Histochem Cell Biol (2008) 130:509–525 DOI 10.1007/s00418-008-0443-6
ORIGINAL PAPER
Epithelial-mesenchymal transition downregulates laminin 5 chain and upregulates laminin 4 chain in oral squamous carcinoma cells Minna Takkunen · Mari Ainola · Noora Vainionpää · Reidar Grenman · Manuel Patarroyo · Antonio García de Herreros · Yrjö T. Konttinen · Ismo Virtanen
Accepted: 7 May 2008 / Published online: 22 May 2008 © Springer-Verlag 2008
Abstract Basement membranes maintain the epithelial phenotype and prevent invasion and metastasis. We hypothesized that expression of basement membrane laminins might be regulated by epithelial-mesenchymal transition (EMT), hallmark of cancer progression. As EMT is mediated by transcription factor Snail, we used oral squamous carcinoma cells obtained from a primary tumor (43A), from its EMT-experienced recurrence (43B) and Snail-transfected 43A cells (43A-SNA) displaying full
M. Takkunen (&) · N. Vainionpää · I. Virtanen Institute of Biomedicine/Anatomy, University of Helsinki, P·O. Box 63 (Haartmaninkatu 8), 00014 Helsinki, Finland e-mail:
[email protected] M. Ainola · Y. T. Konttinen Department of Medicine, Helsinki University Central Hospital, Helsinki, Finland R. Grenman Department of Otorhinolaryngology, Head and Neck Surgery, Turku University Central Hospital, 20520 Turku, Finland M. Patarroyo Department of Odontology, Karolinska Institute, 141 04 Stockholm, Sweden A. García de Herreros Programa de Recerca en Càncer, IMIM-Hospital del Mar, Universitat Pompeu Fabra, Parc de Recerca Biomèdica de Barcelona (desp 298.03), c/Doctor Aiguader 88, 08003 Barcelona, Spain Y. T. Konttinen ORTON Orthopaedic Hospital of the Invalid Foundation, Helsinki, Finland Y. T. Konttinen COXA Hospital for Joint Replacement, Tampere, Finland
EMT, as a model to study laminins and their receptors. Northern blotting, immunoXuorescence, and immunoprecipitation showed a gradual loss of laminin-511 and its receptor Lutheran from 43A to 43B and 43A-SNA cells. In contrast, neoexpression of laminin 4 mRNA was found congruent with synthesis of laminin-411. Chromatin immunoprecipitation disclosed direct binding of Snail to regions upstream of laminin 5 and 4 genes. ImmunoXuorescence and immunoprecipitation showed a switch from hemidesmosomal integrin 64 to 61 and neoexpression of 11 in 43A-SNA cells, and upregulation of integrinlinked kinase in both 43B and 43A-SNA cells. The cells adhered potently to laminin-511 and Wbronectin, whereas adhesion to laminin-411 was minimal. In contrast, laminin411 inhibited cell adhesion to other extracellular matrix proteins. In conclusion, EMT induces a switch from laminin-511 to laminin-411 expression, which may be directly controlled by Snail. Concomitant changes take place in laminin- and collagen-binding receptors. Laminin-411 reduces adhesion to laminin-511 and Wbronectin, suggesting that tumor cells could utilize laminin-411 in their invasive behavior. Keywords Epithelial-mesenchymal transition · Basement membrane · Laminin 5 chain · Laminin 4 chain · Oral squamous cell carcinoma · Snail Abbreviations BM Basement membrane ECM Extracellular matrix EMT Epithelial-mesenchymal transition GAPDH Glutaraldehyde-3-phosphate-dehydrogenase ILK Integrin-linked kinase Lm Laminin MAb Monoclonal antibody
123
510
Lu SCC
Histochem Cell Biol (2008) 130:509–525
Lutheran Squamous cell carcinoma
Introduction Basement membranes (BM) are sheets of extracellular matrix (ECM) generated by the cells at epithelial-mesenchymal interface. BMs underlie epithelia and endothelia and encircle certain isolated cells. Structural components of BM include laminins, type IV collagens, nidogens, and proteoglycans (Kalluri 2003). BM guards the epithelial phenotype and has classically been regarded to act as a barrier that averts carcinoma cells from invading the surrounding interstitial stroma. Therefore, breakdown of BM has been considered as a crucial step towards progression of malignancy (Bosman et al. 1992; Liotta and Kohn 2001). Laminins are trimeric glycoproteins composed of , , and chains. To date, 15 diVerent laminins have been recognized (Miner and Yurchenco 2004; Aumailley et al. 2005). Expression of diVerent laminin chains is cell- and tissuespeciWc, and individual cells are able to produce several laminins simultaneously. Secretion of the laminin trimer and hence the formation of whole BMs, as well as the cell-BM interactions are regarded primarily as chain-dependent (Matsui et al. 1995; Yurchenco et al. 1997). Laminin 5 chain is a component of laminins-511, -521 and -523 (Miner and Yurchenco 2004; Aumailley et al. 2005). Laminin-511 is regarded as the most widely expressed laminin found in most epithelial BMs. In contrast, laminin 4 chain, a component of laminins-411, -421 and -423, is primarily produced by cells of mesenchymal origin, e.g., muscle, adipose, and endothelial cells (Lefebvre et al. 1999; Petäjäniemi et al. 2002). Laminin 4 chain has a role in cell migration, invasion and endothelial transmigration (Sixt et al. 2001; Khazenzon et al. 2003; Wondimu et al. 2004). Accordingly, overexpression of laminin 4 chain appears to correlate with increasing malignancy in gliomas (Ljubimova et al. 2004). However, the roles of both laminin 4 and 5 chains still remain elusive in malignant progression of carcinomas. Adhesion and interaction of normal and tumor cells with ECM is mediated primarily by integrins, but also by some non-integrin molecules (Hynes 2002; Miner and Yurchenco 2004). Integrins, composed of and subunits, not only link the ECM with cytoplasmic structures, but also transmit signals to the cell interior by activating multiple pathways with eVects on proliferation, survival, and apoptosis. Furthermore, Lutheran glycoprotein is a speciWc receptor for 5 chain laminins (Kikkawa and Miner 2005). Integrinlinked kinase (ILK) connects integrins to the actin cytoskeleton and regulates actin polymerization. Through its kinase activity, ILK activates several signaling pathways (Oloumi et al. 2004).
123
Epithelial-mesenchymal transition (EMT) is an important process occurring during gastrulation and mesoderm formation in embryonic development, but it also operates in the formation, invasion, and metastasis of carcinomas (Nieto 2002; Peinado et al. 2007). EMT has a role in progression of malignancy, e.g., in oral squamous cell carcinoma (SCC) (Yanjia and Xinchun 2007). EMT leads to loss of epithelial cell polarity and cell–cell contacts, which are reXected in the reorganization of the cellular cytoskeleton and loss of E-cadherin. Snail (Batlle et al. 2000; Cano et al. 2000) and other transcription factors, e.g., ZEB-1 and ZEB2, repress E-cadherin and their proWling has associated them with EMT in diVerent carcinomas (Peinado et al. 2007). Much interest has been devoted to Snail, which has been shown to directly repress several epithelial genes, e.g., MUC1, cytokeratin 18, claudins, and occludin (Guaita et al. 2002; Ikenouchi et al. 2003; Ohkubo and Ozawa 2004) as well as to upregulate mesenchymal genes, such as Wbronectin and vimentin (Batlle et al. 2000; Cano et al. 2000; Takkunen et al. 2006). Transcriptional regulation of these molecules occurs through the consensus DNA-binding sequence for Snail, called the E-box motif (5⬘-CANNTG3⬘) (Mauhin et al. 1993). As our previous studies showed that EMT downregulates epithelial laminin-332 (Takkunen et al. 2006), we hypothesized that Snail could also have an eVect on expression of laminins-511 and -411 during progression of oral SCC. To test this hypothesis, we evaluated the production of laminin 5 and 4 chains and their receptors in oral SCC cells. We further studied eventual functional consequences of laminin 5 and 4 chain expression with cell adhesion studies. With a cell model presenting endogenous or exogenous EMT, we examined the direct eVect of transcription factor Snail on regulation of laminin expression.
Materials and methods Cell culture Oral squamous cell carcinoma cell line UT-SCC-43A (43A) was derived from a primary gingival tumor of a 75-year-old Caucasian female. The tumor was staged T4N1M0. This tumor later recurred after radiation therapy and surgery and the cell line UT-SCC-43B (43B) was derived from a recurrent tumor. 43A cells were permanently transfected with full-length, hemagglutinin-tagged cDNA of murine Snail (Batlle et al. 2000), manually cloned and selected with G418 (Sigma, St. Louis, MO). 43A, 43B and Snailtransfected 43A-SNA cells have been previously characterized (Takkunen et al. 2006). The cells were cultured in RPMI 1640 medium (Sigma) with 10% fetal calf serum and antibiotics.
Histochem Cell Biol (2008) 130:509–525
Indirect immunoXuorescence microscopy The cells were grown on glass coverslips and Wxed in methanol at ¡20°C or in 4% paraformaldehyde at room temperature for 15 min. Primary antibodies (Table 1) were applied for 1 h followed by Alexa Fluor® 488 or 594 conjugates (Molecular Probes/Invitrogen, Eugene, OR) for 30 min. The specimens were studied with Leica Aristoplan microscope equipped with an epi-illuminator and appropriate Wlters. Confocal microscopy was carried out using a Leica TCS SP2 AOBS system (Leica Microsystems AG, Mannheim, Germany) with argon excitation line 488 nm or DPSS 561 nm and HCX PL APO CS 63x1.40 NA oil immersion objective. Image stacks were collected through the specimen using a standardized 120 nm z-sampling density. Selected image stacks were further subjected to deconvolution and restoration using theoretical point spread function and iterative maximum likelihood estimation algorithm (ScientiWc Volume Imaging BV, Hilversum, the Netherlands). In a subset of experiments, cells were treated with 5 M monensin (Sigma) overnight in order to inhibit secretion of newly synthesized proteins (TartakoV 1983). Cell morphology and invasion assays Cell morphology and invasion were examined with modiWed Boyden chambers. Falcon FluoroBlok Individual Cell Culture Inserts (BD Biosciences, San Jose, CA) with 8-m pore sizes were coated with 5 mg/ml Matrigel (BD Biosciences) for 1 h. 5 £ 104 cells in 350 l culture medium were added to the upper chamber of the insert, and 900 l culture Table 1 Antibodies and antisera used
Antibodies are monoclonal unless otherwise stated
511
medium was added to the lower chamber. The cells were allowed to grow and invade at 37°C for 24 h, after which the Wlters were Wxed with 4% paraformaldehyde at room temperature for 10 min and stained with rhodamine phalloidin (Molecular Probes/Invitrogen). Filters were detached from the inserts with a scalpel, mounted on objective glasses in Vectashield mounting medium (Vector Laboratories, Burlingame, CA) and covered with cover slips. Cell growth and morphology were studied in the upper chamber and the invaded cells were detected in the lower chamber. The cells were photographed and counted with Olympus AX70 microscope (Olympus Corporation) using 10£ or 20£ objectives or with confocal microscope as mentioned above. The experiments were repeated at least three times. The diVerences between the groups were tested with a twosided, unpaired t-test with the signiWcance level set at = 0.05. Northern blot Northern blots were performed with non-radioactive, digoxigenin-labeled cRNA probes (Roche Diagnostics, Penzberg, Germany) (Takkunen et al. 2006). Total RNA was extracted with Eurozol (Euroclone, Milan, Italy), and poly-A-RNAs were enriched with Dynabeads Oligo (dT)25-beads (Dynal Biotech, Oslo, Norway). The RNAs were separated in denaturing 1.2% agarose gels and transferred by upward capillary transfer onto Hybond membranes (Amersham Biosciences, Uppsala, Sweden). The membranes were UVcrosslinked and hybridized with digoxigenin-labeled cRNA probes generated from linearized plasmid cDNA templates
SpeciWcity
Antibody
References
Laminin 4 chain
168FC10
Petäjäniemi et al. (2002)
Laminin 4 chain
Polyclonal laminin 4 chain antiserum
Iivanainen et al. (1997)
Laminin 4 chain
3H2
Wondimu et al. (2004)
Laminin 5 chain
4C7
Engvall et al. (1986)
Laminin 2 chain
S5F11
Wewer et al. (1997b)
Laminin 1 chain
113BC7
Määttä et al. (2001)
Snail
173EC3
Francí et al. (2006), Takkunen et al. (2006)
Lutheran
BRIC221
Serotec, Oxford, UK
Lutheran
Polyclonal Lutheran antiserum
Moulson et al. (2001)
Integrin 1 subunit
TS2/7
Hemler et al. (1984)
Integrin 6 subunit
GoH3
Chemicon, Temecula, CA
Integrin 1 subunit
102DF5
Ylänne and Virtanen (1989)
Integrin 4 subunit
AA3
Tamura et al. (1990)
Integrin-linked kinase
ILK
Upstate, Charlottesville, VA
Fibronectin
Polyclonal Wbronectin antiserum
Dako, Glostrup, Denmark
123
512
by in vitro-transcription. Prehybridization and hybridization with DIG Easy Hyb granules (Roche) were carried out at 68°C for 30 min and for 18 h, respectively. The probes were detected with alkaline-phosphatase-conjugated anti-digoxigenin antibody and CSPD (Roche). The blots were then exposed to HyperWlm MP (Amersham Biosciences). For re-use of the blots, the membranes were washed twice in stripping solution (50% formamide, 5% SDS, 50 mM Tris-HCl, pH 7.2) at 80°C for 60 min, and re-probed. The following cRNA probes were used: a 1.5-kb fragment of laminin 5 chain covering nucleotides 9805-11332 (Durkin et al. 1997), and a 2.7-kb fragment of laminin 4 chain covering nucleotides 94-2808 (Kortesmaa et al. 2000). Hybridizations with antisense GAPDH probes were used to conWrm the equal loading of mRNA, and hybridizations with sense cRNA probes were used as negative controls (not shown). Digoxigenin-labeled RNA molecular weight marker I (Roche) was used as a size marker. Immunoprecipitation and Western blot For immunoprecipitation experiments of laminin 5, 2 and 4 chains, methionine-starved 43A, 43B and 43A-SNA cells were labeled overnight with [35S]methionine (50 Ci/ml; Amersham Biosciences). For laminin 1 chain immunoprecipitations, the cells were left unlabeled. Culture medium was collected, cleared by centrifugation, and supplemented with normal mouse serum and 0.5% Triton X-100. For integrin and Lutheran immunoprecipitations, [35S]methioninelabeled cells were scraped oV with rubber policeman and solubilized in ice-cold RIPA buVer (10 mM Tris-HCl, pH 7.2, 150 mM NaCl, 0.1% SDS, 1.0% Triton X-100, 1.0% deoxycholate, 5 mM EDTA, and 1 mM PMSF). The samples were then preabsorbed with uncoupled GammaBind Plus Sepharose beads (Amersham Biosciences), followed by application to GammaBind Plus Sepharose beads prebound with antibodies (Table 1), and incubated at 4°C overnight. The precipitated proteins were separated with SDS-PAGE following Laemmli’s procedure with reducing 5–8% gels. [14C]Methylated Molecular Weight Marker (Amersham Biosciences) or Molecular Weight Marker (M.W. 30,000– 200,000; Sigma) were used. Immunoprecipitated bands from dried gels were detected using HyperWlm MP (Amersham Biosciences). For Western blots, the immunoprecipitated samples were diluted in reducing Laemmli⬘s sample buVer and transferred onto nitrocellulose Wlters, which were blocked with 5% dry milk in phosphate-buVered saline. Polyclonal antiserum against laminin 4 chain (Iivanainen et al. 1997) or Wbronectin (Dako, Glostrup, Denmark) was applied, and the immunoreactive bands were detected with SuperSignal® West Pico Chemiluminescent Substrate (Pierce, Rockford, IL) using horseradish peroxidase-coupled anti-rabbit immunoglobulins (Dako).
123
Histochem Cell Biol (2008) 130:509–525
Chromatin immunoprecipitation Chromatin immunoprecipitation (ChIP) was performed with ChIP-IT Express Assay Kit (Active Motif, Carlsbad, CA) according to instructions of the manufacturer. BrieXy, 43A-SNA cells were Wxed with 1% formaldehyde at room temperature for 15 min to crosslink the DNA-binding proteins to DNA. The DNA was sheared into fragments with a Dounce homogenizator followed by enzymatic digestion at 37°C for 15 min. A portion of chromatin lysate was stored as input control. DNA-protein complexes were immunoprecipitated at 4°C overnight using Protein G beads with 2–6 g of mouse IgG antibody (Dako), positive antibody against RNA polymerase II, or monoclonal antibody (MAb) 173EC3 against Snail (Francí et al. 2006; Takkunen et al. 2006). The DNA was eluted, the crosslinks were reversed at 94°C for 15 min, and proteins were removed with Proteinase K at 37°C for 1 h. Then, the DNA was used as a template for PCR. PCR with primers designed to cover laminin 5 and 4 chain promoter regions (Tables 2 and 3) were used to determine if the DNA sequences had bound Snail. First, promoter sequences for laminin 5 (NM_005560) and 4 (NM_002290) chain genes were extracted from human genome sequence using Genomatix Gene2Promoter software (Genomatix Software, Munich, Germany). Overlapping primers covering the genomic region 3,000 bp upstream of laminin 5 and 4 transcription start sites were designed with Primer3 software (Rozen and Skaletsky 2000) and were produced by Oligomer (Helsinki, Finland). Primers for GAPDH, used to detect Input DNA, were provided by the kit manufacturer. Primers were mixed with AmpliTaq Gold DNA polymerase in PCR buVer (Applied Biosystems, Foster City, CA). PCR ampliWcation was performed in a thermal cycler (RoboCycler Gradient 40; Stratagene, La Jolla, CA) as follows: reaction mixture was denatured at 95°C for 10 min, after which 40 cycles were run with denaturation at 95°C for 1 min, annealed at 60– 64°C for 1 min, extended at 72°C for 1 min, and Wnally extended for 20 min. The samples were fractionated through 1% agarose gels with a 100-bp DNA ladder (Invitrogen, Paisley, UK). Search for E-box (5⬘-CA(C/G)(C/ G)TG-3⬘) and Z-box motifs (5⬘-CAGGTG/A-3⬘) was performed with MatInspector software (Genomatix Software). Quantitative cell adhesion assay Cell adhesion experiments were performed on 96-well plates using intracellular acid phosphatase activity (Prater et al. 1991). The wells were coated with 4 g/ml recombinant human laminin-411 (Kortesmaa et al. 2002), 4 g/ml native human laminin -511 or 5 g/ml Wbronectin at room temperature for 1 h. Laminin-511 was puriWed from the
Histochem Cell Biol (2008) 130:509–525 Table 2 Primers used for chromatin immunoprecipitation, covering 3,000 bp upstream of laminin 5 chain (NM_005560) sequence
Position
Size (bp)
Orientation
Sequence
Tm
¡2939/¡2608
332
5⬘
TCAGGAGTTCACGACTCACG
60
3⬘
GGGACAATCCAAGATCCAGA
60
¡2839/¡2480
360
5⬘
TCTCAGGAATGCCACTGGAG
61
3⬘
ACGTCCTGTCCTGAATCCAC
60
5⬘
ATCTTGGATTGTCCCTGGAG
59
3⬘
GTCATCACCAAATGGACCAG
59
5⬘
GATGGACAAACTTCCTCTTGC
59
3⬘
TGGGTAAAGAGCCCACACTC
60 60
¡2622/¡2223 ¡2380/¡2015
400 366
¡2243/¡1915
329
5⬘
GCTGGTCCATTTGGTGATG
3⬘
GTTAATCACCGGGCTCACTG
61
¡2036/¡1772
265
5⬘
CAGAGTGTGGGCTCTTTACC
57
3⬘
GTGGGGAGAGCACTTTAAGC
59
¡1890/¡1535
358
5⬘
TGACACAGCGCATTCTCAG
60
3⬘
GCTTTAGATCCCGTGTGAGG
60
¡1702/¡1389
314
5⬘
AAGAAGCCCTCAGGGTCTCA
61
3⬘
CTATTAGTTCTCCCACCTGGG
58
¡1511/¡1208
304
5⬘
CCTGGACTGCAGATTCCTTG
61
3⬘
TTCTGAGCTAGCAGCTGTCC
58
5⬘
GGGATTTGAGATTTGCAGGA
60
3⬘
TCAGGTCTTCGTCTGCCTTT
60
5⬘
CTTCCCTGGAGGCAGATTT
59
3⬘
CAGCCAGGTCAGGTTCAACT
60
¡1290/¡931 ¡1016/¡572
Position indicates regions upstream of laminin 5 chain gene transcription start site
513
360 445
¡745/¡410
336
5⬘
CGACCTCCTTAAGAGCCAATT
60
3⬘
CCCACTCTTTGTTCCCCTAA
59
¡534/¡218
317
5⬘
TTCCTCTGCAGATGGTCATTC
60
3⬘
GGCCTTAACCCTTCGGA
59
culture medium of PANC-1 pancreatic adenocarcinoma cells with immunoaYnity chromatography (Tani et al. 1999), and Wbronectin was puriWed from outdated human plasma (Finnish Red Cross Blood Transfusion Service, Helsinki, Finland) with gelatin-Sepharose aYnity chromatography (Amersham Biosciences) (Engvall and Ruoslahti 1977). The wells were post-coated with 3% bovine serum albumin (Sigma) at room temperature for 1 h. In order to prevent synthesis and secretion of endogenous proteins, the cells were preincubated with cycloheximide (10 g/ml; Sigma) at 37°C for 1 h, after which the cells were trypsinized and treated with trypsin-neutralizing solution (Promocell, Heidelberg, Germany). 2 £ 104 43A, 43B and 43A-SNA cells in serum-free medium supplied with cycloheximide were added to each well, and the plates were incubated at 37°C for 1 h. After washing in phosphatebuVered saline, phosphatase substrate solution (5 mg/ml Phosphatase substrate in 50 mM acetate buVer, pH 5.0; Sigma, 1% Triton X-100) was added and the plates were incubated at 37°C for 1 h. The reaction was stopped with 1 M NaOH and the absorbances were measured at 450 nm. The experiments were performed in triplicate, and absorbances were expressed §SD of three wells. The diVerence
between the groups were tested with a two-sided, unpaired t-test with the signiWcance level set at = 0.05.
Results To study the expression of laminins and their receptors in oral SCC cells, we used a cell model with characteristics of EMT. This in vitro model comprises primary tumor cell line 43A, endogenously EMT-experienced recurrence 43B, and Snail-transfected primary tumor cell line 43A-SNA (Takkunen et al. 2006). 43A cell line displays a typical, epithelial cobblestone-like phenotype with E-cadherin at cell– cell junctions, whereas 43B cells show distinct mesenchymal characteristics, e.g., N-cadherin at cell–cell junctions, abundance of vimentin Wlaments and disappearance of squamous cell cytokeratins. 43B cells express E-cadherin repressors ZEB-1 and ZEB-2. 43A cells acquire a complete mesenchymal phenotype when stably transfected with Snail (43A-SNA) (Takkunen et al. 2006). In this study, we Wrst examined the invasion capabilities of 43A, 43B and 43A-SNA cells using modiWed Boyden chambers. The cells were seeded on Matrigel-coated Wlter
123
514 Table 3 Primers used for chromatin immunoprecipitation, covering 3,000 bp upstream of laminin 4 chain (NM_002290) sequence
Histochem Cell Biol (2008) 130:509–525
Position
Size (bp)
Orientation
Sequence
Tm
¡2754/¡2447
308
5⬘
GAGCAGTGAGTCCGACCAAG
61
3⬘
TTGGGAGCTTGGCATGTAAC
61
¡2619/¡2222
398
5⬘
GAATGCCTAACCTCCTCCAA
59
3⬘
ATCTGGGCCCTCTTCTGTCT
60
¡2325/¡1958
368
5⬘
GGAAGAGCTGGGAGCACATA
60
3⬘
CATGTTTGGTTTAGTTGAGAGACTG
59
5⬘
TTTAAAGGGTGACTGGGTCAG
59
3⬘
AGCCCAGGTAAATCTGATGG
59
5⬘
GCTTCCTTTGGCTTTGGTTC
61
¡2059/¡1732
Position indicates regions upstream of laminin 4 chain gene transcription start site
328
¡1813/¡1253
561
3⬘
CAGAGGTGAAGGAAATGGACA
60
¡1339/¡1007
333
5⬘
GCCCAGCCCTAAATGAGAC
60
3⬘
GCACCTAACATGTGCCAGATAC
60
¡1076/¡726
351
5⬘
TGGTACTACTTTGCAGGAATGC
59
3⬘
TGTGGATGGGATAGTGTCTGC
61
¡873/¡533
341
5⬘
TGGAAGCTTACCTGGGTGTC
60
3⬘
TTCATCCTAAAGAGGTGCTTTG
59
¡637/¡293
345
5⬘
TACAGGCCAAGAGGAAGAGG
59
3⬘
CTCTGAAGGCAGAGGGTCAG
60
5⬘
GGTGGCCAGTGAATCTGAAG
61
3⬘
ACACTGAGGTCCGCCTTTC
60
¡411/¡61
351
chambers and allowed to grow for 24 h. 43A cells formed large, round colonies in Matrigel, reminiscent of low-metastatic cells. 43B and especially 43A-SNA cells formed branching colonies with few cell–cell contacts (Fig. 1a–c).
The cells which had invaded the matrix to the lower chamber were stained and counted. A signiWcant increase in cell invasion was found in 43B (P < 0.001) and 43A-SNA cells (P < 0.001) when compared to 43A cells. Invasion of the
Fig. 1 Cell morphology and cell invasion of 43A, 43B and 43A-SNA cells. 50,000 cells were seeded on Matrigel-coated Wlters and allowed to grow and invade for 24 h. Confocal images show the morphological diVerences between cell colonies in the upper Wlter chamber (a–c). 43A cells formed round colonies, whereas 43B and 43A-SNA cells displayed a mesenchymal phenotype with reduced cell-cell junctions. An
example of the invaded cells is shown in the lower Wlter chamber after 24 h (d–f). The invasion ability of EMT-experienced 43B and 43ASNA cells was signiWcantly (P < 0.001) increased when compared to 43A cells. Invasion of 43B cells was Wvefold, and 43A-SNA 50-fold, to that of 43A cells (g). Filter pores can be seen in photographs as round dots or rings. Scale bar: 10 m
123
Histochem Cell Biol (2008) 130:509–525
matrix by 43B cells was Wvefold compared to invasion by 43A cells, and invasion by 43A-SNA cells was 50-fold to that by 43A cells (Fig. 1d–g). Laminin 5 chain expression is downregulated in EMT-experienced cells Our previous studies showed that EMT terminated the synthesis of epithelial laminin-332 (Takkunen et al. 2006). We therefore studied the expression of laminin 5 chain, found in all epithelial BMs with Northern blots. A 12-kb transcript corresponding to laminin 5 chain mRNA was detected in 43A and 43B cells, the transcript appearing slightly weaker in 43B cells, whereas in 43A-SNA cells, no expression of laminin 5 chain mRNA was detected (Fig. 2a). Expression of the corresponding laminin 5 chain protein was studied with immunoXuorescence microscopy.
515
The cells were treated with monensin to inhibit protein secretion so that the newly synthesized proteins accumulate in the cytoplasm. Immunoreactivity for laminin 5 chain was found in cytoplasmic vesicles in 43A and to some extent also in 43B cells, whereas no reactivity was detected in 43A-SNA cells (Fig. 2b). Synthesis and secretion of laminin 5 chain was further studied with immunoprecipitation of [35S]methioninelabeled cells (Fig. 2c). MAb 4C7 precipitated two polypeptides of Mr 380,000 and 390,000, corresponding to laminin 5 chain (Champliaud et al. 2000), from the culture medium of 43A cells. In addition, two polypeptides of Mr ca. 200,000 and Mr 220,000 were detected, corresponding to laminin 1 and 1 chains, respectively. Also in 43B cell culture medium laminin 5, 1, and 1 chains were found, but the bands were distinctly fainter in 43B medium than in the 43A medium. In 43A-SNA cell culture medium no polypeptides were precipitated with MAb 4C7. Immuno-
Fig. 2 Expression of laminin 5 chain and laminin-511 in 43A, 43B and 43A-SNA cells. Northern blots of 43A, 43B and 43ASNA cells (a) detected a 12-kb transcript for laminin 5 chain in 43A and a lighter transcript in 43B cells, whereas no laminin 5 mRNA was detected in 43ASNA cells. Equal loading of mRNA was ensured with GAPDH hybridizations. Immunoreactivity for laminin 5 chain (b) was detected in 43A and 43B cell cytoplasm after inhibition of protein secretion with monensin. 43A-SNA cells remained negative. Scale bar: 10 m. Immunoprecipitation of culture medium of [35S]methionine-labeled cells with MAb against laminin 5 chain (c) precipitated polypeptides of Mr ca. 380,000 and 390,000 corresponding to laminin 5 chain, and Mr ca. 220,000 1 and 1 chains in 43A cells. A progressive loss of laminin-511 chains was detected in 43B and 43A-SNA cells. Immunoprecipitation with MAb against laminin 2 chain did not detect any polypeptides in 43A, 43B, or 43A-SNA cells. Lm, laminin; C, control lane with no antibody
123
516
precipitations with MAb S5F11 against laminin 2 chain did not detect any polypeptides in 43A, 43B, or 43A-SNA cells, indicating that laminins-521 or -421 were not produced (Fig. 2c). These results suggest that 43A cells synthesize and secrete laminin 5 chain in form of laminin511, whereas in 43B cells, expression of laminin 5 is decreased. 43A-SNA cells do not at all express laminin 5 mRNA and do not synthesize and secrete laminin-511. Laminin 4 chain is upregulated in EMT Since laminin 4 chain is produced by cells of mesenchymal origin, we investigated the expression of laminin 4 chain mRNA in EMT-experienced SCC cells. Northern blots with cRNA probe to laminin 4 chain showed no transcripts in 43A cells, whereas 6.5-kb transcripts of laminin Fig. 3 Expression of laminin 4 chain and laminin-411 in 43A, 43B and 43A-SNA cells. Northern blots of 43A, 43B and 43ASNA cells (a) with an antisense probe to laminin 4 chain detected a 6.5-kb transcript in 43B and 43A-SNA cells. Laminin 4 chain mRNA was not found in 43A cells. Equal loading of mRNA was ensured with GAPDH hybridizations. Monensin treatment showed cytoplasmic accumulation of laminin 4 chain (b) in 43B and 43A-SNA cells, whereas 43A cells remained negative. Scale bar: 10 m. Immunoprecipitation of culture medium with MAb against laminin 4 chain (c) showed bands of Mr 180,000– 220,000 corresponding to laminin 1 and 1 chains in 43B and 43A-SNA cells, whereas 43A cells were negative. C, control lane with no antibody. Immunoprecipitation of culture medium with MAb against laminin 1 chain followed by Western blot with polyclonal antibody against laminin 4 chain (d) showed no bands in 43A cells. Instead, broad bands of Mr 180,000– 220,000, indicating presence of laminin 4 chain, were detected in 43B and 43A-SNA cells. C, control lane with no antibody
123
Histochem Cell Biol (2008) 130:509–525
4 chain were found in 43B and 43A-SNA cells (Fig. 3a). Similarly, after monensin treatment, MAb 168FC10 showed no immunoreactivity for laminin 4 chain protein in cytoplasmic vesicles in 43A cells, whereas laminin 4 chain protein was found in both 43B and 43A-SNA cells (Fig. 3b). Further, immunoprecipitation with MAb 3H2 against laminin 4 chain showed no polypeptides in 43A cell culture medium, whereas prominent bands of Mr 180,000 and 220,000 corresponding to laminin 1 and 1 chains (Champliaud et al. 2000) were detected in 43B and 43ASNA cells (Fig. 3c). However, because precipitates of laminin 4 chain are of the same sizes as 1 and 1 chains, the size of laminin 4 chain could not be veriWed conWdently. Therefore, additional Western blots were performed to detect laminin 4 chain. Immunoprecipitation of culture
Histochem Cell Biol (2008) 130:509–525
medium with MAb 113BC7 against laminin 1 chain followed by Western blot with polyclonal antibody against laminin 4 chain showed no bands in 43A cells (Fig. 3d). Instead, broad laminin 4 chain bands of Mr ca. 180,000– 220,000 (Kortesmaa et al. 2000; Sasaki et al. 2001) were seen in 43B and 43A-SNA cells. A slight size diVerence was found between the precipitated proteins in 43B and 43A-SNA cells, which suggests that the secreted laminin 4 chains are diVerently N-glycosylated or modiWed by glycosaminoglycans (Sasaki et al. 2001; Kortesmaa et al. 2002; Wondimu et al. 2004). Taken together, these results suggest that expression of laminin 4 chain mRNA and laminin-411 is induced upon EMT. Snail binds directly to laminin 5 and laminin 4 promoter sequences To determine whether downregulation of laminin 5 chain and upregulation of laminin 4 chain represents a direct eVect of Snail action, we conducted chromatin immuno-
517
precipitation (ChIP). Immunoprecipitation of 43A-SNA cells with Snail antibody followed by PCR ampliWcation with primers (Tables 2 and 3) covering 3,000 bp upstream of laminin 5 and 4 chains were used to detect Snail-chromatin complexes. ChIP with Snail antibodies disclosed two promoter regions (¡1890/¡1535; ¡1016/¡572) upstream of laminin 5 (Fig. 4a) and three regions (¡2059/¡1732; ¡1339/¡1007; ¡873/¡533) upstream of laminin 4 chain gene (Fig. 4b). Snail binds to E-box motifs 5⬘-CANNTG-3⬘ in promoter sites (Mauhin et al. 1993). E-box motifs were present in both of the laminin 5 promoter precipitates (one CAGG TG sequence within ¡1890/¡1535; two CAGGTG, and two CAGCTG sequences within ¡1016/¡572), and in two of the three laminin 4 promoter precipitates (one CAGG TG sequence within ¡1339/¡1007 and one CAGCTG sequence within ¡873/¡533) (Fig. 4c). Within ¡2059/ ¡1732 of laminin 4 promoter precipitate, a highly similar sequence, CAGGTA, also called Z-box motif, was detected. Taken together, these results suggest that Snail
Fig. 4 Chromatin immunoprecipitation (ChIP) analysis of Snail association with genomic regions containing predicted promoter sites for laminin 5 and 4 chain. SpeciWc MAb recognizing Snail was used to immunoprecipitate Snail-bound chromatin in 43A-SNA cells. After PCR ampliWcation, chromatin enrichment was detected at two regions (¡1890/¡1535; ¡1016/¡572) upstream of laminin 5 gene transcription start site (a), and at three regions (¡2059/¡1732; ¡1339/¡1007; ¡873/¡533) upstream of laminin 4 gene transcription start site (b). IgG was used as a negative control, and Input DNA with primers against GAPDH was used as a positive control. Diagram showing E-box and Zbox (c) motifs found in Snailprecipitates 3,000 bp upstream of transcription start site (ATG). Five E-box motifs are present in laminin 5 chain promoter precipitates, whereas two E-boxes and one Z-box are present in laminin 4 chain promoter precipitates
123
518
binds in vivo to speciWc 5⬘-Xanking regions of laminin 5 and laminin 4 chain genes and thus may directly control their expression. Laminin 5 chain receptor Lutheran is downregulated in EMT To Wnd out whether EMT also aVects the laminin 5 chainmediated signaling at the receptor level, we Wrst studied the expression of Lutheran glycoprotein, a speciWc non-integrin receptor for laminin 5 chain (Kikkawa and Miner 2005). 43A cells showed a strong cell surface-conWned immunoXuorescence for Lutheran (Fig. 5a), whereas in 43B cells the immunoreactivity was punctate and heterogeneously distributed. No Lutheran immunoreactivity was found in 43A-SNA cells. In immunoprecipitation of RIPA-extracted cells, polyclonal antibody against Lutheran revealed a prominent Mr 85,000 band, corresponding to Lutheran (Parsons et al. 2001) (Fig. 5b). In 43B cells, only a faint band was detected, whereas in 43A-SNA cells no immunoreactive bands were found. These results suggest that during EMT, synthesis of both laminin-511 and its receptor, Lutheran, are decreased. Integrin subunits reassemble upon EMT of oral SCC cells We then performed immunoXuorescence microscopy and integrin immunoprecipitations from RIPA-extracted cells to analyze the expression of diVerent laminin- and collagen-binding receptors in our cell model. Integrin 64 binds laminin-332 at hemidesmosomes, but also acts as a receptor for laminin-511 (Kikkawa et al. 2000; Pouliot et al. 2001). Immunoreactivity for integrin 6 subunit was detected in 43A cells in a granular manner, a labeling pattern typical for hemidesmosomes (Takkunen et al. 2006) (Fig. 5a). In 43B and 43A-SNA cells, only diVuse, cell surface-conWned immunoreactivity was detected. However, immunoreactivity for integrin-linked kinase (ILK) was not found in 43A cells, whereas in 43B and 43A-SNA cells prominent, elongated streaks of reactivity were detected, resembling focal adhesions. Immunoprecipitations with MAb 102DF5 against integrin 1 subunit revealed Mr 110,000 bands in all cells associated with several subunits (Fig. 5b; lanes 1, 6, 11). MAb AA3 against integrin 4 subunit showed in 43A cells Mr 140,000 and Mr 210,000 bands, corresponding to integrin 6 and 4 (lane 2), respectively, whereas in 43B and 43ASNA cells no integrin subunits were detected (lanes 7, 12). MAb TS2/7 against integrin 1 subunit did not precipitate any polypeptides in 43A and 43B cells (lanes 3, 8), whereas in 43A-SNA cells, prominent bands of Mr 200000 and Mr 110,000 bands were found, corresponding to integrin 1 and 1 subunits (lane 13). MAb GoH3 against integrin 6 sub-
123
Histochem Cell Biol (2008) 130:509–525
unit showed that integrin 6 pairs with 4 in 43A and 43B cells (lanes 4, 9), but in 43A-SNA cells, 6 pairs with 1 (lane 14). Western blots showed no ILK bands in 43A cells, whereas clear Mr 59,000 bands, corresponding to ILK (Somasiri et al. 2001), were seen in 43B and 43A-SNA cell lysates (Fig. 5b). These results suggest that 43A and to some extent also 43B cells express integrin 64, whereas in 43A-SNA cells, 6 associates with 1 subunit. Integrin 64 has been shown to bind laminin-332 and laminin-511, whereas integrin 61 is among the few receptors for laminin-411 (Kortesmaa et al. 2000; Fujiwara et al. 2001). Furthermore, in 43A-SNA cells, neoexpression of collagen receptor integrin 11 was detected, and ILK was found in 43B and 43A-SNA cells. Laminin-411 decreases adhesion of oral SCC cells In order to elicit the role of diVerent laminins in the adhesion of oral SCC cells, we performed quantitative cell adhesion assays. Wells of 96-well plates were coated with 5 g/ ml Wbronectin or with 4 g/ml laminins -511 or -411, after which the cells were allowed to adhere. Cycloheximide was applied to prevent endogenous secretion and deposition of ECM proteins. The cells adhered signiWcantly (P < 0.001) to Wbronectin and laminin-511, whereas adhesion to laminin-411 was negligible (Fig. 6a). Since it has been shown that laminin-411 may have a role in detachment and migration of some cancer cells (Fujiwara et al. 2001; Khazenzon et al. 2003; Vainionpää et al. 2007), we studied whether coexisting laminin-411 has an eVect on cell adhesion to Wbronectin and laminin-511. The wells were again coated with either 5 g/ml Wbronectin or 4 g/ml laminin-511 but together with increasing concentrations (1–20 g/ml) of laminin-411. Adhesion of 43A, 43B and 43A-SNA cells to Wbronectin was signiWcantly (P < 0.001) inhibited already with 5 g/ml laminin-411 (Fig. 6b). Total inhibition of adhesion of 43A and 43B cells, and 60% inhibition of 43A-SNA cells to Wbronectin was gained with 20 g/ml laminin-411. Laminin-411 also inhibited adhesion to laminin-511, but this was not as prominent as inhibition of adhesion to Wbronectin (Fig. 6c). Adhesion to laminin-511 was slightly inhibited in 43A cells (P = 0.06), and signiWcantly in 43B (P < 0.001) and 43ASNA (P < 0.001) cells with 20 g/ml laminin-411. These results suggest that although oral SCC cells do not adhere to laminin-411, it may have a role in the inhibition of cell adhesion to other ECM proteins. Finally, we aimed to elucidate whether the inhibition of cell adhesion to Wbronectin by laminin-411 was due to a direct interaction between the proteins. Immunoprecipitation of 43B cell culture medium with MAb 3H2 against laminin-411 followed by Western blots with polyclonal antiserum against Wbronectin showed a precipitate of Mr ca.
Histochem Cell Biol (2008) 130:509–525
519
Fig. 5 Expression of Lutheran, integrins, and integrin-linked kinase in 43A, 43B and 43A-SNA cells. A strong, cell surface-conWned immunoreactivity for Lutheran (Lu), a laminin 5 chain-speciWc receptor, was found in 43A cells, and a punctate heterogeneous expression for Lutheran was found in 43B cells (a). 43A-SNA cells showed no reactivity for Lutheran. Immunoreactivity for integrin 6 subunit was detected in a typical “Swiss cheese”-like manner in 43A cells, whereas in 43B and 43A-SNA cells, expression was evenly distributed to the cell surface. Immunoreactivity for integrin-linked kinase (ILK) was not detected in 43A cells, whereas in 43B and 43A-SNA cells, strong reactivity was found in nail-like structures. Scale bar: 10 m. Immunoprecipitation of 43A, 43B and 43A-SNA cell lysates (b) showed decreasing amounts of Mr 85,000 form of Lutheran during EMT in 43B and 43ASNA cells. C, control lane with no antibody. Immunoprecipitation with MAb against integrin 1 subunit precipitated several subunits in 43A, 43B and 43ASNA cells (lanes 1, 6, 11). MAb against integrin 4 precipitated 6 and 4 subunits in 43A cells (lane 2), whereas 43B and 43ASNA cells remained negative (lanes 7, 12). MAb against collagen receptor integrin 1 detected in 43A-SNA cells integrin 1 and 1 subunits (lane 13), which were not found in 43A or 43B cells (lanes 3, 8). MAb against integrin 6 precipitated strong bands of 6 and 4 in 43A and fainter bands in 43B cells (lanes 4, 9), whereas in 43A-SNA cells, 6 precipitated with 1 (lane 14), suggesting a change in integrin subunit association. Lanes 5, 10, 15; controls with no antibody. Western blots showed expression of Mr 59,000 ILK in 43B and 43A-SNA cell lysates, but not in 43A cells. Actin bands indicate equal loading. Asterisk, unspeciWc bands
123
520
Histochem Cell Biol (2008) 130:509–525
Fig. 6 Adhesion of 43A, 43B and 43A-SNA cells to recombinant laminin-411, laminin-511, and Wbronectin. In quantitative cell adhesion assay (a), 43A, 43B or 43A-SNA cells adhered signiWcantly (P < 0.001) to wells coated with 5 g/ml Wbronectin or 4 g/ml laminin-511, but did not adhere to laminin-411. Adhesion of oral SCC cells to 5 g/ml Wbronectin in the presence of increasing concentrations of laminin-411 (b). Adhesion to Wbronectin was signiWcantly inhibited by 5 g/ml laminin-411 (P < 0.001). With 20 g/ml laminin-411, total
inhibition of cell adhesion to Wbronectin was accomplished in 43A and 43B cells and 60% inhibition was detected in 43A-SNA cells. Adhesion to laminin-511 (c) was inhibited with 20 g/ml laminin-411 in 43A cells (P = 0.06), and signiWcantly in 43B (P < 0.001) and 43ASNA cells (P < 0.001). Immunoprecipitation of 43B cell culture medium (d) with MAb against laminin 4 chain and Western blot with polyclonal antiserum against Wbronectin detected a Mr 220,000 band corresponding to Wbronectin (Fn). C, control lane with no antibody
220,000, corresponding to Wbronectin (Fig. 6d). These Wndings suggest that laminin-411 binds to Wbronectin and hinders its functions as a cell adhesion substrate.
have detected Snail expression in invasive fronts of laryngeal SCC (Francí et al. 2006). Recent studies attribute a more dynamic role for BM laminins in the maintenance of epithelial cell diVerentiation and tumorigenesis (Ziober et al. 2006). We have shown earlier that oral SCC cells lose the expression of laminin-332 chains via endogenous and also via Snail-induced EMT (Takkunen et al. 2006). In line with our results, it was recently suggested that transcription factors Snail, ZEB-1 and ZEB-2 repress laminin 3 chain expression also in vivo (Spaderna et al. 2006). In this study, we hypothesized that apart from laminin-332, EMT might regulate the expression of other laminins as well. To clarify this point, EMT was studied at several levels, namely expression, regulation and signal transduction, coupled with functional adhesion studies, using a set of oral SCC cells. Upon EMT, the cells formed branching colonies in Matrigel and were signiWcantly more invasive than the primary tumor 43A cells. In particular, EMT induced a switch of laminin 5 chain to laminin 4 chain synthesis, probably due to binding of transcription factor Snail to speciWc regions upstream of both laminin chain genes. A concomitant loss of laminin 5 chain receptor Lutheran and induction of mesenchyme-
Discussion At the periphery of carcinomas, individual malignant cells detach from the tumor mass and act independently within the extracellular matrix of the stroma. This change in tissue architecture has been suggested to take place through EMT (Guarino et al. 2007; Peinado et al. 2007). BM proteins form the Wrst barrier which migrating carcinoma cells must penetrate during malignant transformation, followed by invasion to interstitial stroma. Fragmented or totally absent BMs have been detected in epithelial carcinomas, including also oral SCC (Hagedorn et al. 1998; Määttä et al. 2001), and this phenomenon has been recently linked in colon carcinomas to EMT (Spaderna et al. 2006). EMT has a role also in oral SCC (Yanjia and Xinchun 2007), as microarray studies have indicated upregulation of EMT-related genes in high-risk head and neck SCC tumors (Chung et al. 2006) and in their metastases (Yang et al. 2007). Accordingly, we
123
Histochem Cell Biol (2008) 130:509–525
linked integrin 11 and ILK were found. Laminin-332 and laminin-511 receptor integrin 64 was dissociated and instead integrin 6 subunit paired with 1, potentially relating to their invasion capabilities. Finally, laminin-411 inhibited adhesion of oral SCC cells to laminin-511 and Wbronectin, and laminin-411 was found to interact with the Wbronectin molecule. Laminin 5 chain is crucial for development, as laminin 5 knock-out mice die at E13.5-17 with severe defects in placental vessels, neural tube, limbs, and kidney (Miner et al. 1998; Miner and Li 2000). Laminin 5 chain controls epithelial morphogenesis, for instance, in submandibular gland development (Rebustini et al. 2007). Peptides corresponding to active sites in the globular domain of laminin 5 chain inhibit tumor cell migration, tumor formation, invasion, and angiogenesis (Hibino et al. 2004), suggesting that laminin 5 chain and laminin-511 may have a protective role in tumorigenesis. Our present Wndings support this assumption. 43A cells expressed strongly laminin 5 chain mRNA and laminin-511 protein, whereas in cells which had undergone EMT, laminin 5 chain and laminin-511 were diminished or totally lacking. Although well-preserved laminin 5 chain expression has been reported in BMs of, e.g., renal tumors (Lohi et al. 1996) and prostate carcinoma (Brar et al. 2003), reduced laminin 5 chain expression has been described in oral SCC (Kosmehl et al. 1999), non-small cell lung carcinomas (Akashi et al. 2001), invasive areas of colorectal carcinomas (Lohi et al. 2000), and diVuse-type gastric carcinomas (Tani et al. 1996). Therefore, it may be assumed that diVerent carcinomas behave diVerently upon malignant transformation in respect of laminin 5 chain expression. Laminin 4 chain is principally produced by cells of mesenchymal origin (Lefebvre et al. 1999; Petäjäniemi et al. 2002). Laminin 4 knock-out mice are viable, but present an abnormal structure of capillary BM leading to microvascular defects and hemorrhage (Thyboll et al. 2002). Laminin 4 chain has been suggested to play a role in invasion (Khazenzon et al. 2003) and migration through endothelia (Sixt et al. 2001; Wondimu et al. 2004). Studies concerning laminin 4 chain expression in malignancies have thus far focused on non-epithelial cancers. For example, increased laminin 4 expression has been found during progression of gliomas (Ljubimova et al. 2004). Recently, laminin 4 chain expression was reported in renal cell carcinomas (Vainionpää et al. 2007). Our results showed that EMT induced 43B and 43A-SNA cells to synthesize laminin 4 chain concomitantly with 1 and 1 chains, forming laminin-411, whereas no such expression was found in 43A cells. Interestingly, in 43B cells, a simultaneous expression of laminins-511 and -411 was detected. These cells have undergone an endogenous, i.e., spontaneous EMT driven by transcription factors ZEB-1
521
and ZEB-2, and seem to represent a milder form of EMT (Takkunen et al. 2006). Only limited information is available concerning transcriptional regulation of laminins in general, and laminin 4 and 5 chains in particular (Aberdam et al. 2000). Since laminins have strictly regulated expression proWles during development and in adult tissues, it is presumable that their regulation is of utmost importance. Cells losing expression of one laminin chain have been suggested to acquire other, compensatory laminin chains. For instance, knock-out of laminin 5 induces the levels of 1-, 2-, and 4-containing laminins (Miner et al. 1998). Factors controlling these events are yet unclear. Genes encoding laminin 5 and 4 chains reside at 20q13.2-q13.3 and 6q21, respectively, but their promoter elements have not been characterized. Therefore, we performed chromatin immunoprecipitations to test our hypothesis and to gain information of eventual binding of transcription factor Snail to these regions. We found that Snail bound to two chromatin regions in laminin 5 chain promoter, and to three regions in laminin 4 chain promoter. All but one of these regions contained E-boxes, which represent previously characterized consensus binding sites for Snail (Mauhin et al. 1993). The Wfth region of interest, lacking E-box, contained a highly similar sequence with a single nucleotide deviation (CAGGTG ! CAGGTA, also called Z-box), which has been recently shown to bind some other Snail- and EMT-related transcription factors (Spaderna et al. 2006). Our results suggest that Snail binds to speciWc regions upstream of both laminin 5 and 4 chain sequences, suggesting that Snail may control their expression in vivo. In 43B cells, the potential regulators of laminin expression are ZEB-1 and ZEB-2 transcription factors, which also bind E-box motifs (Postigo and Dean 2000). To our knowledge, this is the Wrst study disclosing how transcription of laminin 5 and 4 chains is regulated and suggesting that they obey a reciprocal transcription mode. We were also interested in the expression of laminin receptors in our cell system. Lutheran is a speciWc receptor of 5 chain laminins (Moulson et al. 2001; Parsons et al. 2001), of which only laminin-511 was found in our cell model. We have shown before that Lutheran is expressed coaligned with laminin 5 chain in normal oral BM (Willberg et al. 2007). Here, a strong cell surface-conWned immunoreactivity was evident for Lutheran in 43A cells, whereas in 43B cells, only a diVuse and faint expression was found. 43A-SNA cells completely lacked Lutheran expression. A similar decrease in Lutheran expression was detected with immunoprecipitations. Therefore, the results suggest that concurrent with decreasing expression of laminin-511, also expression of its counterpart Lutheran is diminished. Lutheran or its shorter spliceoform, B-CAM, has been studied in diVerent carcinomas (Kikkawa and
123
522
Miner 2005; Määttä et al. 2005). B-CAM has been detected in squamous cell and basal cell carcinomas of skin (Schön et al. 2000). As it was not found in malignant melanoma, an epithelial origin was suggested for B-CAM. In tumorigenesis of ovarian epithelium, polarized expression of Lutheran is lost (Määttä et al. 2005). This has been suggested to indicate that the stabilizing interactions between epithelial cells and BM may be lost as a consequence of progression of malignancy, which conclusion is clearly supported by the present Wndings. Oral epithelial cells, as well as oral SCC cells, have been shown to contain integrins 64, 61, 31, and 21 (Ziober et al. 2006). Distribution of integrin 6 was found in a granular pattern in 43A cells, whereas in EMT-experienced cells, its distribution was diVusely organized along the cell surface. Immunoprecipitation studies showed that integrin 6 paired with 4 subunit in 43A cells and to some extent in 43B cells. However, in 43A-SNA cells, 6 subunit coprecipitated 1 subunit. When pairing with 4, integrin 64 mediates the formation of hemidesmosomes, which link the intermediate Wlament cytoskeleton to BM laminin-332. Integrin 64 also transmits cell adhesion to laminin-511 (Kikkawa et al. 2000). Extensive loss or changes in polarization of integrin 64 complex have been reported in oral SCC (Downer et al. 1993; Garzino-Demo et al. 1998). On the other hand, integrin 61, associated with focal contacts, is the main receptor for laminin-411 and promotes cell motility and tumorigenesis in breast carcinoma (Wewer et al. 1997a; Fujiwara et al. 2001). We have shown before that EMT reduces integrin 64 complex in 43B and 43ASNA cells (Takkunen et al. 2006). Here, we showed that integrin 6 subunit redistributed and colocalized with 1 in 43A-SNA cells, corroborating previous Wndings on prostate carcinoma of a switch from 4 to 1 expression (Cress et al. 1995). We propose that a reduction of integrin 4 subunit allows 43B and 43A-SNA cells to escape from hemidesmosomal contacts and use laminin-411 receptor integrin 61 to become motile. Our studies also showed neoexpression of integrin 11 in 43A-SNA cells. Integrin 11 is a predominantly mesenchymal integrin, detected, e.g., in endothelium, visceral and smooth muscle, being absent from epithelium (Miettinen et al. 1993; Gardner et al. 1996). Integrin 1 subunit activates MAPK/Ras-pathway, which has a role in induction of EMT (Pozzi et al. 1998; Peinado et al. 2007). Dysregulation of integrin 1 has been found in carcinomas, and it is upregulated in, e.g., bladder carcinoma (Liebert et al. 1994) and in several mesenchymal tumors (Miettinen et al. 1993). Altered expression of integrin 1 has been linked to cells with migratory function, as in repair of tissue injury, or in T cell invasion (Gardner et al. 1996). Therefore, neoexpression of collagen receptor integrin 11 in oral SCC cells may indicate tendency to migration and invasion.
123
Histochem Cell Biol (2008) 130:509–525
Integrin-linked kinase, a component of focal adhesion plaques, interacts with the cytoplasmic domains of 1 and 3 integrin subunits. ILK connects BM, cell adhesion molecules, integrins and growth factors to the actin cytoskeleton and to a range of signaling pathways (Oloumi et al. 2004). Overexpressed ILK promotes oncogenic transformation and increased invasion, possibly through repression of Ecadherin (Novak et al. 1998). ILK overexpression has been shown to be involved in the initiation of EMT (Somasiri et al. 2001), and interestingly, to activate Snail through GSK-3 pathway (Tan et al. 2001). Our results showed neoexpression of ILK in EMT-experienced cells, where it was topologically conWned to elongated streaks resembling focal adhesions. Therefore, our results extend earlier Wndings by showing that not only does ILK activate Snail, but also that both endogenous and Snail-induced EMT, in 43B and 43A-SNA cells, respectively, upregulate ILK. This could be a consequence of a positive feedback loop, where Wbronectin, abundantly deposited in EMT, stimulates engagement of integrins, further upregulates TGF- and ILK, thus maintaining EMT (Nieto 2002; Oloumi et al. 2004). Finally, to address the potential functional consequences of laminin expression in oral SCC cells, we studied their adhesion properties to Wbronectin, laminin-511, and laminin-411. Quantitative cell adhesion assay showed that all the cells adhered well to Wbronectin and laminin511. In contrast, these cells did not adhere to laminin-411. In a mouse autoimmune encephalomyelitis model, vascular BMs containing laminin-511 were impermeable to leukocytes, whereas these cells easily passed endothelial BMs containing laminin-411 (Sixt et al. 2001). Laminin-411 may participate in other processes where enhanced migration occurs, such as angiogenesis or wound healing (Fujiwara et al. 2001). Our results showed that laminin411 inhibited adhesion of oral SCC cells to Wbronectin and laminin-511 signiWcantly. In immunoprecipitation, laminin-411 and Wbronectin coprecipitated, suggesting that they bind to each other in vivo. Recently, laminin-411 has been found to have some qualities resembling matricellular proteins (Vainionpää et al. 2007). Matricellular proteins, e.g., SPARC and tenascin-C, induce intermediate state of adhesion, or de-adhesion, and may enhance cell migration (Murphy-Ullrich 2001; Bornstein and Sage 2002). Tenascin-C coprecipitates with Wbronectin and inhibits cell adhesion by preventing binding of syndecan-4 to Wbronectin (Huang et al. 2001). Therefore, our results suggest that EMT-experienced cells seem to synthesize laminin-411 and escape from strong adhesion to BM or extracellular matrix, which enables them to invade surrounding structures. Laminin-411 may impair cell adhesion to Wbronectin by blocking active sites in the Wbronectin molecule.
Histochem Cell Biol (2008) 130:509–525 Acknowledgments Professors J.H. Miner and V. Quaranta are acknowledged for providing valuable antibodies. The skillful technical assistance of Mika Hukkanen, Pipsa Kaipainen, Hannu Kamppinen, Reijo Karppinen, Marja-Leena Piironen, Outi Rauanheimo, Anne Reijula, and Hanna Wennäkoski is warmly appreciated. M.T. was supported by the K. Albin Johansson Stiftelse and the SuomalaisNorjalainen Lääketieteen Säätiö, M.A. and Y.T.K. by the Academy of Finland, the Biomedicum Helsinki Foundation, the Finska Läkaresällskapet, and the Helsinki University Central Hospital (EVO Grant), M.P. by the Swedish Cancer Society and the Karolinska Institute, and I.V. by the Helsinki University Central Hospital (EVO Grant no. TYH6269) and the Diabetes Research Foundation.
References Aberdam D, Virolle T, Simon-Assmann P (2000) Transcriptional regulation of laminin gene expression. Microsc Res Tech 3:228–237 Akashi T, Ito E, Eishi Y, Koike M, Nakamura K, Burgeson RE (2001) Reduced expression of laminin alpha 3 and alpha 5 chains in nonsmall cell lung cancers. Jpn J Cancer Res 3:293–301 Aumailley M, Bruckner-Tuderman L, Carter WG, Deutzmann R, Edgar D, Ekblom P, Engel J, Engvall E, Hohenester E, Jones JC, Kleinman HK, Marinkovich MP, Martin GR, Mayer U, Meneguzzi G, Miner JH, Miyazaki K, Patarroyo M, Paulsson M, Quaranta V, Sanes JR, Sasaki T, Sekiguchi K, Sorokin LM, Talts JF, Tryggvason K, Uitto J, Virtanen I, von der Mark K, Wewer UM, Yamada Y, Yurchenco PD (2005) A simpliWed laminin nomenclature. Matrix Biol 5:326–332 Batlle E, Sancho E, Francí C, Domínguez D, Monfar M, Baulida J, García De Herreros A (2000) The transcription factor snail is a repressor of E-cadherin gene expression in epithelial tumour cells. Nat Cell Biol 2:84–89 Bornstein P, Sage EH (2002) Matricellular proteins: extracellular modulators of cell function. Curr Opin Cell Biol 5:608–616 Bosman FT, Havenith MG, Visser R, Cleutjens JP (1992) Basement membranes in neoplasia. Prog Histochem Cytochem 4:1–92 Brar PK, Dalkin BL, Weyer C, Sallam K, Virtanen I, Nagle RB (2003) Laminin alpha-1, alpha-3, and alpha-5 chain expression in human prepubertal benign prostate glands and adult benign and malignant prostate glands. Prostate 1:65–70 Cano A, Pérez-Moreno MA, Rodrigo I, Locascio A, Blanco MJ, del Barrio MG, Portillo F, Nieto MA (2000) The transcription factor snail controls epithelial-mesenchymal transitions by repressing Ecadherin expression. Nat Cell Biol 2:76–83 Champliaud MF, Virtanen I, Tiger CF, Korhonen M, Burgeson R, Gullberg D (2000) Posttranslational modiWcations and beta/gamma chain associations of human laminin alpha1 and laminin alpha5 chains: puriWcation of laminin-3 from placenta. Exp Cell Res 2:326–335 Chung CH, Parker JS, Ely K, Carter J, Yi Y, Murphy BA, Ang KK, ElNaggar AK, Zanation AM, Cmelak AJ, Levy S, Slebos RJ, Yarbrough WG (2006) Gene expression proWles identify epithelial-tomesenchymal transition and activation of nuclear factor-kappaB signaling as characteristics of a high-risk head and neck squamous cell carcinoma. Cancer Res 16:8210–8218 Cress AE, Rabinovitz I, Zhu W, Nagle RB (1995) The alpha 6 beta 1 and alpha 6 beta 4 integrins in human prostate cancer progression. Cancer Metastasis Rev 3:219–228 Downer CS, Watt FM, Speight PM (1993) Loss of alpha 6 and beta 4 integrin subunits coincides with loss of basement membrane components in oral squamous cell carcinomas. J Pathol 3:183–190 Durkin ME, Loechel F, Mattei MG, Gilpin BJ, Albrechtsen R, Wewer UM (1997) Tissue-speciWc expression of the human laminin alpha5-chain, and mapping of the gene to human chromosome
523 20q13.2–13.3 and to distal mouse chromosome 2 near the locus for the ragged (Ra) mutation. FEBS Lett 2/3:296–300 Engvall E, Davis GE, Dickerson K, Ruoslahti E, Varon S, Manthorpe M (1986) Mapping of domains in human laminin using monoclonal antibodies: localization of the neurite-promoting site. J Cell Biol 6(pt 1):2457–2465 Engvall E, Ruoslahti E (1977) Binding of soluble form of Wbroblast surface protein, Wbronectin, to collagen. Int J Cancer 1:1–5 Francí C, Takkunen M, Dave N, Alameda F, Gómez S, Rodríguez R, Escrivà M, Montserrat-Sentís B, Baró T, Garrido M, Bonilla F, Virtanen I, García de Herreros A (2006) Expression of Snail protein in tumor-stroma interface. Oncogene 37:5134– 5144 Fujiwara H, Kikkawa Y, Sanzen N, Sekiguchi K (2001) PuriWcation and characterization of human laminin-8. Laminin-8 stimulates cell adhesion and migration through alpha3beta1 and alpha6beta1 integrins. J Biol Chem 20:17550–17558 Gardner H, Kreidberg J, Koteliansky V, Jaenisch R (1996) Deletion of integrin alpha 1 by homologous recombination permits normal murine development but gives rise to a speciWc deWcit in cell adhesion. Dev Biol 2:301–313 Garzino-Demo P, Carrozzo M, Trusolino L, Savoia P, Gandolfo S, Marchisio PC (1998) Altered expression of alpha 6 integrin subunit in oral squamous cell carcinoma and oral potentially malignant lesions. Oral Oncol 3:204–210 Guaita S, Puig I, Francí C, Garrido M, Domínguez D, Batlle E, Sancho E, Dedhar S, De Herreros AG, Baulida J (2002) Snail induction of epithelial to mesenchymal transition in tumor cells is accompanied by MUC1 repression and ZEB1 expression. J Biol Chem 42:39209–39216 Guarino M, Rubino B, Ballabio G (2007) The role of epithelial-mesenchymal transition in cancer pathology. Pathology 3:305–318 Hagedorn H, Schreiner M, Wiest I, Tubel J, Schleicher ED, Nerlich AG (1998) Defective basement membrane in laryngeal carcinomas with heterogeneous loss of distinct components. Hum Pathol 5:447–454 Hemler ME, Sanchez-Madrid F, Flotte TJ, Krensky AM, BurakoV SJ, Bhan AK, Springer TA, Strominger JL (1984) Glycoproteins of 210,000 and 130,000 m.w. on activated T cells: cell distribution and antigenic relation to components on resting cells and T cell lines. J Immunol 6:3011–3018 Hibino S, Shibuya M, Engbring JA, Mochizuki M, Nomizu M, Kleinman HK (2004) IdentiWcation of an active site on the laminin alpha5 chain globular domain that binds to CD44 and inhibits malignancy. Cancer Res 14:4810–4816 Huang W, Chiquet-Ehrismann R, Moyano JV, Garcia-Pardo A, Orend G (2001) Interference of tenascin-C with syndecan-4 binding to Wbronectin blocks cell adhesion and stimulates tumor cell proliferation. Cancer Res 23:8586–8594 Hynes RO (2002) Integrins: bidirectional, allosteric signaling machines. Cell 6:673–687 Iivanainen A, Kortesmaa J, Sahlberg C, Morita T, Bergmann U, ThesleV I, Tryggvason K (1997) Primary structure, developmental expression, and immunolocalization of the murine laminin alpha4 chain. J Biol Chem 44:27862–27868 Ikenouchi J, Matsuda M, Furuse M, Tsukita S (2003) Regulation of tight junctions during the epithelium-mesenchyme transition: direct repression of the gene expression of claudins/occludin by Snail. J Cell Sci Pt 10:1959–1967 Kalluri R (2003) Basement membranes: structure, assembly and role in tumour angiogenesis. Nat Rev Cancer 6:422–433 Khazenzon NM, Ljubimov AV, Lakhter AJ, Fujita M, Fujiwara H, Sekiguchi K, Sorokin LM, Petäjäniemi N, Virtanen I, Black KL, Ljubimova JY (2003) Antisense inhibition of laminin–8 expression reduces invasion of human gliomas in vitro. Mol Cancer Ther 10:985–994
123
524 Kikkawa Y, Miner JH (2005) Review: Lutheran/B-CAM: a laminin receptor on red blood cells and in various tissues. Connect Tissue Res 4/5:193–199 Kikkawa Y, Sanzen N, Fujiwara H, Sonnenberg A, Sekiguchi K (2000) Integrin binding speciWcity of laminin-10/11: laminin-10/11 are recognized by alpha 3 beta 1, alpha 6 beta 1 and alpha 6 beta 4 integrins. J Cell Sci Pt 5:869–876 Kortesmaa J, Doi M, Patarroyo M, Tryggvason K (2002) Chondroitin sulphate modiWcation in the alpha4 chain of human recombinant laminin-8 (alpha4beta1gamma1). Matrix Biol 6:483–486 Kortesmaa J, Yurchenco P, Tryggvason K (2000) Recombinant laminin-8 (alpha(4) beta(1) gamma(1)). Production, puriWcation, and interactions with integrins. J Biol Chem 20:14853–14859 Kosmehl H, Berndt A, Strassburger S, Borsi L, Rousselle P, Mandel U, Hyckel P, Zardi L, Katenkamp D (1999) Distribution of laminin and Wbronectin isoforms in oral mucosa and oral squamous cell carcinoma. Br J Cancer 6:1071–1079 Lefebvre O, Sorokin L, Kedinger M, Simon-Assmann P (1999) Developmental expression and cellular origin of the laminin alpha2, alpha4, and alpha5 chains in the intestine. Dev Biol 1:135–150 Liebert M, Washington R, Stein J, Wedemeyer G, Grossman HB (1994) Expression of the VLA beta 1 integrin family in bladder cancer. Am J Pathol 5:1016–1022 Liotta LA, Kohn EC (2001) The microenvironment of the tumour-host interface. Nature 6835:375–379 Ljubimova JY, Fugita M, Khazenzon NM, Das A, Pikul BB, Newman D, Sekiguchi K, Sorokin LM, Sasaki T, Black KL (2004) Association between laminin-8 and glial tumor grade, recurrence, and patient survival. Cancer 3:604–612 Lohi J, Oivula J, Kivilaakso E, Kiviluoto T, Fröjdman K, Yamada Y, Burgeson RE, Leivo I, Virtanen I (2000) Basement membrane laminin-5 is deposited in colorectal adenomas and carcinomas and serves as a ligand for alpha3beta1 integrin. APMIS 3:161– 172 Lohi J, Tani T, Leivo I, Linnala A, Kangas L, Burgeson RE, Lehto VP, Virtanen I (1996) Expression of laminin in renal-cell carcinomas, renal-cell carcinoma cell lines and xenografts in nude mice. Int J Cancer 3:364–371 Määttä M, Bützow R, Luostarinen J, Petäjäniemi N, Pihlajaniemi T, Salo S, Miyazaki K, Autio-Harmainen H, Virtanen I (2005) DiVerential expression of laminin isoforms in ovarian epithelial carcinomas suggesting diVerent origin and providing tools for diVerential diagnosis. J Histochem Cytochem 10:1293–1300 Määttä M, Virtanen I, Burgeson R, Autio-Harmainen H (2001) Comparative analysis of the distribution of laminin chains in the basement membranes in some malignant epithelial tumors: the alpha1 chain of laminin shows a selected expression pattern in human carcinomas. J Histochem Cytochem 6:711–726 Matsui C, Wang CK, Nelson CF, Bauer EA, HoeZer WK (1995) The assembly of laminin-5 subunits. J Biol Chem 40:23496–23503 Mauhin V, Lutz Y, Dennefeld C, Alberga A (1993) DeWnition of the DNA-binding site repertoire for the Drosophila transcription factor SNAIL. Nucleic Acids Res 17:3951–3957 Miettinen M, Castello R, Wayner E, Schwarting R (1993) Distribution of VLA integrins in solid tumors. Emergence of tumor-type-related expression. Patterns in carcinomas and sarcomas. Am J Pathol 4:1009–1018 Miner JH, Cunningham J, Sanes JR (1998) Roles for laminin in embryogenesis: exencephaly, syndactyly, and placentopathy in mice lacking the laminin alpha5 chain. J Cell Biol 6:1713– 1723 Miner JH, Li C (2000) Defective glomerulogenesis in the absence of laminin alpha5 demonstrates a developmental role for the kidney glomerular basement membrane. Dev Biol 2:278–289 Miner JH, Yurchenco PD (2004) Laminin functions in tissue morphogenesis. Annu Rev Cell Dev Biol 255–284
123
Histochem Cell Biol (2008) 130:509–525 Moulson CL, Li C, Miner JH (2001) Localization of Lutheran, a novel laminin receptor, in normal, knockout, and transgenic mice suggests an interaction with laminin alpha5 in vivo. Dev Dyn 1:101– 114 Murphy-Ullrich JE (2001) The de-adhesive activity of matricellular proteins: is intermediate cell adhesion an adaptive state? J Clin Invest 7:785–790 Nieto MA (2002) The snail superfamily of zinc-Wnger transcription factors. Nat Rev Mol Cell Biol 3:155–166 Novak A, Hsu SC, Leung-Hagesteijn C, Radeva G, PapkoV J, Montesano R, Roskelley C, Grosschedl R, Dedhar S (1998) Cell adhesion and the integrin-linked kinase regulate the LEF-1 and betacatenin signaling pathways. Proc Natl Acad Sci USA 8:4374– 4379 Ohkubo T, Ozawa M (2004) The transcription factor Snail downregulates the tight junction components independently of E-cadherin downregulation. J Cell Sci Pt 9:1675–1685 Oloumi A, McPhee T, Dedhar S (2004) Regulation of E-cadherin expression and beta-catenin/Tcf transcriptional activity by the integrin-linked kinase. Biochim Biophys Acta 1:1–15 Parsons SF, Lee G, Spring FA, Willig TN, Peters LL, Gimm JA, Tanner MJ, Mohandas N, Anstee DJ, Chasis JA (2001) Lutheran blood group glycoprotein and its newly characterized mouse homologue speciWcally bind alpha5 chain-containing human laminin with high aYnity. Blood 1:312–320 Peinado H, Olmeda D, Cano A (2007) Snail, Zeb and bHLH factors in tumour progression: an alliance against the epithelial phenotype? Nat Rev Cancer 6:415–428 Petäjäniemi N, Korhonen M, Kortesmaa J, Tryggvason K, Sekiguchi K, Fujiwara H, Sorokin L, Thornell LE, Wondimu Z, Assefa D, Patarroyo M, Virtanen I (2002) Localization of laminin alpha4chain in developing and adult human tissues. J Histochem Cytochem 8:1113–1130 Postigo AA, Dean DC (2000) DiVerential expression and function of members of the zfh-1 family of zinc Wnger/homeodomain repressors. Proc Natl Acad Sci USA 12:6391–6396 Pouliot N, Nice EC, Burgess AW (2001) Laminin-10 mediates basal and EGF-stimulated motility of human colon carcinoma cells via alpha(3) beta(1) and alpha(6) beta(4) integrins. Exp Cell Res 1:1– 10 Pozzi A, Wary KK, Giancotti FG, Gardner HA (1998) Integrin alpha1beta1 mediates a unique collagen-dependent proliferation pathway in vivo. J Cell Biol 2:587–594 Prater CA, Plotkin J, Jaye D, Frazier WA (1991) The properdin-like type I repeats of human thrombospondin contain a cell attachment site. J Cell Biol 5:1031–1040 Rebustini IT, Patel VN, Stewart JS, Layvey A, Georges-Labouesse E, Miner JH, HoVman MP (2007) Laminin alpha5 is necessary for submandibular gland epithelial morphogenesis and inXuences FGFR expression through beta1 integrin signaling. Dev Biol 1:15–29 Rozen S, Skaletsky HJ (2000) Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics methods and protocols: methods in molecular biology. Humana Press, Totowa, pp 365–386 Sasaki T, Mann K, Timpl R (2001) ModiWcation of the laminin alpha 4 chain by chondroitin sulfate attachment to its N-terminal domain. FEBS Lett 1:173–178 Schön M, Klein CE, Hogenkamp V, Kaufmann R, Wienrich BG, Schön MP (2000) Basal-cell adhesion molecule (B-CAM) is induced in epithelial skin tumors and inXammatory epidermis, and is expressed at cell-cell and cell-substrate contact sites. J Invest Dermatol 6:1047–1053 Sixt M, Engelhardt B, Pausch F, Hallmann R, Wendler O, Sorokin LM (2001) Endothelial cell laminin isoforms, laminins 8 and 10, play decisive roles in T cell recruitment across the blood-brain barrier
Histochem Cell Biol (2008) 130:509–525 in experimental autoimmune encephalomyelitis. J Cell Biol 5:933–946 Somasiri A, Howarth A, Goswami D, Dedhar S, Roskelley CD (2001) Overexpression of the integrin-linked kinase mesenchymally transforms mammary epithelial cells. J Cell Sci Pt 6:1125–1136 Spaderna S, Schmalhofer O, Hlubek F, Berx G, Eger A, Merkel S, Jung A, Kirchner T, Brabletz T (2006) A transient, EMT-linked loss of basement membranes indicates metastasis and poor survival in colorectal cancer. Gastroenterology 3:830–840 Takkunen M, Grenman R, Hukkanen M, Korhonen M, García de Herreros A, Virtanen I (2006) Snail-dependent and -independent epithelial-mesenchymal transition in oral squamous carcinoma cells. J Histochem Cytochem 11:1263–1275 Tamura RN, Rozzo C, Starr L, Chambers J, Reichardt LF, Cooper HM, Quaranta V (1990) Epithelial integrin alpha 6 beta 4: complete primary structure of alpha 6 and variant forms of beta 4. J Cell Biol 4:1593–1604 Tan C, Costello P, Sanghera J, Dominguez D, Baulida J, de Herreros AG, Dedhar S (2001) Inhibition of integrin linked kinase (ILK) suppresses beta-catenin-Lef/Tcf-dependent transcription and expression of the E-cadherin repressor, snail, in APC-/- human colon carcinoma cells. Oncogene 1:133–140 Tani T, Karttunen T, Kiviluoto T, Kivilaakso E, Burgeson RE, Sipponen P, Virtanen I (1996) Alpha 6 beta 4 integrin and newly deposited laminin-1 and laminin-5 form the adhesion mechanism of gastric carcinoma. Continuous expression of laminins but not that of collagen VII is preserved in invasive parts of the carcinomas: implications for acquisition of the invading phenotype. Am J Pathol 3:781–793 Tani T, Lehto VP, Virtanen I (1999) Expression of laminins 1 and 10 in carcinoma cells and comparison of their roles in cell adhesion. Exp Cell Res 1:115–121 TartakoV AM (1983) Perturbation of vesicular traYc with the carboxylic ionophore monensin. Cell 4:1026–1028 Thyboll J, Kortesmaa J, Cao R, Soininen R, Wang L, Iivanainen A, Sorokin L, Risling M, Cao Y, Tryggvason K (2002) Deletion of the laminin alpha4 chain leads to impaired microvessel maturation. Mol Cell Biol 4:1194–1202
525 Vainionpää N, Lehto VP, Tryggvason K, Virtanen I (2007) Alpha4 chain laminins are widely expressed in renal cell carcinomas and have a de-adhesive function. Lab Invest 8:780–791 Wewer UM, Shaw LM, Albrechtsen R, Mercurio AM (1997a) The integrin alpha 6 beta 1 promotes the survival of metastatic human breast carcinoma cells in mice. Am J Pathol 5:1191–1198 Wewer UM, Thornell LE, Loechel F, Zhang X, Durkin ME, Amano S, Burgeson RE, Engvall E, Albrechtsen R, Virtanen I (1997b) Extrasynaptic location of laminin beta 2 chain in developing and adult human skeletal muscle. Am J Pathol 2:621–631 Willberg J, Hormia M, Takkunen M, Kikkawa Y, Sekiguchi K, Virtanen I (2007) Lutheran blood group antigen as a receptor for alpha5 laminins in gingival epithelia. J Periodontol 9:1810–1818 Wondimu Z, Geberhiwot T, Ingerpuu S, Juronen E, Xie X, Lindbom L, Doi M, Kortesmaa J, Thyboll J, Tryggvason K, Fadeel B, Patarroyo M (2004) An endothelial laminin isoform, laminin 8 (alpha4beta1gamma1), is secreted by blood neutrophils, promotes neutrophil migration and extravasation, and protects neutrophils from apoptosis. Blood 6:1859–1866 Yang MH, Chang SY, Chiou SH, Liu CJ, Chi CW, Chen PM, Teng SC, Wu KJ (2007) Overexpression of NBS1 induces epithelial-mesenchymal transition and co-expression of NBS1 and Snail predicts metastasis of head and neck cancer. Oncogene 10:1459– 1467 Yanjia H, Xinchun J (2007) The role of epithelial-mesenchymal transition in oral squamous cell carcinoma and oral submucous Wbrosis. Clin Chim Acta 1/2:51–56 Ylänne J, Virtanen I (1989) 140,000 Wbronectin receptor complex in normal and virus-transformed human Wbroblasts and in Wbrosarcoma cells: identical localization and function. Int J Cancer 6:1126–1136 Yurchenco PD, Quan Y, Colognato H, Mathus T, Harrison D, Yamada Y, O’Rear JJ (1997) The alpha chain of laminin-1 is independently secreted and drives secretion of its beta- and gamma-chain partners. Proc Natl Acad Sci USA 19:10189–10194 Ziober AF, Falls EM, Ziober BL (2006) The extracellular matrix in oral squamous cell carcinoma: friend or foe? Head Neck 8:740–749
123
