SKM), and adult mouse heart (HRT). The respective samples were also incubated with FTC, a specific Abcg2 inhibitor, which inhibited the ability to efflux Hoechst dye. I, Using Affymetrix array technology, common and distinct molecular programs associated with embryonic stem cell SP population (ESSP), cardiac SP cell population (CSP), bone marrow SP cell population (BMSP), and skeletal muscle SP cell population (SMSP) were obtained and analyzed. Venn diagrams of the respective SP cell molecular programs (significantly increased transcript expression) compared with the respective main population (MP) cells reveal distinct and common sets of transcripts. The number of significantly increased transcripts is included in the brackets.
HRT+FTC
H
CSP (1802) 197
HRT
G
D
20
80
15
CMV
ABCG2
IRES
Percent cell death
GSH / GSSG
*
EGFP
10
MP
5
MEF
0 MP
Gsr
* *
60 50
MP
Tuba
SP Gsr / Tuba
H2O2(μl)
*
70
1.0
SP MP
*
MP
G
100
80
50
SP
F
*
60
40
SP
E 90
70
*
0.75 0.5
SP
Figure 3. Overexpression of Abcg2 promotes cytoprotection in myogenic C2C12 cells. A, The FACS profiles of native C2C12 cells reveal an absence of SP cells. Following overexpression of Abcg2, the FACS profile of the transfected C2C12 cells reveals the SP cell phenotype of cells within the gated region, which can be blocked with FTC incubation. B, When Abcg2 was overexpressed in C2C12 cells, the ratio of reduced to oxidized glutathione (GSH/ GSSG) is lower in Abcg2-expressing C2C12 SP cells compared with C2C12 cells, which lack Abcg2 (n⫽6; *P⬍0.05). C, Schematic outlining the experimental strategy for the experimental results presented in D. D, When Abcg2 was overexpressed in MEFs, the SP cells displayed a survival benefit compared with MEF MP after exposure to oxidative stress with a 4-hour hydrogen peroxide treatment (n⫽5; *P⬍0.05). E, The Abcg2-expressing C2C12 SP cells consumed hydrogen peroxide at a significantly higher rate compared with C2C12 MP cells. F and G, Western blot analysis revealed increased expression of ␣-glutathione reductase in C2C12 SP cells when compared with the MP cells. G represents the quantitation of the Western blot analyses (n⫽3; *P⬍0.05,). ␣-Tubulin (Tuba) is used as a loading control.
0.25 1
3
6 9 12 Time (min)
0
MP
SP
Downloaded from http://circres.ahajournals.org/ by guest on October 14, 2015
A
D -2543 HR E Mouse GTCCACGTCTA Human CACCACGCCTG -2683 Probe: Abcg2–HRE -2549 -2528 WT: 5’ AAAATGTCCACGTCTAGCTCT 3’ Mut: 5’ --------G-AT--------- 3’
C α-HA Competitor DNA Hif2α-HA
1
- - - - - WT Mut + ++ + + 2 3 4 5 6
+ + 7
+ HD + 8
α-HA
310
IgG
310
Total
310
E
3 2 1 0 -
Hif2α-DNA NS
Free probe
+
–
Hif2α-HA
B
1079
-3Kb
F Fold activation
we hypothesized that Abcg2 was inducing a low level of oxidative stress that was “priming” or preconditioning the cells to be more resistant to oxidative stress.29,30 To examine this hypothesis, we measured the ratio of reduced to oxidized glutathione (GSH/GSSG) in Abcg2-expressing C2C12 SP cells compared with C2C12 cells, which lack Abcg2. We observed that there was a lower ratio of reduced to oxidized (GSH/GSSG) glutathione in the Abcg2-expressing C2C12 cells (11.1⫾0.8) compared with wild-type C2C12 cells (16.4⫾4.7; n⫽6; *P⬍0.05; Figure 3B). To determine whether Abcg2 expression itself affects the cellular survival in other cell types, we overexpressed Abcg2 in mouse embryonic fibroblast (MEF) cells given their well-described use in oxidative stress experiments (Figure 3C).31,32 Abcg2overexpressing MEFs and wild-type MEFs were then exposed to hydrogen peroxide. The Abcg2-overexpressing MEF SP cells displayed a survival benefit (64⫾4.5% cell death) compared with MEF MP cells (74⫾2.5% cell death n⫽5; *P⬍0.05; Figure 3D) after exposure to oxidative stress. This finding confirmed that the overexpression of Abcg2 was not generating an oxidative stress that was deleterious to the cells, but rather Abcg2 overexpression resulted in a survival benefit. To further define the biochemical mechanism of the induction of oxidative stress genes, hydrogen peroxide consumption assays were performed in Abcg2-expressing C2C12 SP cells. We observed that the Abcg2-expressing C2C12 SP cells are able to consume hydrogen peroxide at a higher rate compared with C2C12 cells, which lack Abcg2, consistent with the notion that Abcg2 induces cytoprotective pathways (Figure 3E). Given that glutathione reductase is responsible for recycling GSSG to GSH, we hypothesized that there would be an induction of this enzyme in the Abcg2expressing C2C12 SP cells.29 This was confirmed using Western blot analysis, which revealed higher levels of ␣-glutathione reductase (Gsr) expression in the Abcg2overexpressing C2C12 SP cells compared with the C2C12 MP cells (ratio of Gsr to ␣-tubulin loading control, 0.547⫾0.1 in C2C12 MP versus 0.81⫾0.1 in Abcg2overexpressing C2C12 SP cells; n⫽3; *P⬍0.05; Figure 3F and 3G). Collectively, these findings further confirmed that the upregulation of cytoprotective factors involved in the oxidative stress response is directly related to overexpression of Abcg2. Recent studies support the notion that HIF-2␣ (EPAS1) may serve as a master regulator of oxidative stress response pathways.17–19 Because we have demonstrated, Abcg2 expression is associated with induction of oxidative stress pathways, we hypothesized that HIF-2␣ could be an upstream regulator of Abcg2. Database analysis of the 3-kb upstream fragment of the Abcg2 gene revealed the presence of an evolutionarily conserved hypoxia-response element (HRE) (Figure 4A). The HRE was tested for its ability to interact specifically with Abcg2 in vitro using an EMSA. As outlined in Figure 4B and 4C, using the EMSA, we demonstrated that HIF-2␣ binds to this site (ie, HRE) because it forms a HIF-2␣ -DNA complex (lane 2), which is competed in the presence of excess cold competitor (lanes 3 and 4) but not the mutant (lanes 5 and 6) cold probe, and the DNA-protein complex is supershifted by anti-HA serum. As a further control, heat denaturation of the antibody before adding to the reaction
Regulation and Functional Role of Abcg2
Fold induction
Martin et al
8 6
+ Hif2α α
3Kb Abcg2
Luc
CACGT
4 2
0 Hif2α vector pGLT
pGLT-Abcg2
Figure 4. HIF-2␣ binds and transactivates the Abcg2 gene. A, Database analysis reveals an evolutionary conserved HRE in the Abcg2 promoter. The evolutionarily conserved HRE (shown in the box) is present in the mouse and human Abcg2 promoter at the indicated nucleotide sequence upstream of the ATG transcriptional start site. B, Nucleotide sequences of single strand wild-type (WT) and mutant (Mut) probes. Sequence of wild-type and mutant HRE are shown in bold. C, Binding of HIF-2␣ to the mouse Abcg2 HRE in vitro using EMSA. EMSA reveals a specific HIF-2␣/DNA complex (lane 2), which is competed in the presence of excess cold wild-type competitor (lanes 3 and 4) but not mutant (lanes 5 and 6) cold probe. The complex is supershifted by anti-HA serum, but heat denaturation (HD) of the antibody before adding to the reaction fails to supershift the complex (lanes 7 and 8). The intensity of a nonspecific (NS) band was not affected in the presence of competitors and antibody. D, Top, Schematic of the evolutionary conserved HRE (black), which is flanked by HIF accessory sequences (white) in the Abcg2 promoter. Use of chromatin immunoprecipitation assays reveals the capacity of HIF-2␣ to bind to the Abcg2 promoter in vivo. Chromatin solutions prepared from C2C12 myoblasts transfected with HA-tagged HIF-2␣– expressing vector or HA-tagged control vector were immunoprecipitated (IP) with anti-HA serum (top gel) and control IgG (middle gel). Note that the Abcg2 promoter harboring the HRE was amplified only from anti-HA immunoprecipitation of the HIF-2␣– expressing sample. Total PCR products are shown in the bottom gel. E, Overexpression of HIF-2␣ results in increased expression of endogenous Abcg2 using qRT-PCR. RNA was isolated from C2C12 myoblasts transfected with either HA-tagged HIF-2␣ (⫹) or control (⫺) vector and analyzed using qRT-PCR. Fold induction of Abcg2 transcript is shown. F, Schematic outlining the 3-kb Abcg2 promoter-luciferase (luc) plasmid, which harbors the evolutionary conserved HRE used in the transcriptional assays. C2C12 cells were transfected with control or Abcg2-Luc reporter (shown at top), LacZ expression vector, and HA-tagged HIF-2␣. Note that HIF-2␣, in a dose-dependent fashion, transactivated the Abcg2 gene. Total amount of DNA was adjusted with empty vector. Fold activation of Luc activity is normalized to the empty vector.
fails to supershift the complex (lanes 7 and 8). Using chromatin immunoprecipitation assays, we confirmed that HIF-2␣ binds to the Abcg2 promoter in vivo. The database analysis revealed that the HRE was flanked by three HIF accessory sequences within the upstream fragment of the Abcg2 gene, as outlined in Figure 4D. Chromatin solutions,
Downloaded from http://circres.ahajournals.org/ by guest on October 14, 2015
1080
Circulation Research
May 9, 2008
prepared from C2C12 cells transfected with either HA-tagged HIF-2␣ (⫹) or HA-tagged control (⫺) vector, were used to immunoprecipitate the HIF-2␣–DNA complex by anti-HA serum and control IgG serum and analyzed by PCR amplification. Using primers designed to amplify the HRE, we were able to amplify product from the DNA bound to protein precipitated with the anti-HA serum only from the HIF-2␣– overexpressing cells but not from control antibodies which further establishes the specificity of HIF-2␣ binding to the Abcg2 promoter (Figure 4D). We then undertook transcriptional activation assays to confirm that the binding of HIF-2␣ to the Abcg2 promoter was biologically significant. Initially, we analyzed whether the Abcg2 transcript was upregulated following HIF-2␣ overexpression. RNA was isolated from C2C12 myoblasts transfected either with HA-tagged HIF-2␣ (⫹) or control (⫺) vectors and corresponding cDNA was used for qRT-PCR analysis. In response to HIF-2␣ overexpression, we observed a 2.7-fold induction of Abcg2 transcript (Figure 4E), whereas no significant induction was seen of Car9, a known downstream target of HIF-1␣ (supplemental Figure IV). This activation was further confirmed using transcriptional assays. We fused a 3-kb Abcg2 promoter fragment to the luciferase reporter. We transfected C2C12 myoblasts with the Abcg2 promoter–reporter construct and increasing HIF-2␣ amounts (Figure 4F). We observed a 6.1-fold increase of Abcg2 transcription in response to HIF-2␣. Moreover, HIF-2␣ in a dose-dependent fashion transcriptionally activated the Abcg2 gene compared with the control (ie, empty vector). However, when we transfected C2C12 myoblasts with the Abcg2 promoter–reporter construct and maximum doses of HIF-1␣, we observed only a 2-fold increase of Abcg2 transcription (supplemental Figure VA). These results further establish that HIF-2␣ binds and transactivates Abcg2 gene expression to promote cytoprotection in the cardiac SP cell population and that this response is specific for HIF-2␣.
Discussion Many adult tissues harbor a resident stem cell or progenitor cell population that participates in the maintenance and regeneration of the respective tissues in response to an injury. Accumulating evidence supports the notion that the adult heart is capable of limited regeneration in response to an injury. SP cells have been shown to function as stem/ progenitor cells in a number of lineages.1–3 In the present study, we have begun to decipher the regulatory program of the cardiac SP cell population by making 3 principal findings that enhance our mechanistic understanding of this cell population. First, we demonstrated that the Abcg2-expressing cardiac SP cell population increases in number following a focal myocardial injury. Using numerous technologies, we observed that the cardiac SP cells following myocardial injury increased in number compared with the cardiac SP cells resident in the uninjured adult heart. These techniques do not definitively distinguish whether the increase in cardiac SP cells is attributable to recruitment from extracardiac tissues (ie, bone marrow) or proliferation of the resident cardiac SP cell population. Future studies will be necessary to further define the source of the increased SP cell population
following injury. The transcriptome analysis also revealed that not only was there an increase in the numbers of cardiac SP cells in response to injury, but there was an induction of Abcg2 gene expression in cardiac SP cells isolated from the injured heart. The induction of Abcg2 in this cell population isolated from the injured heart supported the notion that Abcg2 may have an important functional role in this cell population. Previous studies have demonstrated that stem/progenitor cell populations have cytoprotective mechanisms that promote survival in response to stressful stimuli following a severe injury.10,11 Our second principle observation is that Abcg2 promotes a cytoprotective response in SP cell populations by inducing antioxidant stress pathways. We and others have previously demonstrated that Abcg2 functions to efflux Hoechst dye in SP cell populations, although the physiological role for this multidrug resistance protein is unclear.3,4 Using a gene disruption strategy, Abcg2-null mice are viable, and they have a relative absence of SP cells and increased toxicity with exposure to antineoplastic drugs.33 Although it is possible that other members of the ABC transporter superfamily may compensate in the absence of Abcg2, accumulating data support the notion that Abcg2 expression in stem cells may mediate the ability to respond to stressful stimuli. Recent studies have examined the global gene expression or the transcriptome of embryonic, hematopoietic, and neural stem cells and have defined a common signature of gene expression that provides resistance against environmental stress.10 –12 These common programs of gene expression (including genes involved in cytoprotection) in these stem cell populations have been proposed to be a “stemness” feature, which may promote stem cell survival and regeneration of injured tissues.10 –12 The transcriptome results in the present study are largely in agreement with the previous studies because they too reported an induction of stress responsive genes in SP cells (compared with MP cells). In the present study, we observed that forced expression of Abcg2 resulted in an induction of antioxidant stress pathways that resulted in increased consumption of hydrogen peroxide and increased viability. These results support the conclusion that Abcg2 expression in SP cells has a cytoprotective role and promotes cellular viability following a severe injury. The third major finding of the present study is that HIF-2␣ is a potent transcriptional regulator of the Abcg2 gene. HIF-2␣ is a basic helix–loop– helix/PAS domain transcription factor that is similar in composition to HIF-1␣ but has distinct functions.19 For example, mice lacking HIF-2␣ have multiple organ pathologies (ie, heart, skeletal muscle, liver, etc), increased generation of reactive oxygen species, and decreased expression of antioxidant enzymes,.19 In addition, the results of transcriptional assays revealed that HIF-2␣ was a direct upstream regulator of antioxidant enzymes.19 Collectively, these studies support the hypothesis that HIF-2␣ is a primary sensor of the oxidative stress response and promotes a cytoprotective response to maintain ROS homeostasis. Importantly, these functional roles for HIF-2␣ were distinct from HIF-1␣. Recent studies further support a specific role for HIF-2␣ in stem and progenitor cell populations. For example, HIF-2␣ is a specific upstream transcriptional activator of the pluripotency factor, Oct4 in stem cell popula-
Downloaded from http://circres.ahajournals.org/ by guest on October 14, 2015
Martin et al tions.17 In the present study, we provide molecular biological and biochemical data supporting the role of HIF-2␣ as an upstream regulator of the Abcg2 gene. These results extend the repertoire of gene expression that is regulated by HIF-2␣ and provide a mechanistic insight toward the molecular response of progenitor cell populations to stressful stimuli. Moreover, these results further highlight the molecular programs characteristic of stem/progenitor cell populations that promote survival during the postinjury period, including the regulation of Abcg2 gene expression. In conclusion, these studies demonstrate that the cardiac SP cells are resident in the adult heart and increase in number in response to injury. Furthermore, these studies also unveil a cytoprotective functional role of Abcg2 in response to oxidative stress, which are downstream of HIF-2␣. These studies further enhance our understanding of the cardiac SP cell population, define a functional role of Abcg2 in the SP cell population, and decipher signal transduction pathways in which stem/progenitor cell populations are protected from oxidative stress.
Acknowledgments We acknowledge the technical assistance provided by Sean Goetsch and Nan Jiang.
Sources of Funding Funding was provided by GlaxoSmithKline (to C.M.M.), the American Heart Association (to D.J.G.), and the March of Dimes Associations (to D.J.G.).
Disclosures None.
References 1. Goodell MA, Brose K, Paradis G, Conner AS, Mulligan RC. Isolation and functional properties of murine hematopoietic stem cells that are replicating in vivo. J Exp Med. 1996;183:1797–1806. 2. Gussoni E, Soneoka Y, Strickland CD, Buzney EA, Khan MK, Flint AF, Kunkel LM, Mulligan RC. Dystrophin expression in the mdx mouse restored by stem cell transplantation. Nature. 1999;401:390 –394. 3. Martin CM, Meeson AP, Robertson SM, Hawke TJ, Richardson JA, Bates S, Goetsch SC, Gallardo TD, Garry DJ. Persistent expression of the ATP-binding cassette transporter, Abcg2, identifies cardiac SP cells in the developing and adult heart. Dev Biol. 2004;265:262–275. 4. Zhou S, Schuetz JD, Bunting KD, Colapietro AM, Sampath J, Morris JJ, Lagutina I, Grosveld GC, Osawa M, Nakauchi H, Sorrentino BP. The ABC transporter Bcrp1/ABCG2 is expressed in a wide variety of stem cells and is a molecular determinant of the side-population phenotype. Nat Med. 2001;7:1028 –1034. 5. Scharenberg CW, Harkey MA, Torok-Storb B. The ABCG2 transporter is an efficient Hoechst 33342 efflux pump and is preferentially expressed by immature human hematopoietic progenitors. Blood. 2002;99:507–512. 6. Bunting KD. ABC transporters as phenotypic markers and functional regulators of stem cells. Stem Cells. 2002;20:11–20. 7. Litman T, Druley TE, Stein WD, Bates SE. From MDR to MXR: new understanding of multidrug resistance systems, their properties and clinical significance. Cell Mol Life Sci. 2001;58:931–959. 8. Stolzing A, Scutt A. Age-related impairment of mesenchymal progenitor cell function. Aging Cell. 2006;5:213–224. 9. Pelicci PG. Do tumor-suppressive mechanisms contribute to organism aging by inducing stem cell senescence? J Clin Invest. 2004;113:4 –7. 10. Ramalho-Santos M, Yoon S, Matsuzaki Y, Mulligan RC, Melton DA. “Stemness”: transcriptional profiling of embryonic and adult stem cells. Science. 2002;298:597– 600. 11. Ivanova NB, Dimos JT, Schaniel C, Hackney JA, Moore KA, Lemischka IR. A stem cell molecular signature. Science. 2002;298:601– 604.
Regulation and Functional Role of Abcg2
1081
12. Liadaki K, Kho AT, Sanoudou D, Schienda J, Flint A, Beggs AH, Kohane IS, Kunkel LM. Side population cells isolated from different tissues share transcriptome signatures and express tissue-specific markers. Exp Cell Res. 2005;303:360 –374. 13. Dernbach E, Urbich C, Brandes RP, Hofmann WK, Zeiher AM, Dimmeler S. Antioxidative stress-associated genes in circulating progenitor cells: evidence for enhanced resistance against oxidative stress. Blood. 2004;104:3591–3597. 14. Ryan HE, Lo J, Johnson RS. HIF-1 alpha is required for solid tumor formation and embryonic vascularization. EMBO J. 1998;17:3005–3015. 15. Semenza GL, Agani F, Feldser D, Iyer N, Kotch L, Laughner E, Yu A. Hypoxia, HIF-1, and the pathophysiology of common human diseases. Adv Exp Med Biol. 2000;475:123–130. 16. Iyer NV, Kotch LE, Agani F, Leung SW, Laughner E, Wenger RH, Gassmann M, Gearhart JD, Lawler AM, Yu AY, Semenza GL. Cellular and developmental control of O2 homeostasis by hypoxia-inducible factor 1 alpha. Genes Dev. 1998;12:149 –162. 17. Covello KL, Kehler J, Yu H, Gordan JD, Arsham AM, Hu CJ, Labosky PA, Simon MC, Keith B. HIF-2alpha regulates Oct-4: effects of hypoxia on stem cell function, embryonic development, and tumor growth. Genes Dev. 2006;20:557–570. 18. Sato M, Tanaka T, Maemura K, Uchiyama T, Sato H, Maeno T, Suga T, Iso T, Ohyama Y, Arai M, Tamura J, Sakamoto H, Nagai R, Kurabayashi M. The PAI-1 gene as a direct target of endothelial PAS domain protein-1 in adenocarcinoma A549 cells. Am J Respir Cell Mol Biol. 2004;31: 209 –215. 19. Scortegagna M, Ding K, Oktay Y, Gaur A, Thurmond F, Yan LJ, Marck BT, Matsumoto AM, Shelton JM, Richardson JA, Bennett MJ, Garcia JA. Multiple organ pathology, metabolic abnormalities and impaired homeostasis of reactive oxygen species in Epas1-/- mice. Nat Genet. 2003;35:331–340. 20. Masino AM, Gallardo TD, Wilcox CA, Olson EN, Williams RS, Garry DJ. Transcriptional regulation of cardiac progenitor cell populations. Circ Res. 2004;95:389 –397. 21. Gallardo TD, Hammer RE, Garry DJ. RNA amplification and transcriptional profiling for analysis of stem cell populations. Genesis. 2003;37: 57– 63. 22. Garry DJ, Yang Q, Bassel-Duby R, Williams RS. Persistent expression of MNF identifies myogenic stem cells in postnatal muscles. Dev Biol. 1997;188:280 –294. 23. Meeson AP, Shi X, Alexander MS, Williams RS, Allen RE, Jiang N, Adham IM, Goetsch SC, Hammer RE, Garry DJ. Sox15 and Fhl3 transcriptionally coactivate Foxk1 and regulate myogenic progenitor cells. EMBO J. 2007;26:1902–1912. 24. Freitas A, Alves-Filho JC, Secco DD, Neto AF, Ferreira SH, BarjaFidalgo C, Cunha FQ. Heme oxygenase/carbon monoxide-biliverdin pathway down regulates neutrophil rolling, adhesion and migration in acute inflammation. Br J Pharmacol. 2006;149:345–354. 25. Garry DJ, Ordway GA, Lorenz JN, Radford NB, Chin ER, Grange RW, Bassel-Duby R, Williams RS. Mice without myoglobin. Nature. 1998; 395:905–908. 26. Yan T, Jiang X, Zhang HJ, Li S, Oberley LW. Use of commercial antibodies for detection of the primary antioxidant enzymes. Free Radic Biol Med. 1998;25:688 – 693. 27. Schleiss MB, Holz O, Behnke M, Richter K, Magnussen H, Jorres RA. The concentration of hydrogen peroxide in exhaled air depends on expiratory flow rate. Eur Respir J. 2000;16:1115–1118. 28. Rebrin I, Kamzalov S, Sohal RS. Effects of age and caloric restriction on glutathione redox state in mice. Free Radic Biol Med. 2003;35:626 – 635. 29. Dhalla NS, Elmoselhi AB, Hata T, Makino N. Status of myocardial antioxidants in ischemia-reperfusion injury. Cardiovasc Res. 2000;47: 446 – 456. 30. Arthur PG, Lim SC, Meloni BP, Munns SE, Chan A, Knuckey NW. The protective effect of hypoxic preconditioning on cortical neuronal cultures is associated with increases in the activity of several antioxidant enzymes. Brain Res. 2004;1017:146 –154. 31. Poss KD, Tonegawa S. Reduced stress defense in heme oxygenase 1-deficient cells. Proc Natl Acad Sci U S A. 1997;94:10925–10930. 32. Scorrano L, Oakes SA, Opferman JT, Cheng EH, Sorcinelli MD, Pozzan T, Korsmeyer SJ. BAX and BAK regulation of endoplasmic reticulum Ca2⫹: a control point for apoptosis. Science. 2003;300:135–139. 33. Zhou S, Zong Y, Lu T, Sorrentino BP. Hematopoietic cells from mice that are deficient in both Bcrp1/Abcg2 and Mdr1a/1b develop normally but are sensitized to mitoxantrone. Biotechniques. 2003;35:1248 –1252.
Downloaded from http://circres.ahajournals.org/ by guest on October 14, 2015
Online Supplement
Martin et al., HIF-2α transactivates Abcg2 and promotes…
Supplemental Material and Methods FACS Analysis Mouse embryonic stem cells (SM-1, passage 7) derived from 129S6SvEvTac mice were cultured under standard conditions and ES cells were cultured on a subconfluent feeder cell layer of irradiated SNL 76/7 STO cells as previously described 1. Prior to staining, the ES cells were separated from STO cells by dispersing the trypsinized cell preparation on gelatin-coated plates twice for 30 min each. The cells were pelleted by centrifugation, washed, resuspended at 1.0 x 106 cells/ml in Hanks buffer containing 2% fetal calf serum and stained with 5 µg/ml Hoechst 33342 (90 minutes at 37° C). Murine bone marrow was extracted from the femurs and tibias of C57Bl/6 male mice. The cells were pelleted by centrifugation, washed, resuspended at 1.0 x 106 cells/ml in Hanks buffer containing 2% FCS and stained with 5 µg/ml Hoechst 33342 (90 minutes at 37° C). Murine cardiac tissue and skeletal muscle was harvested from 2-4 month-old WT mice following a transcardiac perfusion with ice-cold PBS. Tissue was then digested with pronase (10 mg/ml), separated using a percoll gradient (40%/70%) and resuspended at 1.0 x 106 cells/ml in Hanks buffer containing 2% FCS and stained with 12.5 µg/ml and 25 µg/ml Hoechst 33342 (90 minutes at 37°C) respectively, for skeletal muscle and cardiac cell preparations. The cells were divided into two samples with one sample receiving fumitremorgin (FTC) (kindly provided by Lee Greenberger, Wyeth Research) at a concentration of 10 µM just prior to Hoechst 33342 staining
2, 3
.
Antibody conjugated staining utilized cell populations that were resuspended at 1.0 x 106 cells/ml in Hanks buffer containing 2% FCS. FITC-conjugated antibodies (c-Kit, Sca-1, CD34, and CD45, Beckton Dickerson Labs) were individually added at a
Online Supplement
Martin et al., HIF-2α transactivates Abcg2 and promotes…
concentration of 1.0 mg/ml and incubated on ice for 20 minutes. Cell populations were then rinsed with PBS, pelleted, resuspended in Hanks media and maintained at 4° C before FACS analysis.
A MoFlo flow cytometer (Cytomation, Inc.) equipped with 360
nm UV and 488 nm argon lasers were used to detect the fluorescence of Hoechst, EGFP and propidium iodide, respectively. The detection of Hoechst red (670/40 nm) and blue (405/30 nm) LP filters in combination with a 440 nm long pass filter were used for these studies. A minimum of 100,000 events was collected.
Transcriptome analysis Oligonucleotide array hybridizations were carried out according to the Affymetrix protocol as previously described
1, 4
. Briefly, total RNA was isolated from FACS sorted
C2C12 cells, ES cells, adult bone marrow SP cells, cardiac SP cells, or skeletal muscle SP cells. Total RNA was isolated from the respective cell samples using the Tripure Isolation Kit (Roche).
Two cycles of RNA amplification were performed for each
sample. In the first cycle, double–stranded cDNA was synthesized from total RNA using an oligo dT-T7 primer followed by an in vitro transcription reaction to produce primary cRNA. amplification.
Primary cRNA (200 ng) was then used for a second cycle of Following precipitation, the double stranded cDNA was converted to
biotin-labeled cRNA using the Enzo BioArray High Yield RNA Transcript Labeling Kit (Enzo Biochem, New York, NY). The purified biotin-labeled cRNA was then fragmented using Affymetrix fragmentation buffer for 35 minutes at 95oC. cRNA (15
Labeled, fragmented
g) was then hybridized to the high-density oligonucleotide mouse array.
After six hours of hybridization, the array was washed, stained and scanned according
Online Supplement
to the manufacturer’s protocol.
Martin et al., HIF-2α transactivates Abcg2 and promotes…
The array data were analyzed using the MAS5.0
software package and Dchip to determine significant transcript expression and to determine common and unique expression profiles associated with the respective samples.
QRT-PCR analysis cDNA synthesis was performed using SuperScript II RT (Invitrogen) as previously described 4. All primer pairs spanned an intron and the respective sequences are listed below:
Abcg2
F 5’-CAGATATCAATGGGATCATG-3’ R 5’-CATCTAGCAACGAAGACTTGC-3’
Plf2
F 5’-CATCTCCAAAGCCACAGACA-3’ R 5’-AACCAGGCAGGGTTCTTCTT-3’
Gsta4
F 5’-CTGGAGTGGAGTTTGAGGAA-3’ R 5’-TGGTCTGTGCAGCATCATC-3’
Atf3
F 5’-AAGAGCTGAGATTCGCCATC-3’ R 5’-CCTTCAGCTCAGCATTCACA-3’
Cdkn1a
F 5’-TTGCACTCTGGTGTCTGAGC-3’ R 5’-CTCCTGACCCACAGCAGAAG-3’
Ndr1
F 5’-TCTTCGGCAAGGAGGAGATA-3’ R 5’-CTGTTGTAGGCGCTGATGAA-3’
Epc1
F 5’-CCTGCCTCAGGAGTATACAA-3’
Online Supplement
Martin et al., HIF-2α transactivates Abcg2 and promotes…
R 5’-CTGTCGAAGGACTCGTATGT-3’ MkI67
F 5’-GTCAAAGAGCAAGAGGCAAT-3’ R 5’-TATGTCTCCATGTCTCAGCC-3’
Wt1
F 5’-AGCACACTGGTGTGAAACCA-3’ R 5’-ACCTGTATGAGTCCTGGTGT-3’
Ctss
F 5’-TGGGAGACATGACCAATGAA-3’ R 5’-GTATGACCTGAAAGTGACAG-3’
Cthrc1
F 5’-TGGGAAAATTGCGGAGTGTA-3’ R 5’-GCATGCATTCCTGCATTTGA-3’
Krt18
F 5’-TATGAAGCGCTGGCTCAGAA-3’ R 5’-TCTCCTCAATCTGCTGAGAC-3’
Car9
F 5’-CCCTTGGGTTAGAGGATCTATCG R 5’-GGCCACCCCCTTTTTCAT
As previously described, the qRT-PCR reaction was performed with 12.5 µl Cybr Green, 6.5 µl H2O, 1 µl of cDNA (2 µg/µl diluted 1:5) and 2.5 µl of the forward and reverse primers (200 mM) in a total volume of 25 µl. We utilized an ABI Prism 7000 SDS v1.1 thermal cycler and the following conditions (1 cycle 50.0º C for 2 minutes; 1 cycle 95.0º C for 10 minutes; 40 cycles 95.0º C for 15 seconds; 60.0º C for 1 minute and 60.0>95.0º C for 20 minutes for dissociation).
Myocardial cryoinjury WT mice were anesthetized with 2% isofluorane, intubated and ventilated using a small
Online Supplement
Martin et al., HIF-2α transactivates Abcg2 and promotes…
animal ventilator (Harvard Apparatus) 5. A left thoracotomy was performed and the heart exposed in order to induce cryoinjuries consistently in the same area of the left ventricle (LV).
A transmural cryoinjury was induced by exteriorizing the heart and
applying a liquid nitrogen cooled probe to the LV for 6 seconds. The size of the probe used to induce injury was 2.18 mm by 2.52 mm.
The resulting injury was easily
visualized and measured to be 4.27 ± 0.5 mm X 3.88 ± 0.30 mm 5.
This highly
reproducible injury represents 29.4 ± 6.3% of the total heart based on wet weights. Six mice were injured for each timepoint to ensure at least four injured mice were viable for harvest at each specified timepoint. Injuries were performed in triplicate. At one, three, seven and fourteen days following injury the mice were sacrificed and prepared for either FACS, molecular or immunohistochemical analyses and compared to uninjured littermates.
Immunohistochemistry Adult hearts (unperturbed and postinjury) were fixed with 4% paraformaldehyde, embedded in paraffin, sectioned and hydrated with PBS as previously described 6. Sections (5 µm in thickness) were permeabilized (0.3% triton in PBS for 5 minutes), blocked (5% normal goat serum/PBS for 30 minutes) and incubated at 4° C overnight with the primary antisera, polyclonal rabbit anti-ABCG2 serum kindly provided by Susan Bates National Institute of Health, Bethesda Maryland (1:800 dilution)
7
and/or an anti-
alpha-sarcomeric actinin serum (1:150 dilution, Sigma, St. Louis, MO). The sections were then rinsed and incubated with the respective secondary antisera. For ABCG2 a biotinylated goat anti-rabbit serum (1:200 dilution, Vector Laboratories, Burlingame, CA)
Online Supplement
Martin et al., HIF-2α transactivates Abcg2 and promotes…
was used as a secondary antibody and incubated for 30 minutes at room temperature, which was detected with 1:50 dilution of FITC-conjugated goat anti-rabbit streptavidin serum (Jackson Immunoresearch Laboratories, West Grove, PA).
Alternatively,
lissamine rhodamine-conjugated goat anti-mouse IgG (1:50; Jackson Immunoresearch) was used as a secondary antibody and incubated for 30 minutes to detect alphasarcomeric actin.
Slides were mounted with Vectashield (Vector Laboratories,
Burlingame, CA) and fluorescence images were collected using a Zeiss Axioplan2i microscope.
PBS substitution and absorption (2:1 molar excess of Abcg2
protein:antibody) controls were utilized and in all instances the controls were negative (i.e. absence of signal).
Random fields from three consecutive slides from each
timepoint were used to quantitate the number of Abcg2 positive cells. Each image was adjusted in Adobe Photoshop (Adobe Inc., Mountain View, CA) to maintain a consistent threshold value for positive staining to reduce variability and evaluator bias. Statistically significant differences were determined using Student’s t-test.
Cell Culture and Overexpression of Abcg2 C2C12 cells were plated in a 150 mm dish in Dulbecco Modified Eagle Medium (DMEM) containing 20% fetal calf serum (FCS) supplemented with 1% penicillin-streptomycin as previously described 8. The following day, the cells were transfected with either 3 µg of EGFP-N1 plasmid (Clontech) or 9 µg of the pG2-IRES-EGFP bicistronic construct, which drove the expression of human ABCG2 and enhanced green fluorescent Protein (EGFP) under the control of cytomeglovirus immediate early promoter/enhancer (kindly provided by Beverly Torok-Storb and Michael Harkey, Fred Hutchinson Cancer
Online Supplement
Martin et al., HIF-2α transactivates Abcg2 and promotes…
Research Center using the Lipofectamine Plus system (Invitrogen). Twenty-four hours following transfection, cells were trypsinized, resuspended at 1.0 x 106 cells/ml in Hanks buffer containing 2% FCS and stained with 15 mg/ml Hoechst 33342 for 45 minutes at 37°C. The cells were divided into two groups with one group receiving Fumitremorgin C (FTC) at a concentration of 10 µM
2, 3
just prior to Hoechst 33342 staining. Cell
populations were then rinsed with PBS, pelleted, resuspended in Hanks media and maintained at 4° C before FACS analysis (MoFlo, Cytomation, Inc.). The cells were then sorted by FACS into Tripure for microarray and RT-PCR analyses or collected for H2O2 consumption and GSH/GSSG measurements as described below.
Mouse
embryonic fibroblasts (MEFs) were prepared from wildtype E13.5 embryos. The cells were plated at equal numbers in a 90 mm cell dish in Dulbecco Modified Eagle Medium (DMEM) containing 10% fetal calf serum (FCS) supplemented with 1% penicillinstreptomycin. The following day, they were transfected with 4 µg of the pG2-IRESEGFP bicistronic construct which drove the expression of human ABCG2 and enhanced green fluorescent Protein (EGFP) under the control of cytomeglovirus immediate early promoter/enhancer using the Lipofectamine Plus system (Invitrogen). Forty-eight hours following transfection, cells were trypsinized, resuspended in Hanks buffer containing 2% FCS and stained with 15 mg/ml Hoechst 33342 for 45 minutes at 37° C. The cells were divided into two groups with one group receiving FTC at a concentration of 10 µM just prior to Hoechst 33342 staining.
Cell populations were then rinsed with PBS,
pelleted, resuspended in Hanks media and maintained at 4° C before FACS analysis (MoFlo, Cytomation, Inc). The MEF cells were then sorted by FACS into SP and MP cells determined by the Hoechst-low phenotype. The SP and main population (MP)
Online Supplement
Martin et al., HIF-2α transactivates Abcg2 and promotes…
cells were replated into respective wells of a 24 well dish at a concentration of 40,000 cells per well. Twenty-four hours later the DMEM supplemented media was replaced with PBS containing 250 µmolar H2O2 for four hours. Cell populations were then rinsed with PBS, pelleted, resuspended in Hanks media and maintained at 4° C before FACS analysis to determine the percentage of cell death of each population by propidium iodine staining.
Electrophorectic Mobility Shift Assay C2C12 cells, grown in DMEM media supplemented with 20% FBS, were transfected with HA-tagged HIF-2α using lipofectamine plus reagent (Invitrogen). After 24 hours, nuclear extract (NE) was prepared as previously described 8. Reaction mixture (20µl) containing NE (5µg) or BSA (as control) and
32
P-labeled wildtype probe in 10 mM
HEPES-KOH (pH 7.9), 6mM MgCl2, 50 mM KCl, 0.1 mM EDTA, 10% glycerol, and 1 µg of poly(dI-dC)poly(dI-dC) was incubated for 20 minutes at room temperature. In some reactions, rat anti-HA serum (Roche) with or without prior heat denaturation (10 minutes at 90ºC) and 5-25 fold excess of unlabeled WT or mutated probe were added. After incubation, samples were resolved by electrophoresis at 4ºC using 0.5XTGE running buffer and visualized using the phosphoimager system.
Chromatin Immunopreciptation (ChIP) Assay ChIP assays were performed as previously described
8
with following modifications.
Briefly, C2C12 myoblast cells were transfected with 10µg HA-tagged HIF-2α or HAtagged control vector (pIRES-hrGFP-2a) in a 15 cm culture dish. Formaldehyde (1%
Online Supplement
Martin et al., HIF-2α transactivates Abcg2 and promotes…
final concentration) was added 24 hours following transfection and chromatin solution was prepared by sonication. Immunoprecipitation reactions were carried out using an anti-HA serum and control IgG.
Promoter occupancy of HIF-2α was analyzed by
amplifying the DNA fragment (310 bp) corresponding to upstream HRE and three HIF accessory sequence (HAS) motifs using the following set of primers (forward: 5’ATTTGAAGCCTCTAACTCCTCGCC-3’
and
reverse:
5’-
TGGAGTTTTCCCATTTTCTGTAGC-3’). Undiluted or 10 fold diluted DNA was used after immunoprecipitation while the PCR reaction from each chromatin solution before immunoprecipitation was diluted 30 and 100 fold and indicated as totals.
Reporter Gene Assays In a six well plate, C2C12 myoblast cells were transiently transfected with a control (pGLT-Luc) or Abcg2-Luc construct with or without increased amount of HA-tagged HIF2α or HIF-1α overexpression plasmids. Total amount of DNA (3µg) was adjusted with empty vector. Twenty-four hours after transfection, cells were washed twice with PBS, lysed and used for luciferase activity as described 8. ß-galactosidase activity was used to normalize transfection efficiency. Each sample was run in triplicate.
Western blot analysis Protein extracts from Abcg2 overexpressing SP cells and respective control cell populations were prepared and Western blot analysis was preformed as previously described
9, 10
. Blots were probed with a polyclonal rabbit anti-glutathione reductase
serum (BD PharMingen, 1:2000) and the polyclonal rabbit α-tubulin serum (1:2000
Online Supplement
Martin et al., HIF-2α transactivates Abcg2 and promotes…
dilution; Sigma-Aldrich) and detected using a horseradish peroxidase-conjugated goat anti-rabbit serum (1:10,000 dilution; Pierce Chemical Company, Rockford, IL)
10, 11
.
Results were quantified by use of the ChemDoc System (Bio-Rad, Hercules, CA).
H2O2 Consumption Assays Following the addition of 250µM H2O2 to the sample of interest, 100 µL was removed at specific timepoints and added to 2.0 mL 25 mM K2HPO4, 0.1%TritonX-100, pH 7.25 with 500 µM hydroxyphenyllactic acid (Sigma) and 2.0 units/mL horseradish peroxidase (added shortly before use)
12
.
Fluorescence (at 30 seconds) was measured with
excitation wavelength (320 nm) and emission wavelength (425 nm) with a slit width of 5 nm 12.
GSH/GSSG Measurements Abcg2 overexpressing SP cells and respective control cell populations were pelleted and GSH and GSSG were extracted with 75 µL of 5% meta-phosphoric acid (MPA). Following centrifugation, GSH and GSSG present in the supernatant were resolved by reverse phase HPLC and quantified by electrochemical detection as previously described 13.
Online Supplement
Martin et al., HIF-2α transactivates Abcg2 and promotes…
References 1. Gallardo TD, Hammer RE, Garry DJ. RNA amplification and transcriptional profiling for analysis of stem cell populations. Genesis. 2003;37:57-63. 2. Martin CM, Meeson AP, Robertson SM, Hawke TJ, Richardson JA, Bates S, Goetsch SC, Gallardo TD, Garry DJ. Persistent expression of the ATP-binding cassette transporter, Abcg2, identifies cardiac SP cells in the developing and adult heart. Dev Biol. 2004;265:262-275. 3. Scharenberg CW, Harkey MA, Torok-Storb B. The ABCG2 transporter is an efficient Hoechst 33342 efflux pump and is preferentially expressed by immature human hematopoietic progenitors. Blood. 2002;99:507-512. 4. Masino AM, Gallardo TD, Wilcox CA, Olson EN, Williams RS, Garry DJ. Transcriptional regulation of cardiac progenitor cell populations. Circ Res. 2004;95:389397. 5. Naseem RH, Meeson AP, Dimaio JM, White MD, Kallhoff JB, Humphries CG, Goetsch SC, De Windt LJ, Williams MA, Garry MG, Garry DJ. Reparative myocardial mechanisms in adult C57BL/6 and MRL mice following injury. Physiol Genomics. 2007;30:44-52. 6. Garry DJ, Yang Q, Bassel-Duby R, Williams RS. Persistent expression of MNF identifies myogenic stem cells in postnatal muscles. Dev Biol. 1997;188:280-294. 7. Litman T, Druley TE, Stein WD, Bates SE. From MDR to MXR: new understanding of multidrug resistance systems, their properties and clinical significance. Cell Mol Life Sci. 2001;58:931-959. 8. Meeson AP, Shi X, Alexander MS, Williams RS, Allen RE, Jiang N, Adham IM, Goetsch SC, Hammer RE, Garry DJ. Sox15 and Fhl3 transcriptionally coactivate Foxk1 and regulate myogenic progenitor cells. Embo J. 2007;26:1902-12. 9. Garry DJ, Ordway GA, Lorenz JN, Radford NB, Chin ER, Grange RW, BasselDuby R, Williams RS. Mice without myoglobin. Nature. 1998;395:905-908. 10. Freitas A, Alves-Filho JC, Secco DD, Neto AF, Ferreira SH, Barja-Fidalgo C, Cunha FQ. Heme oxygenase/carbon monoxide-biliverdin pathway down regulates neutrophil rolling, adhesion and migration in acute inflammation. Br J Pharmacol. 2006;149:345-54. 11. Yan T, Jiang X, Zhang HJ, Li S, Oberley LW. Use of commercial antibodies for detection of the primary antioxidant enzymes. Free Radic Biol Med. 1998;25:688-693. 12. Schleiss MB, Holz O, Behnke M, Richter K, Magnussen H, Jorres RA. The concentration of hydrogen peroxide in exhaled air depends on expiratory flow rate. Eur Respir J. 2000;16:1115-1118. 13. Rebrin I, Kamzalov S, Sohal RS. Effects of age and caloric restriction on glutathione redox state in mice. Free Radic Biol Med. 2003;35:626-635.
Online Supplement
Martin et al., HIF-2α transactivates Abcg2 and promotes…
Online Figure I. Transcriptome analysis of cardiac SP cells following myocardial injury reveals a common molecular program.
A) Venn diagram of the respective
molecular program of significantly increased transcript expression in cardiac SP cells (isolated from the 3 and 7 days post-injured heart) compared to uninjured cardiac SP cells. Total numbers of transcripts significantly increased in expression at each time period are indicated in parentheses compared to transcripts isolated from SP cells from the unperturbed heart.
B) Fold increase of representative transcripts at 3 days and 7
days post-injury (compared to uninjured cardiac SP cells).
All transcripts are
significantly increased at each time period in cardiac SP cells following injury.
C)
Microarray results were confirmed using qRT-PCR for several candidate genes.
Online Figure II.
A common SP cell molecular program.
A)
Fold change of
representative transcripts of embryonic, adult mouse bone marrow, adult mouse skeletal, and adult mouse cardiac SP cells compared to their respective main population. B) Microarray results were confirmed using qRT-PCR for several candidate genes.
Online Figure III.
Overexpression of Abcg2 alters the genetic signature in
myogenic C2C12 cells. A) Following overexpression of Abcg2, C2C12 cells were analyzed using dual wavelength FACS analysis. Cells that overexpressed Abcg2 were isolated, analyzed using Affymetrix array technology and observed to have upregulation of many cytoprotective transcripts when compared to native C2C12 cells. B) The microarray results between the C2C12 SP cells (Abcg2 overexpressing cells) and the
Online Supplement
Martin et al., HIF-2α transactivates Abcg2 and promotes…
C2C12 MP (native cells) were confirmed using qRT-PCR analysis for several candidate genes.
Online Figure IV. Overexpression of HIF-2α fails to increase expression of the HIF-1α downstream target gene Car9.
A)
Overexpression of HIF-2α failed to
increase expression of the known HIF-1α target gene Car9 using qRT-PCR. RNA was isolated from C2C12 myoblasts transfected with either HA-tagged HIF-2α (+) or control (-) vector and analyzed using qRT-PCR.
Online Figure V. HIF-1α fails to transactivate the Abcg2 gene. A) Schematic outlining the 3kb Abcg2 promoter-luciferase (luc) plasmid.
C2C12 cells were
transfected with control or Abcg2-Luc reporter (shown top), LacZ expression vector and HA-tagged HIF-1α.
Total amount of DNA was adjusted with empty vector.
Fold
activation of Luc activity is normalized to the empty vector. B) Schematic outlining the 3X-HRE-tk-luc plasmid. C2C12 cells were transfected with control or 3X-HRE-tk-luc plasmid (shown top), LacZ expression vector and HA-tagged HIF-1α. Total amount of DNA was adjusted with empty vector. the empty vector.
Fold activation of Luc activity is normalized to
Online Figure I
A 3 day (624)
291
333
307
7 day (640)
B Differential gene expression Title ATP-binding cassette, sub-family G, member 2 collagen triple helix repeat containing 1 cathepsin S cyclin D1 cyclin-dependent kinase 4 cyclin-dependent kinase 6 endothelin 1 frataxin haptoglobin keratin complex 1, acidic, gene 18 lipocalin 2 antigen identified by monoclonal antibody Ki 67 N-myc downstream regulated-like superoxide dismutase 1 tenascin C vascular endothelial growth factor C Wilms tumor homolog
Symbol Abcg2 Cthrc1 Ctss Ccnd1 Cdk4 Cdk6 End1 Fxn Hp Krt18 Lcn2 Mki67 Ndrl Sod1 Tnc Vegfc Wt1
3 day 1.67 11.81 11.50 1.55 2.12 1.59 2.72 1.43 5.95 4.68 7.76 12.49 2.96 1.24 21.48 2.37 2.87
C 120
3 day 7 day
Fold change
100 40 30 20 10 0
Mki67
Wt1
Ctss
Cthrc1
Krt18
7 day 1.90 7.13 12.91 2.07 1.47 2.09 1.95 1.28 7.09 9.68 3.81 4.15 1.98 1.55 2.95 1.97 5.63
Online Figure II
A Title activating transcription factor 3 ATP-binding cassette, sub-family G (WHITE), member 2 cyclin-dependent kinase inhibitor 1A (P21) DNA-damage inducible transcript 3 enhancer of polycomb homolog 1 (Drosophila) hypoxia inducible factor 1, alpha subunit Jun oncogene MAD homolog 7 (Drosophila) myelocytomatosis oncogene myeloid differentiation primary response gene 116 N-myc downstream regulated gene 1 nuclear factor of kappa light chain gene enhancer in B-cells inhibitor, alpha procollagen, type XVIII, alpha 1 TG interacting factor transforming growth factor beta 1 induced transcript 4 thioredoxin-like 1
Symbol Atf3 Abcg2 Cdkn1a Ddit3 Epc1 Hif1a Jun Smad7 Myc Myd116 Ndrg1 Nfkbia Col18a1 Tgif Tgfb1i4 Txnl1
B
Fold change
45
CSP BMSP
40
10
0
Abcg2 Cdkn1a
Epc1
Atf3
BMSP -2.20 5.99 2.45 1.47 2.44 1.45 1.60 4.68 2.34 2.96 3.07 1.12 6.34 1.31 7.70 1.79
SMSP 4.89 7.06 2.46 1.53 4.09 1.93 3.09 4.20 6.99 2.94 4.93 2.99 12.45 1.80 8.93 2.02
CSP 2.43 3.05 2.47 1.75 3.72 2.27 1.45 3.46 2.16 1.67 3.95 1.99 6.97 2.14 3.48 2.03
ESSP 2.05 2.24 2.70 1.85 2.34 1.87 1.94 3.13 5.07 2.40 1.64 2.72 1.27 1.55 2.59 2.18
Online Figure III
A Symbol
Title
C2C12 SP C2C12 MP (Signal) Fold Change (Signal)
Atf3
activating transcription factor 3
1665.8
9.19
132.5
Plf2
proliferin 2
7272.4
5.66
854.7
Ndr1
N-myc downstream regulated 1
3291.1
5.28
574.5
Cdkn1a
cyclin-dependent kinase inhibitor 1A (P21)
1254.1
4.92
261.4
Gadd45a
Growth arrest and DNA-damage-inducible 45 alpha
1071.2
4.59
202.9
Gsta4
glutathione S-transferase, alpha 4
1086.7
4.00
252.8
Ddit3
DNA-damage inducible transcript 3
1914.6
4.00
518.2
2010015E03Rik
RIKEN cDNA 2010015E03 gene
1361.5
3.48
318.0
Epc1
enhancer of polycomb homolog 1, (Drosophila)
506.2
2.64
228.0
Slugh
slug, chicken homolog
1124.3
2.46
552.9
Ccng2
cyclin G2
303.8
2.14
144.6
2310046G15Rik
RIKEN cDNA 2310046G15 gene
140.9
-3.03
444.9
Cdc6
cell division cycle 6 homolog (S. cerevisiae)
177.2
-2.83
513.4
Crip
cysteine rich intestinal protein
256.8
-2.00
600.2
Casp8ap2
caspase 8 associated protein 2
144.3
-1.87
318.2
B 12 8 4
f2
n1 Pl
dk
tf3
C
A
st G
dr
1
a4
a
0
N
Fold change
16
Online Figure IV
A Fold activation
1.5 1.0 0.5 0 -0.5 -1.0 -1.5
+ Hif2α
-
Hif2α
Online Figure V
A
3Kb Abcg2
B Luc
3x HRE
Luc
8 6 4 2 0
Hif1α vector pGLT-Abcg2
Fold activation
Fold activation
CACGT
160 120 80 40
Hif1α vector
0 Hif1α HRE
Hypoxia-Inducible Factor-2α Transactivates Abcg2 and Promotes Cytoprotection in Cardiac Side Population Cells Cindy M. Martin, Anwarul Ferdous, Teresa Gallardo, Caroline Humphries, Hesham Sadek, Arianna Caprioli, Joseph A. Garcia, Luke I. Szweda, Mary G. Garry and Daniel J. Garry Circ Res. 2008;102:1075-1081; originally published online March 20, 2008; doi: 10.1161/CIRCRESAHA.107.161729 Circulation Research is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231 Copyright © 2008 American Heart Association, Inc. All rights reserved. Print ISSN: 0009-7330. Online ISSN: 1524-4571
The online version of this article, along with updated information and services, is located on the World Wide Web at: http://circres.ahajournals.org/content/102/9/1075
Data Supplement (unedited) at: http://circres.ahajournals.org/content/suppl/2008/03/20/CIRCRESAHA.107.161729.DC1.html
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published in Circulation Research can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for which permission is being requested is located, click Request Permissions in the middle column of the Web page under Services. Further information about this process is available in the Permissions and Rights Question and Answer document. Reprints: Information about reprints can be found online at: http://www.lww.com/reprints Subscriptions: Information about subscribing to Circulation Research is online at: http://circres.ahajournals.org//subscriptions/
Downloaded from http://circres.ahajournals.org/ by guest on October 14, 2015
