Inflammation, Vol. 29, Nos. 4Y6, December 2005 (# 2006) DOI: 10.1007/s10753-006-9014-y
Human Conjunctival Epithelial Cells Lack Lipopolysaccharide Responsiveness Due to Deficient Expression of MD2 but Respond After Interferon-g Priming or Soluble MD2 Supplementation Jaya Talreja,1 Kavitha Dileepan,1 Sanjeev Puri,2 Mohammad H. Kabir,1 David M. Segal,3 Daniel J. Stechschulte,1 and Kottarappat N. Dileepan1,4
Abstract—Inflammatory responses to Gram-positive and Gram-negative bacterial cell wall components are initiated by Toll-like receptor 2 (TLR2) and TLR4, respectively. Therefore, the existence of functionally active TLR2 and TLR4 in human conjunctival epithelial cells (HCEC) are critical for the effective host defense against bacterial infections in the eye. We examined the ability of HCEC to respond to TLR4 ligand, lipopolysaccharide (LPS), or TLR2 ligands, lipoteichoic acid (LTA) and peptidoglycan (PGN) using the Chang conjunctival epithelial cell line and the primary conjunctival epithelial cell line (IOBA-NHC) as in vitro models. Incubation of Chang cells with LPS (1 to 1,000 ng/ ml) failed to stimulate IL-6 production where as stimulation with LTA or PGN resulted in marked increases in IL-6 production. Semi-quantitative RTYPCR and immunofluorescence analyses showed that Chang cells express TLR2 and TLR4 mRNA and proteins. However, these cells expressed little or no mRNA encoding MD2, an accessory molecule required for TLR4 signaling. Incubation of Chang epithelial cells with interferon-+ (IFN+), but not TNF-!, stimulated MD2 mRNA expression and restored LPS responsiveness. In addition, when Chang cell cultures were supplemented with soluble MD2, LPS was able to stimulate IL-6 production. The lack of LPS response, deficient expression of MD2, and induction of MD2 expression and LPS response after IFN+ priming, were also evident in IOBA-NHC cells. These results demonstrate that HCEC lack LPS responsiveness due to deficient expression of MD2 and that the response can be restored by IFN-+ priming or MD2 supplementation. KEY WORDS: conjunctival epithelial cells; lipopolysaccharide; TLR2; TLR4; MD2; interferon-+.
INTRODUCTION 1
Division of Allergy, Clinical Immunology & Rheumatology, Department of Medicine, Mail Stop 2026, The University of Kansas Medical Center, 3901 Rainbow Boulevard, Kansas City, KS 66160, USA. 2 Department of Biochemistry and Molecular Biology, The University of Kansas Medical Center, Kansas City, KS 66160, USA. 3 Experimental Immunology Branch, NCI, National Institute of Health, Bethesda, MD 20892, USA. 4 To whom correspondence should be addressed at Division of Allergy, Clinical Immunology & Rheumatology, Department of Medicine, Mail Stop 2026, The University of Kansas Medical Center, 3901 Rainbow Boulevard, Kansas City, KS 66160, USA. E-mail:
[email protected]
Conjunctival epithelium serves as a barrier against pathogens and allergens and responds to many physiological and inflammatory challenges to the eye. Human conjunctival epithelial cells (HCEC) participate in host defense mechanisms by maintaining a tear film and initiating inflammatory responses via induction of proinflammatory genes, release of cytokines and cheAbbreviations: TLR, toll-like receptors; HCEC, human conjunctival epithelial cells; LPS, lipopolysaccharide; PAMPs, pathogen-associated molecular patterns; PGN, peptidoglycan; LTA, lipoteichoic acid.
170 0360-3997/06/0400-0170/0
#
2006 Springer Science+Business Media, Inc.
Interferon-+ Induces MD2 and LPS Response in Epithelial Cells mokines and recruitment of inflammatory cells. Host defense mechanisms in HCEC involve carefully balanced effects of innate and adaptive immune components, which have to eliminate invading pathogens, while at the same time protect the eye from uncontrolled inflammatory responses. Clinical and epidemiological evidence documents that Gram-positive bacterial infection is a common cause of conjunctivitis. On the other hand, although the incidences of Gram-negative bacterial conjunctivitis are less common, their consequences are severe [1Y3]. The discriminative pattern of Gram-positive and Gram-negative pathogen recognition by HCEC is not understood. The innate immune system recognizes microbial pathogens through a family of receptors called Toll-like receptors (TLRs). Thus far, at least, eleven mammalian TLRs have been identified, and several of them participate in cellular responses to bacterial pathogens and their cellular components [4Y7]. Among them, TLR4 recognizes lipopolysaccharide (LPS) of Gram-negative organisms [8, 9] and TLR2 recognizes peptidoglycan (PGN) and lipoteichoic acid (LTA) regions of the Gram-positive bacterial cell wall [9, 10]. LPS recognition and signaling by TLR4 requires the participation of accessory molecules, CD14 and MD2 [11]. Furthermore, MD2 is essential for the translocation of functional TLR4 from cytoplasm to cell surface [12, 13]. Epithelial cells and endothelial cells either synthesize or acquire soluble CD14 from circulation. MD2 is endogenously expressed [14] and can interact with TLR4 in the endoplasmic reticulum or it can be secreted into the medium where it binds with high affinity to TLR4 [15, 16]. Human uvea, retina, sclera and conjunctiva have been found to constitutively express TLR4, MD2 and CD14 mRNA [17]. However, immunohistochemical analyses revealed protein expression of these molecules to be limited to the antigen presenting cells in these tissues [17]. The recognition of Gram-positive and Gram-negative bacterial pathogen-associated molecular patterns (PAMPs) by isolated human conjunctival cells, its association with the cellular expression of TLRs and MD2, and the regulation of TLR-mediated responses by components of the adaptive immune system have not been studied. The focus of the present study was to establish the relative responsiveness of HCEC to Gram-positive and Gram-negative bacterial cell wall components and correlate the inflammatory responses with the expression of TLR2, TLR4 and MD2 using an immortalized conjunctival cell line and a spontaneously mutated
171
primary conjunctival cells. The results demonstrate that, although HCEC express TLR2 and TLR4 mRNA and proteins and respond to challenge by the Gram-positive bacterial TLR2 ligands, they do not initially respond to the TLR4 ligand, LPS. Salient findings of this study are the demonstration that the lack of LPS response in HCEC is due to deficient expression of MD2, and that the responsiveness can be restored via IFN+-induced MD2 expression or by supplementation of HCEC cultures with soluble MD2. MATERIALS AND METHODS Human conjunctival epithelial cells, WongYKilbourne derivative of Chang conjunctival epithelial cell line, CCL20.2 (Chang cells) were obtained from American Type Tissue Culture Cell Collection (ATCC). IOBANHC cells derived from normal human bulbar conjunctival epithelial cells [18] were kindly supplied by Dr. Yolanda Diebold, University Institute of Applied Ophthalmology, Valladolid, Spain. N-2-hydroxyethylpiperazine-N0 -2-ethane-sulfonic acid (HEPES), Hank’s balanced salt solution (HBSS), trypsin-ethylenediaminetetraacetate (EDTA) and trypsin neutralizing solution (TNS) were purchased from Cambrex (San Diego, CA). Minimum essential medium (MEM) and fetal bovine serum (low endotoxin) were purchased from Hyclone Laboratories (Logan, UT). DMEM/ Nutrient MIX F-12 was purchased from Fischer Scientific. Penicillin, streptomycin, bovine insulin, cholera toxin, hydrocortisone, Escherichia coli LPS (0111:B4), lipoteichoic acid, peptidoglycan and HRPanti-FLAG were supplied by Sigma Chemical Co. (St. Louis, MO). TLR2 (H-175) and TLR4 (H-80) antibodies were purchased from Santa Cruz Biotechnology, Inc (Santa Cruz, CA), and Cy3 goat anti-rabbit and normal goat serum were obtained from Jackson Immunoresearch Laboratories (West Grove, PA). The enzymelinked immunosorbant assay (ELISA) kits for IL-6 were purchased from R & D systems (Minneapolis, MN). Culture of Epithelial Cells Chang cells were grown in MEM containing 10% fetal bovine serum, 15 mM HEPES, 100 U/ml penicillin, 100 2g/ml streptomycin at 37-C in humidified atmosphere containing 5% CO2. IOBA-NHC cells were maintained in DMEM/Nutrient MIX F-12 supplemented with human EGF (2 ng/ml), bovine insulin (1 2g/ml), cholera toxin (0.1 2g/ml), hydrocortisone (5 2g/ml) and
172
Talreja, Dileepan, Puri, Kabir, Segal, Stechschulte and Dileepan
10% fetal bovine serum [18]. At confluence, cells were detached from the culture flasks using trypsin-EDTA, washed twice, and both cell types were resuspended in MEM containing 10% FBS, 15 mM HEPES, 100 U/ml penicillin, 100 2g/ml streptomycin for all experiments. Assay of IL-6 Production Chang cells or IOBA-NHC cells (2104) were added to each of the wells of a 96-well cell culture plate and allowed to adhere for 24 h. Following adherence, selected concentrations of the activating agents were added to the monolayers and incubated in a final volume of 0.2 ml at 37-C under the atmosphere of 5% humidified CO2. After 24-h incubation, the culture supernatants were collected and analyzed for IL-6 levels by ELISA. YPolymerase Chain Reaction Reverse TranscriptionY YPCR) (RTY Total RNA was isolated from resting epithelial cells and those stimulated with TNF! (200 U/ml) or IFN+ (200 U/ml) using TRIzol Reagent (Life Technologies). For reverse transcription reaction, 2 2g of RNA of each sample was used for making cDNA using SuperscriptiII RNase Hj Reverse Transcriptase system (Life Technologies) according to the manufacturer’s protocol. PCR amplification of cDNA was performed with Taq Polymerase (Life Technologies) at 95-C for 45 s, 54-C for 45 s, and 72-C for 1 min for TLR2, TLR4 and GAPDH, 95-C for 30 s, 52-C for 45 s, and 72-C for 45 s (for MD2). The number of cycles used for each gene products were: TLR2, 30 cycles, MD2, 32 cycles, and TLR4 and GAPDH, 22 cycles. PCR products were electrophoresed on 2% agarose gel and stained with ethidium bromide. The oligonucleotide primers used for RTYPCR are given in Table 1. Immunofluorescent Staining Immunofluorescence analyses of the expression of TLR2 and TLR4 proteins were carried out as previously
described [19]. Briefly, Chang epithelial cells were plated onto each of the wells of a chamber slide at a concentration of 20,000/well. After adherence, cells were fixed with 4% paraformaldehyde, blocked and stained with rabbit anti-human TLR2 or TLR4. After an overnight incubation with primary antibody, slides were incubated for 1 h with secondary antibody (Cy3 goat anti-rabbit) and washed. Cells incubated with isotype IgG and those incubated with secondary antibody alone served as a control. The slides were viewed and imaged with an immunofluorescence microscope. Priming of Epithelial Cells with IFNg or TNFa Epithelial cells (20,000/well) were plated on to each of the wells of a 96-well plate and allowed to adhere overnight. After adherence, cells were treated with IFN+ (200 U/ml), TNF! (200 U/ml) or medium for 18 h, and washed thrice. The primed cells were then treated with LPS (100 ng/ml) or PGN (100 2g/ml) for 24 h and the culture supernatants were assayed for IL-6 levels. Transient Transfection of Human Embryonic Kidney 293 (HEK293T) Cells with MD2-FLAG Plasmid The HEK293T cells were plated at an approximate density of 7.5105 cells per well of six well plates in DMEM containing 10% heat inactivated FBS. Twentyfour hours after plating, the cells were transiently transfected using calcium phosphate precipitation method. A total of 3 2g plasmid DNA was used for transfecting the individual well with 2 2g of Flagtagged MD2 or control construct (PCDNA3.1/AMP) and pBS construct as a filler DNA. Six hours after the transfection the medium was replaced with fresh DMEM containing 2% FBS (heat inactivated) and incubated for a period of 72 h. After the incubation, culture supernatants were collected and purified for soluble MD2 (sMD2) as described by Kennedy et al. [20]. The presence of MD2-FLAG protein in sMD2 was monitored by Western Blot using anti-FLAG antibody.
Table 1. List of Oligonucleotide Primers used in RTYPCR Gene
Forward primer (50 -30 )
Reverse primer (50 -30 )
TLR2 TLR4 MD2 GAPDH
GCCAAAGTCTTGATTGATTGG TGGATACGTTTCCTTATAAG GAAGCTCAGAAGCAGTATTGGGTC TGATGACATCAAGAAGGTGGTGAAG
GCCAAAGTCTTGATTGATTGG GAAATGGAGGCACCCCTTC GGTTGGTGTAGGATGACAAACTCC TCCTTGGAGGCCATGTGGGCCAT
PCR Product size (bp) 347 548 422 240
Interferon-+ Induces MD2 and LPS Response in Epithelial Cells Western Blot The aliquots of supernatants obtained from HEK 293 T MD2-FLAG transfected cells were mixed with equal volumes of 2 SDS sample buffer and heated to 100-C for 5 min. Samples were resolved on 10% SDS PAGE gel and transferred onto a nitrocellulose membrane. After blocking for 2 h in TBST (20 mM TrisHCl, 150 mM Nacl, 0.1% Tween 20) containing 5% non-fat milk, membranes were washed three times in TBST and probed for 1 h at 4-C with HRP anti-FLAG. After washing five times in TBST, bands were detected using ECL reagents (Bio Rad). Supplementation of Chang Epithelial Cell Culture with sMD2 100 2l aliquots of conditioned media generated from mock-transfected or MD2-transfected (sMD2) cells were added to HCEC cultures. The cells were then incubated for 24 h with medium or LPS (100 ng/ml) and culture supernatants were assayed for IL-6 by ELISA. Statistical Analysis Wherever applicable, the data were analyzed by one-way analysis of variance with subsequent StudentY NewmanYKuel test. All results were expressed as meanTS.D. and P
