CfT-I: an LTR-retrotransposon in Cladosporium fulvum, a fungal pathogen of tomato

Mol Gen Genet (1992) 233 : 337-347 © Springer-Verlag 1992

Original articles CfT-I: an LTR-retrotransposon in a fungal pathogen of tomato

Cladosporium fulvum,

Mark T. McHale 1'2, lan N. Roberts 1'3, Stuart M. Noble 1, Christine Beaumont 1, Michael P. Whitehead 1, Devanshi Seth 1'4, and Richard P. Oliver 1 i Norwich Molecular Plant Pathology Group, University of East Anglia, School of Biological Sciences, Norwich NR4 7TJ, UK Received November 6, 1991 Summary. A retrotransposon from the fungal tomato pathogen Cladosporium fulvum (syn. Fulvia fulva) has been isolated and characterised. It is 6968 bp in length and bounded by identical long terminal repeats of 427 bp; 5 bp target-site duplications were found. Putative first- and second-strand primer binding sites were identified. Three long open reading frames (ORFs) are predicted from the sequence. The first has homology to retroviral gag genes. The second includes sequences homologous to protease, reverse transcriptase, RNAse H and integrase, in that order. Sequence comparisons of the predicted ORFs indicate that this element is closely related to the gypsy class of LTR retrotransposons. Races of the pathogen exhibit polymorphisms in their complement of at least 25 copies of the sequence. Virus-like particles which co-sediment with reverse transcriptase activity were observed in homogenates of the fungus. This is the first report of an LTR retrotransposon in a filamentous fungus. Key words: Transposable elements - Leaf mould - Viruslike particles - Reverse transcriptase - Fulvia fulva

Introduction Despite intensive investigation of the genetic structure of filamentous fungi, knowledge of transposable elements in this group of organisms in sparse. A LINE-like transposon was detected in an African strain of Neurospora crassa (Kinsey and Helber 1989) and a number of mobile introns have also been found (Michel and Lang 1985). Laboratory strains of Aspergillus nidulans and N. crassa appear to lack active transposons (Kinsey and Helber Present addresses. 2 SmithKline Beecham, The Frythe, Welwyn, Herts, UK 3 Institute of Food Research Norwich, Colney Lane, Norwich, UK 4 Biotech International, Technology Park, Bentley, Western Australia Correspondence to. R.P. Oliver

1989; J. R. Kinghorn and C. Scazzocchio, personal communications), a feature that doubtless aided their contribution to classical genetics. In contrast, many phytopathogenic fungi display phenotypic instability, which is characteristic of organisms harbouring transposons. For example, many pathogens spontaneously produce sterile, non-pathogenic mycelium when cultured in vitro, a situation that is often cured by passaging through the plant host to restore vigour. In the field, the rapid appearance of novel, virulent forms in response to resistant varieties of crops is all too frequent (see e.g. Dinoor et al. 1988 ; Lindhout et al. 1989). The molecular basis of these phenomena is unknown, in part because detailed genetic analysis of these species is in its infancy. Retrotransposons are an otherwise ubiquitous class of mobile genetic elements that require a reverse transcription step to undergo replicative transposition (Boeke and Corces 1989). The 'life-cycle' of a retrotransposon is similar to that of retroviruses; however, retrotransposons do not produce infectious virus particles, instead they produce non-infectious virus-like particles that are intermediates during transposition (Shiba and Saigo 1983; Garfinkel et al. 1985; Mellor et al. 1985; Goreleva et al. 1989). Numerous virus-like particles have been observed in preparations of filamentous fungi (Buck 1986; Bozarth 1972): functions have been ascribed to only a handful. The integrated copy of a retrotransposon undergoes transcription via host R N A polymerase II to produce a polyadenylated mRNA, which acts as both a template for translation and as a single-stranded genomic R N A in the mature virus-like particle (Fink et al. 1986). Translation of the retrotransposon m R N A produces the structural proteins of the gag (group-specific antigen) gene and several enzymatic activities (acid proteases, reverse transcriptase, RNase H, integrase) encoded by the pol (polymerase) gene. A third open reading frame (ORF) may encode a protein analogous to retroviral env (envelope) genes. LTR retrotransposons and retroviruses possess a similar genomic organisation and in certain cases share ex-

338 tensive D N A and amino acid sequence homology. LTR retrotransposons have been divided into two distinct groups on the basis of sequence comparisons (Xiong and Eickbush 1988; Doolittle et al. 1989). One such group is the gypsy group of retrotransposons. This class of retrotransposon exhibits the closer phylogenetic relationship to true retroviruses. The other group of LTR retrotransposons includes the eponymous copia from Drosophila melanogaster (Mount and Rubin 1985), Tyl from Saecharomyces cerevisiae (Clare and Farabaugh 1985) and Tntl from Nicotiana tabacum (Grandbastien et al. 1988). The gypsy group of LTR retrotransposons has a diverse membership, comprising retroelements from Lilium henryi [del (Sentry and Smyth 1989; Smyth et al. 1989), Dictyostelium discoideum [D1RS-1] (Cappello et al. 1985), S. cerevisiae [Ty3] (Clark et al. 1988; Hansen et al. 1988), Schizosaecharomyces pombe (Levin et al. 1990) [Tfl, Tf2], several Drosophila species [gypsy, 412, 297, 17.6, TOM] (Marlor et al. 1986; Yuki et al. 1986; Inouye et al. 1986; Saigo et al 1984; Tanda et al. 1988) and a moth [TED] (Friesen and Nissen 1990). The plant viruses CAMV [cauliflower mosaic virus] (Gardner et al. 1981) and CERV [carnation etched ring virus] (Hull et al. 1986) are also related to this group. To our knowledge, LTR retrotransposons have never been reported in filamentous fungi. In this paper we describe the isolation of an LTR retrotransposon from the genome of the filamentous phytopathogen Cladosporium fulvum, a biotrophic, nonobligate member of the Deuteromycetes (Fungi imperfecti), the causative agent of tomato leaf mould. The disease is a model system for the study of plant-pathogen interactions. The pathogen exists in a number of physiological races, which exhibit a gene-for-gene relationship with cultivars of tomato carrying different resistance genes (de Wit 1977). Five avirulence genes have been identified (Lindhout 1989) and Avr9 has been cloned (van Kan et al. 1991). We have previously described the isolation of a 225 bp sequence, designated P5, from the genome of C. fulvum (McHale et al. 1989). P5 encoded a putative protein with striking homology to reverse transcriptase sequences from various retroelements. P5 was shown to be a moderately repetitive sequence, which hybridised to about six bands in pulsed field gel separations of C. fulvum chromosomes (Talbot et al. 1991). In this paper we report the isolation and characterisation of cosmid clones containing D N A homologous to P5. We show that they contain full-length copies of a retrotransposon and suggest that these elements be designated

CfT-1 (C. fulvum transposon).

ed pAN7-2, a vector based on pAN7-1 (Punt et al. 1987). Colony and Southern hybridisations used Hybond-N membranes (Amersham) and standard procedures (Hodgson and Fisk 1987; Maniatis et al. 1982). Single- and double-stranded clones were sequenced using the Sequenase 2.0 kit (United States Biochemicals), the Pharmacia (Uppsala) T7 polymerase kit for manual electrophoresis or the Auto-read kit and an ALF-Pharmacia sequencing apparatus. Primers were synthesised on a Cyclone BioSearch synthesiser. Sequences were analysed using the DNASIS package (Pharmacia) and the N B R F and EMBL databases. Phylogenetic analysis used the PAUP 3.0 package (Swofford 1990). Alignments of amino acids were performed by eye. For isolation of virus-like particles (VLPs), 5 x 103 condiospores per 50 ml of Czapeck's Dox liquid medium (Oxoid) were incubated at 25 ° C with rapid shaking (200 rpm) for 10 days. Cells from 10~12 g wet weight of mycelium were broken down by freezing in liquid nitrogen and grinding in a pestle and mortar in 15 ml of extraction buffer (1 M MgSO4, 10 mM TRIS, pH 7.4, 10 mM CaCI2) with the aid of sand (E1-Sherbeini et al. 1984). The homogenate was incubated on ice for 20 rain and centrifuged at 9750 x g in a Sorvall SS34 rotor for 1 h. Three-millilitre aliquots of the supernatant were overlaid onto 1 ml of 45% w/v sucrose in PKE buffer (0.02 M NazHPO4, 0.15 M KC1, 0.01 M EDTA, pH 7.6). The samples were centrifuged in an SW41 Beckman rotor at 61000 x g overnight at 4 ° C. The supernatant was discarded and the pellet was resuspended in 1 ml of PKE and kept on ice. The samples were loaded onto a 10-80% w/v sucrose density gradient (made up in PKE buffer) and centrifuged in an SW41 rotor (130000 x g, 4 ° C, 4 h). One millilitre fractions were collected by pipetting gently from the top of the tube. The fractions, numbered 1 to 12, from the top to the bottom of the tube, were diluted 5 times in PKE and centrifuged at 150 000 x 9 at 4° C in a Beckman Ti65 rotor. The pellets were resuspended in a minimum volume of PKE and assayed for reverse transcriptase by the method of Garfinkel et al. (1985), with poly G as template and oligo dC as primer. Aliquots from each fraction of the sucrose density gradient were extracted with one volume of chloroform to remove lipid and allowed to settle for 5 min onto carbon-coated plastic film on nickel grids. Samples were fixed for 5 min with 2.5% glutaraldehyde in phosphate buffer, pH 7.4; 2% (w/v) uranyl acetate was used for negative staining for 2 rain. The samples were rinsed in phosphate buffer in between the steps. Grids were examined for VLPs in a JEOL 100C electron microscope.

Materials and methods

Results and discussion

C. fulvum races were maintained on V8 juice agar (Harling et al. 1988) plates at 25 ° C. Escherichia coli JM83, JM101, pUC19 and M13 mp 18 and 19 were used for subcloning and sequencing (Norrander et al. 1983). Fungal D N A was prepared according to Raeder and Broda (1985). The cosmid library was constructed by ligating D N A partially digested with Sau3A into BamHI-digest-

Isolation of full-length copies of CfT-1 A cosmid library was screened with the C. fulvum reverse transcriptase clone pNOMP5 (McHale et al. 1989). Nine hundred cosmid clones were screened, from which five positive clones were isolated. D N A from the clones was digested with BamHI or HindIII, and probed with

339

pNOMP5 DNA. BamHI digestion revealed that cosmids 691,712 and 786 each contained a 1.7 and 1.8 kb doublet of hybridising DNA. This doublet was reminiscent of BamHI-digested, C. fulvum genomic D N A probed with pNOMP5 (McHale et al. 1989). pNOMP5 hybridised to different BamHI bands in the remaining two cosmids, 3612 and 920 (data not shown). Southern hybridisation of HindIII-cut C. fulvum genomic D N A with pNOMP5 had revealed a multitude of high molecular weight bands, implying that intact copies of the P5 retrotransposon are not cut with this restriction enzyme (McHale et al. 1989). Similarly, pNOMP5 hybridised to high molecular weight bands in the HindIII-digested cosmid DNAs, indicating that they may contain full-length copies of the C. fuF rum retroelement. The cosmids which hybridised to pNOMP5 were subcloned by partially digesting with HindIII, religating and transforming into E. eoli. The smallest subclones that retained the 1.7 and 1.8 kb BarnHI doublet were selected for detailed analysis. Subclones pNOM712:3 (15 kb) and pNOM691:125 (20 kb), were mapped with EcoRI, BamHI and HindIII. Sequencing of CfT-1:712 The PstI, BamHI and EcoRI fragments of pNOM712:3 were subcloned into pUC18 (Norrander et al. 1983), thus generating a series of overlapping subclones that were representative of the whole of 712:3 (Fig. 1). The long terminal repeats were detected by probing digests of 712:3 with each of the subclones, searching for multiple hybridisations. This delimited the element to approximately 7.4 kb. (Fig. 1). Many of the subclones were transferred to M13 mpl8. Both strands of the element were sequenced by subcloning and using specific primers (Fig. 2). The Ion9 terminal repeats Examination of the LTRs revealed many features that are characteristic of retrotransposons (Fig. 3). The LTRs are 427 bp long and are identical. Sequencing the CfT-1:691 LTRs from the PstI sites outwards also gave the same identical sequences. Since LTR sequences are

lkb P

P BE X

I ILTRi

IIII

I

P3

I

B21

EBE

PXB

III

I11

P31

I

I

B13

E12

I

I

I I

P5

ORF1

B15

E21

P

X

I I ILTRI P13

I P6[

I ORF3

ORF2 Fig. 1. Restriction map, subclones and open reading frames (ORFs) of the CJT- 1.712 region. Abbreviations of restriction enzymes used are as follows-PstI, P; EcoRI, E; BamHI, B; J(hoI, X. Subclones are referred to in the text with prefix pNOM. LTR, long terminal repeat

homogenised during replication (Boeke and Corces 1989) and would be expected to diverge once integrated into the genome, the identity of the LTR sequences places a limit on the time at which the cloned elements transposed. The presence of highly homologous sequences as represented in the 691 and 712 subclones, at different genomic locations reinforces the view that this element has recently transposed. Examination of the sequences flanking the LTRs in 691 and 712 did not permit an unequivocal assignment of the length of the target site duplication because of degeneracy of the sequences. However, comparison of the 691 and 712 sequences indicated that 5 bp target-site sequences were duplicated during integration. The two duplicated sequences° TATAG(712) and GTACC(691), bear no obvious relationship to each other. The first sequence is reminiscent of the TATA and ATAT targetsites of the gypsy retrotransposons, 17.6 297 and Beagle (Bingham and Zachar 1989). The ends of the LTRs exhibit a 5 bp perfect inverted repeat structure. The LTRs terminate in the characteristic sequences 5'TG...CA3'. Transcription of retrotransposons starts and terminates within the LTR sequences. In some cases, sequences within the LTRs have been shown to have the properties of enhancers (Errede et al. 1985). It is interesting to note that sequences in the CfT-1 LTR show striking homology to the Tyl enhancer (Xu and Boeke 1990) and also to enhancers identified in SV40 (Weber et al. 1984), yeast P H 0 8 0 (Gilliquet et al. 1987) and N. crassa (Geever et al. 1983) (Fig. 3). Two sets of repeated sequences lie on either side of the SV40 enhancer-like region (Fig. 3). Immediately 3' to the 5' LTR is the presumed primer binding site for first-strand reverse transcription. There is no T G G sequence, implying that an internal tRNA fragment rather than an intact tRNA is used for priming. Internal tRNA fragments are used for priming copia retrotransposition (Kikuchi et al. 1986). The CfT-1 primer binding site is complementary to conserved regions of tRNAs. The sequence can be imperfectly aligned with an internal region of a S. pombe serine tRNA (Kohli et al. 1984). Second-strand priming involves annealing to a polypurine tract immediately 5' to the 3' LTR. In CfT-1, the sequence A G A G A G G G G A T G G is found at this position. Four PstI sites were found in CfT-1, one in each LTR and two in the internal, single copy region. Southern hybridisation of the subclone pNOMP5 to PstI-cut C. fulvum genomic D N A revealed just two very intense bands of 3.2 kb and 4.9 kb (Fig. 4). All other restriction enzymes, such as XhoI (lane 2), give a ladder of heterogeneous bands in addition to the strong band predicted by the presence of two internal XhoI sites (Fig. 1) in 712, when hybridised to fragments of CfT- 1. This implies that all pNOMP5-related sequences have conserved PstI sites in the LTRs. The internal PstI sites are symmetrically arranged so either one, but not both, is absent in about half the genomic copies of the retrotransposon. The presence of conserved LTR sequences amongst all the CfT-1 sequences is evidence of an unusual degree of

76 164 252 340 428 516 604 677 743 809 875 875 941 1073 1139 1205 1271 1337 1403 1469 1535 1601 1667 1733 1799 1865 1931 1997 2063 2129 2195 2261

2327

2394

2460

Fig. 2

T A A G A G A C G G T A A T A G A C T A T A ~ A A G G A G C T T A A G A T A T CGGTATACG CACT~C=ATAAACAATAG OOAG O O A T A T A C C CTTATATAq~2GTTAC C CGTAATAATATAATATA~[fG%~gACGGAT C G G A C A C G A C C G A A G G A G C G T CAG C C A A T C A A T A G C C CG C A C T A A T G A C A G G CG ~ C CACAG C T A G G CC~gGCACAG C CG CTG C A G A G T G C CTGGAC4I~ CCTC~AG~fG C CTGGAGTG C C T A ~ O O T A G G CACAGTAC4] CACC~ATAGGCACGGTAC4~ CA~AAAGGAATGGA;~I'I'I'C t i t ±~T~IT I'AGGAACG CATCGTAC CCITATC4~TT CGAGGCG%~f C A A O O C A C T G T T CAATAT CACTG'±'±'I~GAATACACCACAAC C C A A C C T C T G COO CACI]9 CTG C±'±GGTc ±'I'I'ACAAGAC G A G A C A G OTACTG CI~9CAT C A C T C T C C CT CAC CITCCAT C G G C C A C G A G A C A A A A C C C G A T I ~ A G ~ T tT±'t~fGATCI'fGTGATA T C A ~ A G G T T A T A C CAAAC O O A A C A G c ±TIGAACGC COO C A A C G A T G G G A G A T C G A C A G A G T G A C ~ A A C A C C CGC CC C C A G T G A M e t Leu Set M e t Pro T r p L e u Leu Ile G l n A l a T h r A S n AGCA~CAGAGCCCGACGACOOCAGACCGCGAACGATG C T A T C A A T G CCT T G G C T A CTC A T A CAG G C A A C G A A T Pro G l n G l y T r p Gln Pro G l u Phe Phe T!rr G l y A s p A r g Val Lys Phe A s p T h r T r p Val Set G l n COO C A A G G T T G G C A A C C A G A G %~fC qTgC T A T G G C G A C C G A G T C A A G qrfC GAC A C T T G G GTC T C T C A G M e t A s p . M e t T y r Phe L e u Phe A s n S e t M e t Thr G l u A s n Leu Lys Pro Ile Phe A l a A l a ~ h r Phe A T G GAT A T G T A C ~ C q*fG~CAAC T C C A T G A C T G A G A A C OOC A A G CCT A T C 'i'±'±'G C C A C C A C C T T C Leu A r g G l y A r g A l a G l n H i s T r p Val Lys Pro Phe L e u A r g Lys T!rr Leu A s p Set A s n G l y G l u ~ q ~ A G A G G A C G A G C A CAG CAT q ~ G G T C A A A C C A ~ T C CI~ A C ~ A A A T A C CTG G A T A G C A A C C ~ A G A A A s p A S n A l a A S p G l y Val Phe Lys S e r T!rr A S n H i s L e u Lys H i s A l a Met Lys Ser VAI Phe G l y CAT G C T A T G A A G A G C GTC '±'±','G G T GAC AAT GCTGAC GGAGTC %~TCAAG TCTTACAAC CAT O O C A A G Val S e r A s h G l u Ile A l a T h r A l a Val A r g Val Ile G l n His Leu T h r Gln Lys T h r S e t T h r A l a A C T CAG A A G A C T TCC A C A G C C G T C T C G A A C G A G A_q~ G C C A C T G C C C4I~ CC/f GTT A T T C A G CAC G l u T y r A l a A l a Lys Phe G l n Glu T y r A l a Gln L e u T h r A S p T r p A s p A s p G l u A l a Leu G l n Val G A A T A T G O O G C C A A G q T C CAG G A A T A C G C G C A A CTC A C C GAT TC4Z G A C GAC G A A G C A CTT C A A G T C Met q~rr A r g A r g G l y Leu Lys G l u H i s Val Lys A s p G l u Leu M e t A r g A S p G l y A r g Lys Ile A s p A T G A G G G A C G G T CGG A A G A T C G A T Aq~Z T A T C G A A G A G G A CI~ A A G G A G CAT G T C A A A G A C G A G G l y Leu G l y A S p Leu V a l G l n Val T h r Ile A S p Leu A s p A S p Lys L e u T!rr G l u A r g A l a M e t G l u G G C ~ T A G G C G A C O O A G T C C A A GTC A C G A T C G A T CI~ G A C G A C A A G CTC T A C G A G A G A G C T A T G G A A A r g A r g T y r A S p Set Lys Val S e r G l y Lys A l a G l y T!rr T h r Pro G l y Tyr A s p A s n A r g A s n A r g CGA CGA TAC GAC TCC AAG GTA TOO GGAAAG GCC G G A T A C A C G C C A G G C TAC G A C A A C CGT A A C A G A G l y Phe A s h a s p A S h q~yr A S n Lys P r o Lys A s p Lys Pro Tyr Tlrr G l y Pro G l n Pro Met G l u L e u G G T T T C A A C G A C A A C T A C A A C A A A CCC A A G G A C A A G CCG TAC T A C G G A C C A CAG C C A A T G G A G CTC A S p Val T h r G l u Lys G l y A r g Lys I l e A r g A s n S e r Lys G l y A s n A r g A r g Pro Pro Set Set A r g G A C G T T A C C G A G A A A G G T C G C A A G A T C A G G A A C A G C A A G G G G A A C A G A A G A CCC CCG A 6 ~ T C A A G A G l u T h r A r g T h r Cys T y r G l y Cys G l y Lys Pro G l y H i s Ile A l a A r g A s p Cys A r g G l y Lys A s n G A A A C A C G A A C T T G C T A T G G A T G C G G C A A A COO G G C CAC A T A G C A A G G GAC T G C CGC G G T A A G A A T Met Val A r g A r g Glu G l n Pha A S n M e t M e t Gln A r g A r g T h r S e t Lys Ser G l u S e t Set Val G l u A T G G T G CGC CGC G A A CAG ~ C A A C A T G A T G C A A C G A C G A A C T A G T A A A T O 0 G A G A G C A ~ T G%~f G A G Ser Leu G l y A s p Ile A S p T y r T h r A r g A r g Val G l u G l u A r g A l a Set A s n G l y Set T h r G I u Pro T O O CTG G G A G A C A T C G A C T A T A C T C G G A G A GTG G A G G A G A G A G C T A G C A A T G G A A G C A C G G A G COO L e u leu A S p p r o Ser G l n G l y A r g g l y G l y Cys His G l y G l n G l n M e t Val Val Ile Pro Phe G l u OOC CTG G A C CCC T C A C A A G G A O G A G G A G G A T G C CAT G G G C ~ C A A A T G G T G G T C A ~ 9 C C A T T C G A G L e u Gln A S n G l n Pro A r g G l n Phe A s n M e t Met A l a A r g A r g Val A s p Tyr G l u I l e G l u Set G I u C T G CAG A A C CAG C C A C G A CAG T T C A A C A T G A T G G C A C G A A G A G T C G A C TAC G A A A T C G A G T C C G A A S e t A r g A s n G l y His G l y S e r Leu His T r p A r g Phe Cys T!rr G l n A s p Set Cys G l n Val His T y r T C T C G A A A T G G T CAC G G A A G C CI~ CAT T G G C ~ A % ~ f C T G T T A C C A A G A C TCG T G T CAG G T ~ CAC T A C His A r g S e t A l a Lys S e t G l y A l a G l y T y r T r p Pro Gln G l n Pro A r g G l y T h r Leu G l y A l a ~ T C C G C G A A A T C A G G A G C A G G G T A T TC49 CCT CAG C A A C C G C G A G G A A C C CTG G G A G C A A C A CAT A G G G l n A S p A l a T h r Leu G l n G l u Val A S p Ile A s p G l u S e t Cys phe A s p A s p A s p G l y Set A s p Lys C A A G A C G C C A C G OOC C A A G A A G T G G A C A T C G A C G A A T C C q ~ C ~ C G A C GAC CAT G G A A G C G A C A A A G l u A S n G l n A S p Pro G l y T r p A S n G l y S e r T r p S e r Pro G l u Pro G l n Glu G l u Set G l u G l u T h r G A A A A T CAG G A C C C A G G A T G G A A C G G A T C G TC49 T C A CCG G A A C C A CAG G A A G A A AC]r C A A G A A A C C T h r G l y L e u A S p T h r Ile G l u G I u A s p G l n A s p Pro G l u G l u S e t Ser G l u G I u A S p Set S e r G l u A C C G G G CTG G A T A C C A T C G A G G A A G A C CAG G A T C C G G A A G A A T C A A G C G A A G A A G A T T C C T C C G A A G l y G l u G l u S e t A s p T h r A S p A S p A s p A S n Glu G l n M e t T h r Phe T h r Val A s p A l a Pro Lys Lys GGA GAAGAGAGC GAC A O O G A C GAC GACAAC GAACAAATG A C C ~ C A C C G T A G A C G C A CCG A A G A A G L e u T y r A S p Met Ile Ile H i s Leu G l n A r g A r g H i s G l u G l u Phe Leu Pro A r g Ile G l y G l y A r g q T C C T A CCG A G G A T A GGC G G A C G A CTC T A C G A C A T G A T A An CAC OOC C A A C G A A C ~ CAT G A A G A A A r g Met L e u His Ser Ile G l u Phe A s p Lys T h r Leu A s p T h r L e u A r g G l y M e t A l a T r p G l y T y r C G A A T G O O A CAC TCC A T T G A G '~±'±'G A C A A G A C A OOC G A C A C C C T A C G A G G C A T G G C C T G G G G A T A C P r o Leu Met G l u T h r qg~r G l u A S h L e u A l a T h r A l a Val T h r G l u A r g Pro Pro Ile G l y S e t A r g C C A CTC A T G G A A A C G A C C G A A A A C C T A G C A A C T G C T G T C A C A G A G C G A CCG CCG A T A G G A A G T A G M e t Ile G l y T h r G l y T y r L e u T h r Pro S e t G l y T h r Phe Val Ser A s n Glu L e u A r g A s n Met Val A S h A s p A r g T!rr A r g Ile Pro His T h r Val A r g A s n Ile A r g Ile Lys A r g Ile A l a G l n His G l y A A T G A T A G G T A C CGG A T A CCT CAC A C C G T C A G G A A C AZ~f CC]f A T C A A A C G A ~ G C G C A A CAT G G T G l n H i s A l a A r g A l a Leu T y r Set G l u T h r G l n . L y s Ile G l n G l u A r g His A r g Val G l n Met T r p A l a A l a A r g T h r A r g T h r L e u Leu A r g A s h A l a G l u A s p Pro G l y T h r Ser Ser S e t q ~ r A s p Val G C A G C A C G C A C G CGC A C T C T A CTC A G A A A C G C A G A A G A T C C A G G A A C G T C A T C G A G T A C A G A T G T G T h r G l n Lys G l y S e t A r g G l n Val G l n A l a G l u A l a S e t A r g His G l u A l a A r g A r g Set T h r T y r A s p T h r G l u A r g Leu A l a Pro G l y S e r Set G l y G l y L e u G l u T h r A r g Set T h r T h r Phe His Ile G A C A C A G A A A G G CTC G C G C C A G G T T C A A G C G G A G G C CTC G A G A C A C G A A G C A C G A C G q ~ C CAC A T A G l u G l n G l y Lys G l y Set T y r Pro Gln G l u Stop

13 35 57 79 i01 123 145 167 189 211 233 255 277 299 321 343 365 387 409 431 453 475 497 519 541 563 585 22 607 44 629 66 639

341

Arg 2526 C G A Ala 2592 G C T Ala 2658 G C C Ala 2724 G C T GIu 2790 G A G Thr 2856 A C 9 Asp 2922 G A C Trp 2988 T G G Arg 3054 A G G Gly 3120 G G A Tyr 3186 TH/T Trp 3252 T G G Glu 3318 G A G Ser 3384 T C C Gln 3450 C A A Ala 3516 G C A Ile 3582 A T C Leu 3648 qq~3 Arg 3714 A G A Leu 3780 CTC Ala 3846 G C A Gly 3912 G G G Asp 3978 G A T Ala 4044 GCA Ala 4110 G C G GIu 4176 G A A Gly 4242 G G G His 4308 CAT Pro 4374 CCG Arg 4440 CGA Thr 4506 A C A Gln 4572 C A A Ile 4638 Aq*9 Lys 4704 A A G Set

Thr ACA Gln CAA Met ATG Thr ACC Arg CGC Asp GAT Trp TGG Gln CAG Thr ACA Ser AGT Arg CGC ASp GAT Lys AAA Thr ACC Asp GAC Gln CAA Arg CGA Val GTC Asp GAC Gln CAG Pro CCC Ile ATA Val GTA Ala GCA Phe ~PC Val GTC Lys AAA Asp GAC Lys AAG Arg AGA Glu GAG His CAC Val @TA ASp GAT Lys

G l y Lys GGG A A A A l a Set GCA TCA Ile A s p ATA GAT Cys Lys TGT A A G Glu Thr GAG ACG Met A l a ATG GCC Arg Arg AGA AGA A r g Ser CC/f T C A Glu G l u GAA GAA Asp Gly GAT GGA Lys T r p ~ ~ His Lys CAC A A G Glu L e u GAG CTA Set Set TCA AGT Tyr A r g TAC CGA ASp Arg GAC A G A Met A l a ATG GCA Met Pro ATG CCA Leu Leu C T A CTC Glu His G A A CAT G l u Lys GAG A A A T h r Ile ACG ATC Gln S e t CAG T C A Pro Met CCA ATG Lys A r g AAA AGA His I l e CAC A T C Arg His A G A CAC Lys G l u AA~ GAG Leu T h r q~gA A C G Gln A l a CAA GCC Asn Gly AAC GGC Lys Ile AAA ATA A r g Ile CGA ATC Arg Glu CGA GAA T h r Val

Arg AGG Pro CCA Set TCC Lys AAG Ile ATA Ser AGT Gly GGA Leu CTG Pro CCA Ser AGT Set TOG Ile ATA Gln CAG Ala GCA Lys ILAG Leu qTDA Glu GAA Met ATG Asp GAC Thr ACC Cys TC-C Asp GAC Phe TTC Thr ACG Leu CTC Glu GAG Pro CCA Leu CTT Ile A~ Arg CGC Pro CCG Leu Cq~ Leu CTA Glu GAA Asp

Ile A s n ATC AAC Thr Thr ACG ACA Gly Ala GGA GCG Lye G l u AAA GAG Pro Leu CCG C ~ A His A S p CAT G A C Val L e u G T A C9C Ala Asp GCA GAT Pro S e t CCT T C G ASn Ala AAC GCA Arg Leu C G A CTC A S n Ile AAC A~ Thr L e u ACC CTA Gly Thr GGA ACT Leu A s n qrfG A A C Thr Gly ACC GGA Gly Glu GGA GAA G l y Leu GGA ~ Val Cys GTG TGC Lys G l n AAG CAA Glu Phe GAA TTC Pro A l a CCT G C A Leu G l y CI~ G G A Met Leu A % ~ CI~ Lys G l u AAG GAA Thr A S p ACC GAC Val A l a GTG GCC Leu A l a CTA GCC Leu S e t CIT T C A Trp S e r TGG T C G Ala Asp GCA GAT Lye T h r AAG ACA Set A s p AGC GAC Glu Cys GAA TGC Leu Ile

Ser Pro G l y Met Ser A s p A r g A r g TCC C C A G G A A T G A G C G A C C G A A G G Thr Val Phe A r g T h r Lys Ile Ile A C A G T G 'i'I'I'C ~ A A C C A A G A T r A T C Ser G l y A s h Phe A l a Set G l u S e t A G C G G G A A T '±'±'£G C C T C C G A A T C A G l y T y r G l u Leu Ile A l a Val A s p GGT TAT GAA ~ ATC GCG GTA GAC Pro L e u A l a Ile G l n A r g H i s His C C A CTT G C f A T C C A A CGG CAC CAC Ile Val Leu G l y M e t Pro T r p Leu A T C G T A C T A GGT A T G CCT T G G q ~ G Thr Phe A r g Glu Cys G l u Cys Val A C A 'i'±'±'A G G G A A T G C G A A TGC G T T G l u A l a A r g Lys G l n Leu A S n A r g GAG G C A A G G A A A CAG C~C A A C A G G Thr G l y T h r A s p T h r G l y Val G l y A C C G G G A C A GAC AC~P G G C GTG G G G Pro Ser Lys A s p T h r A s h Ile Ser C C A T O G A A G GAT A C C A A C A T C T C A Phe G l u G l u G l u A r g G l y Lys A s p TI'I' G A A G A G G A A A G A G G C A A G G A C Gln Pro G l y Lys G l u Pro Pro T r p CAG C C A G G G A A A G A G CCT C C A T G G A r g G l u T r p Leu Lys G l u Lys Leu O G A G A A T G G CI~ A A G G A G A A G C T A Pro Cys Met Phe Val Pro Lys A l a C C A T G C A T G TTC G ~ C C A A A A G C A Glu Ile T h r Ile Lys A s n A r g T y r GAG ATC ACG ATC AAG AAC CGA TAT Set A s p T i p Tyr T h r Lys Ile A s p T C A G A C T G G TAC A C G A A G ~ GAC Glu T i p L y s Thr A l a Phe A r g T h r G A A T G G A A A A C C G C T %~fC A G G A C A Thr A S n A l a Pro A l a Set Cys G l n A C C A A C G C A CCC G C A T C C T G C CAG Val Val A l a Tyr Met A s p A s p Ile (19C G T T G C T TAC A T G G A C G A C A T A Val G l n A s p Val Phe G l u A r g Leu G%~f C A A G A T G T G T T C G A A C G A CTC His Lys Lys Glu Val Lys Phe Leu CAC A A G A A A G A A G T C A A G '±'l'±'T T A Lys T h r G l n Ser Ile A r g Glu T r p A A G A C A CAG T C A A T C A G A G A A T G G Leu A l a A s n Tyr A s n A r g Lys Phe CTC G C C A A C TAC A A C CGG A A A %vfC T h r A r g Lys A s p Val A S n Trp Lys A C A A G A A A A GAC G T C A A C T G G A A A Gln Cys A l a Set A l a Pro Thr Leu CAG T G C G C T T C A G C C C C A A C G CTr A l a Ser A S p Met A l a Ile G l y A l a GCG T C T G A T A T G G C A A T A GGC G C A T!rr Tlrr Set A r g Lys Met T h r T h r T A T T A T T C C CGG A A A A T G A C C A C A Ile Val A l a A l a Met G l n His T i p A T T G ~ G C C G C C A T G C A A CAT T G G A s p His Lys A S h Leu T h r Tyr Phe GAC CAC A A G A A T CTC A C G T A C ~ C Glu Leu Leu G l y G l n T y r Lys Phe GAG CTG C~9 GGG CAG T A C A A G q'fC A l a L e u Set A r g A r g Set A s p T y r GCG CTG A G C CGA A G A A G C G A T T A C A s h Pro A s p G l y Set Leu Set A l a A A C CCC G A C G G A A G T CTT A G T G C C Lys G l u G l u Gln Phe Pro Ile Set A A G G A A G A A CAG q~gC CCT A T A T C ~ Ile A r g Gln His H i s A S p Glu Pro A T A C G A C A A CAT CAC G A C G A G C C A Gln A r g Set Phe Set Phe Pro G l n

G l u Leu Cys G A G ~TPA T G C Val A s h G l y GTC AAC GGG Phe Val T h r 'i'±'±'GTI' A C A G l y Ser S e r GGA TCA TCC G l u Glu Ile G A G GAG ~ A r g Lys His A G A A A G CAC Ile A s p Ile A T C GAC A n Ile Gin Leu A T A C/~ CTT Pro Pro G l y CCG CC~ G G T G I u Leu Set G A G ~I~ A G T A l a Leu Pro GCC ~A CCT G l y Pro Leu G G A CCC C T A A l a Lys G l y GCC AAA GGA A s n G l y Lys A A C GC~ A A A Pro Leu Pro CCG C T A CCC Leu Arg Asp CTA CGA GAC A r g qhyr G l y A G A TAC G G A A S p Leu Val G A C CTI ~ G T C L e u Val T y r CTG G T C T A C T h r Lys S e t ACG AAG TCC G l y Phe Ile G G C qq~f A T C Pro Glu Pro C C A G A A CCG Ile Lys A s p ATT AAG GAC T r p G l y Lys TGG GGA AAA A r g Leu Phe C G A C T A qTfC Cys Leu T h r TGT CTA ACA A l a Glu G l n G C G G A A CAG A r g Val T y r A G A GTG T A C T h r Thr T h r ACG AC~ ACG G l u Ile Lys GAA ATC AAA Met G l u G l y ATG GAA GGA Ash Thr Arg AAC AOG AGA G l n G l y Lys CAA GGA AAG T h r Tyr G l y A C A TAC G G A Met A r g Leu

Asn AAC His CAC Arg AGA Leu ~PA Thr ACC Asn AAC Gln CAG Ala GCG His CAC Ile Aq'P Lys AAG Tyr TAT Trp TGG Leu CTA Asn AAC Ala GCC Leu C9C Asn AAC Thr ACA Gly GGA Ile ATC Lys AAG Tyr TAT GIu GAA Asp GAT Gln CAG Asn AAC Val GTC Lys AAG Tyr TAC Lys AAA Glu GAG Tyr TAC His CAT Lys

Thr ACA Lys AAG Ash AAC Pro CCC Leu ~ Pro CCA Pro CCT Pro CCG Glu GAA Pro CCC His CAC Gln CAA Ile ATA Arg CGA Ile ATC Phe ~ Tyr TAC Glu GAA Lys AAA Phe TTC Set AGT Thr ACA Set TCA Gln CAG Gly GGT Thr ACA Tyr TAC Glu GAG Glu GAA Thr ACT Glu GAA Phe ~ Gln CAA Pro CCT Val

G l u Lys GAA AAG Thr Asp ACA GAT A r g Ile AGG ATC Set Val AGC GTG A s p Val GAT GTT Val Ile GTA ATC Ala Gln G C G CAG Thr Arg ACT AGA Val T h r GTC ACT Lys G l u AAG GAG G l n Pro CAA CCA M e t Ser ATG TCT Arg Arg CGA CGA Leu Val CTC G T A Glu Glu GAA GAA Tyr Ala TAT GCT G l u Phe GAA ~C Thr Leu A C A CI~ G l y Set GGA TCC Lys T h r AAG ACA Thr Thr ACA ACA Val Lys GTC AAG Lys T h r AAG ACA Thr Glu ACC GAA Set Lys AGC AAG His A S p CAC G A T A s p Ile GAC ATC G l y Pro GGC CCA Leu T h r c±'i~ A C C Pro G l y CCA GGA Pro Val CCA GTG Asn Asn AAC AAC Val Pro GTA CCA Gly Thr GGA ACT Leu A r g

88 ii0 132 154 176 198 220 242 264 286 308 330 352 374 396 418 440 462 484 506 528 550 572 594 616 638 660 682 704 726 748 770 792 814 836

342 4770 T C A q~rr 4836 T A C Gln 4902 C A G Arg 4968 A G G Lys 5034 A A A Asp 5100 G A C Set 5166 T C A Pro 5232 C C A Asn 5298 A A C Set 5364 T C A Leu 5430 CTG 5505 5582 5648 5714 5780 5846 5912 5978 6044 6126 6213 6300 6387 6474 6561 6648 6735 6822 6909 6996 7083 7170 7257 7344

AAG ACA GTC Ile Lys Lys ATC AAG AAA Phe Arg Thr ff~C A G G A C A Ser Lys A s p TCA AAG GAT ff~rr A l a H i s TAT GCA CAC A r g Leu Ile A G A ffff~ A T C ASn Tyr Trp AAC TAC TGG Glu Thr ASp GAG ACG GAT Tyr Ala Gln TAC GCA CAA Glu Thr Thr GAG ACA ACT A s p Pro T h r G A T CCC A C C

GAC Cys TGC Pro CCA Arg CGA Phe ~TC Arg CGA Lys AAG Gly GGG Asp GAC Set TCG His CAC

CfA Val GTA Pro CCA Val GTC Ile ATT Tyr TAT Thr ACG Gln CAA Asn AAC Thr ACG Arg AGG

ATA His CAC Thr ACG Thr ACA Pro CCT His CAC Leu CTC Thr ACG Trp TGG Thr ACG Pro CCG

CAG CGC A G C Cys G l n G l n ff~C C A A C A A Lys Pro T r p AAA CCA TGG Gly Gln Ala C43A C A A G C C A l a Ser G l u GCA TCA GAA G l y Phe Pro G G A ff~fC CCG Met G l y T h r ATG GGA ACG Glu Arg Thr GAA AGA ACG Val Set L e u Gffrf T C A q~fA Pro P h e Met C C A '±'±'±'A T G Arg Glu Gln AGA GAG CAA

TC Asn AAC Asp GAC Tyr TAT Ile ATA Glu GAA Ile ~ Asn AAC Leu CTG Arg CGA Ser TCG

T C A ffTC C C A C A G A G A CTT A A G G T ~ C T A C G C Lys A l a A l a A r g His A l a Lys T y r G l y H i s L e u 858 A A A G C T G C A CGG CAC G C G A A A T A C C4~T C A C C T A G l u Val T h r Met A S p Phe Ile T h r Lys Leu Pro 88O G A G GIfT A C G A T G G A C q~2C A T T A C G A A A C T C CC~ A S p M e t Ile Leu Val Met Val A S p A r g Leu T h r 9O2 G A C A T G A T A C T A G T C A T G G T C G A C A G A CTC A C A ff~agrT h r A l a G l u G l n Leu G l y T y r Leu Val Leu 924 T A C A C T G C A G A G CAG CI~ C ~ A T A C C T C G T A CTG Val Phe Ile T h r A s p A r g A S p Lys Leu Phe T h r 946 GTA ~C ~ A C A G A C A G A G A C A A G CTC %aTC A C A G l y Ile Lys H i s Lys Leu S e r T h r A l a T y r His 968 G G A A T C A A G C A C A A G TI~ T C A A C A G C A T A C CAT G l n T h r L e u G l u G l n Tyr Leu A r g His T!rr Ile 990 CAG A C A C T C G A G C A A T A C C T A C G G C A C T A C A T C Pro Met A l a G l n Ile A l a L e u A s n A s n H i s Lys i012 CCA ~ C-CG CAG A T C G C A CTG A A C A A C C A C A A A 1034 T h r L e u A l a A r g T h r Leu T h r T y r Pro G l u H i s A C T ffff~ G C ~ A G G A C C C A A C C T A T CCG G A A C A C Stop 1045 CACAAAGAAG C A C ~ C A TGA CGACGGAAACTCT CAAGG~ Met A l a Pro Leu L e u Lys G l u 7 AGGCGATCGAAGATGCACAAC_AAAGACTGTC CAACGACGGCAAGA~AAAA A T G G C A C C T C~G C T A A A A G A G G l y A s p Lys Val Tlrr Leu L e u T h r L y s A s n Leu Lys T h r A r g A r g G l n Thr Lys Lys Leu A s p H i s 29 GC49 G A T A A G G T C T A T CTC C T C A C A A A A A A C CTG A A G A C A A G A A G A CAG A C C A A G A A A CTG G A T C A C 51 Val Lys Val G l y Pro Phe Phe Ile A s p Lys Val Val G l y Pro Val A s n T y r A r g L e u A r g Leu Pro Gffrf A A G G T C G G A C C A 'I'I'I ~ 'i'I'I'2~_TC G A C A A A G T C G T A G G A C C A G T C A A C T A C C G A C T A C G A C T A C C A 73 P r o A s p A l a Lys Ile His Pro Val Phe His Ile S e r Lys Leu G l u Pro A l a A s p A l e G l u T h r Pro CCT G A T G C G A A A A T C CAC CCG G T C T T C C A T A T C T C C A A G T T G G A A C C A G C G G A C G C C G A A A C A CCT 95 Cys G l n G l u Set Phe His Phe Glu Pro G l u A l a G l u A s n G l u Phe G l u Val G l u L y s Ile Leu A s p CTA GAC T G C CAG G A G A G C ~ f C CAT T T C G A G CCG G A A G C A G A A A A C G A A '±'±'i'G A A G T C G A A A A A ~ 117 Lys Lys G l y G l n A r g %marr L e u Val L y s T r p Lys G l y q ~ r A s p G l u Set G l u A s n T h r T r p G l u Pro A A G A A G G G T CAG C G A T A C CffT G T C A A A T G G A A A G G A T A C G A C G A A T C A G A A A A T A C C ff~G G A A C C A 139 A r g Ile A s h L e u A l a A S h Cys T y r G l n L e u Leu A r g G l n Phe G l n Lys T r p A r g G l n A s p Set A r g AGA ~ A A T CTG G C G A A C T G C T A C CAG CIrf CI~ C G A CAG T T C CAG A A G T G G CGC C A A G A T T C C CGG 161 Lys G l n Glu A l a G l n Glu A r g A r g A l a Ser Pro A S p G l n T h r A r g Ser A r g P r o Lys T y r Pro H i s A A A C A A G A A G C T CAG G A A C G G A G A G C A A G T CCG G A T C A G A C C A G A A G T CGT CCG A A A T A C CCT C A C 165 A l a A r g T h r Lys S t o p G C A A G G A C C /LAG T A G G A G G G G A A A G A G A C A G C G A G C ~ A C ~ C C A C G T C I ~ C G T C C G G A A G C T C ~ C A G C C r f C C T C C A C T G C G A T C G C C T C G G T C T C T C G A C G C T C T A G A A G C T C C A G CTCCc±'I'I C49AGACGGGCCTTCITfCT CCCAAG CGG CGGCCTC TTCCTCCTGTAT CC9~ CGCACGAC~ CTTCCR~TATCcI'I'CGAAG C G A A G C C T C ~ T A T G C f f r f ~ C T C C ~ ~ T C G A C G A T G CT C CGACAC~-I "I"i',"I'CTCGAGAGCCrCG C G C I ~ A C G G C G CAGACR]CGACCA-q-~CCG C C T ~ A A C ~ A C A q r f A C A GT ~CGA~T I'i'Cc± T i~ZfACAGACACCACAC CGACCAGAC C CGACATGGACACGACAGACGACffrf CGT CT CG C C a A ~ A CAGGGACGAACCATGATI~ CGCCCAGGG CITCG~I'I'I'±'CTCGGATTGACGAATG~A~ ~ ~ ~ ~ ~ C ARX~ffff~AAGGAAAGAAGA~AG C C A T G A C G A C C G CT C A A C C C A A G G A A A C CT CGAffWA-DaTCATAAG CT CC T > G > A is generally seen in the consensus o f all filamentous fungal genes (Gurr et

Fig. 5. Alignments of ORF 1 and 2 sequences to retroelement protein sequences. Sequences were taken from Mount and Rubin 1985 (copia), Hansen et al. 1988 (TyJ); Ratner et al. 1985 (HIV-1); Friesen and Nissen 1990 (TED); Inouye et al. 1986 (17.6) and Marlor et al. 1986 (gypsy). The circumflex symbols indicate identical amino acids. Numbers refer to coordinates in the deduced amino acid sequences

Table 2. Third codon position bias in CJT-1 genes

CJT-10RF1 CJT-10RF2 CJT-10RF3 CJT-10FRs 1-3

Cladosporiumfulvum

A

C

G

T

No. codons

28 33 35 32 19

32 28 26 29 36

25 25 19 24 21

15 14 20 15 24

645 1045 165 1855 381

cDNAs The calculated percentages are shown of each base in the third position of codons for the three predicted CJT-10RFs, individually and together, and for the sum of the Avr9, P1 and P17 cDNAs (van Kan et al. 19991); P.J.G.M. de Wit, personal communication

al. 1987). This pattern contrasts markedly with the A > C > G > T pattern in the CfT- 1 open reading frames and suggests a recent extrachromosomal origin. Similar results were reported for the copia and 17.6 retrotransposons (Hansen et al. 1988). It is clear that a more widespread survey o f the presence o f retrotransposons and their codon usage is justified.

Race-specific polymorphisms Evidence was sought that CfT- 1 might be responsible for some of the variation in pathotype between the physiological races of the fungus. For this purpose, southern blots of genomic D N A of various isolates, digested with BamHI and EeoRI, were probed with pNOMP3, the PstI fragment comprising the 3' half of the 5 ' L T R and 2 kb of the 5' internal domain (Fig. 6). In each track, about 25 strong bands can be counted in addition to weaker bands corresponding to hybridisation to the 3' LTR. This finding, together with the frequency of positive cosmids, is consistent with a moderate copy number of about 25. Race 4 differs from race 0 in that the putative avir~ ulence 4 gene is not expressed in race 4. It is intriguing to note that the race 4 hybridisation pattern (lanes 3 and 7) exhibits single extra bands when compared to race 0 (lanes 4 and 8). Race 2,4,5,9,11 differs in that all of the

345 1

2

3

4

5

6

7

known avirulences are unexpressed and about 5 extra bands are seen when compared to race 0 (lanes 1 and 5).

23.1

Virus-like particles as replicative intermediates durin9 C. fulvum retrotransposition 9.4

6.6

4.4

Fig. 6. Hybridisation of pNOMP3 to EcoRI-(lanes 1-4) and BarnHI-(lanes 5 8) digested genomic DNA. DNA from race 0 (lanes 4 and 8) is compared with race 4 (lanes 3 and 7), race 5 (lanes 2 and 6) and race 2,4,5,9,11 (lanes 1 and 5). Numbers to the left are mol. wt. markers in kb; Arrows highlight the polymorphisms between race 0 and race 4 DNA

The retrotransposons Ty and copia encapsidate their genomic R N A and enzymatic pol functions into viruslike particles (VLPs) (Garfinkel et al. 1985; Mellor et al. 1985; Goreleva et al. 1989). In order to determine whether CfT-1 is also encapsidated, VLP preparations were made from lysates of C. fulvum mycelium. The VLPs were separated on a 10-80% sucrose gradient, fractionated and pelleted. Each of the fractions was examined for the presence of VLPs by electron microscopy. VLPs of between 40 and 50 nm in size and with electrondense cores were repeatedly found in fraction 5 of the gradient (Fig. 7). The particles are strikingly similar to Ty particles observed in galactose-induced strains of yeast, containing the Gal-Ty element (Garfinkel et al. 1985). It is worth noting that Ty particles cannot be reliably detected in uninduced cells. Each of the fractions of the sucrose gradient was assayed for reverse transcriptase (RT) activity by incorporation of [Gt-32p]dCTP into polynucleotide, using oligo dC as primer and poly G as template (Fig. 8a). A peak of activity was found in fraction 5; coincidence of VLPs and RT activity was found in three separate experiments. The RT activity in the peak fraction was found to be dependent on Mg 2+, primer, and template, and was not supported by Mn 2+ ions (Table 3). Reverse transcriptase activity has not been demonstrated previously in filamentous fungi. The VLP fractions from the sucrose gradient were phenol-extracted and dot-blotted onto nitrocellulose. The reverse transcriptase-encoding clone pNOMP5 hybridised primarily to the nucleic acid in fraction 5, containing the VLP peak (Fig. 8b). This fur16 /.a.

•

10 rn 0 x

8

¢J

6

• .\/'J

20 0

I--I

0

T I /i~q

• ~ ,•~

1

3

4

9

2

a

b Fig. 7. Transmission electron micrograph of virus-like particles (VLPs) in fraction 5 of the 10-80% sucrose gradient fractionation of a C. fulvum VLP preparation

/

•

5 6 7 8 VLP f r e c t i o n s

oO0

•

10

•

11

•

12

•

Fig. 8. a Reverse transcriptase activity in sucrose gradient fractions of C. fulvum VLP. b Dot-blot hybridisation of pNOMP5 to sucrose gradient fractions

346 3 . Reverse transcriptase activity (cpm) of fraction 5 from C. fulvum VLP sucrose gradient centrifugation

Table

Complete Mg z + Mg 2+ + Mn 2+ - oligo dC -poly G - enzyme

-

3804 469 187 340 219 350

VLP, Virus-like particle The assays were performed as decribed in the Materials and methods

ther s u p p o r t s the view that C J T - l - r e l a t e d elements are transcribed into R N A , which is p a c k a g e d in V L P s t h a t contain reverse transcriptase.

Conclusion

The results presented in this p a p e r indicate that C.fulvum contains a m o d e r a t e n u m b e r o f g e n o m i c elements with m a n y o f the conserved features o f r e t r o t r a n s p o s o n s . These elements, which are represented by the cloned a n d sequenced 712 clone, have been designated CJT-1 elements. The element a p p e a r s to be expressed and packaged into V L P particles, b u t there is no direct evidence that the elements are still capable o f further transposition. H o w e v e r , the u n i n t e r r u p t e d o p e n reading frames a n d identical L T R s suggest that the cloned c o p y has t r a n s p o s e d recently. This is the first report o f an L T R r e t r o t r a n s p o s o n in a filamentous fungus. The origin o f the element is an intriguing question. Its similarity to elements in diverse organisms and the biased c o d o n usage are suggestive o f h o r i z o n t a l transfer. T h e role o f the element in p r o m o t i n g variation in p a t h o g e n populations, by contributing to the b o o m - a n d - b u s t cycle w h e r e b y p a t h o g e n s rapidly o v e r c o m e the resistance in new varieties o f crop plant is u n k n o w n b u t is u n d e r active study. The study o f genetically uncharacterised filamentous fungi is currently severely h a m p e r e d by a lack o f versatile genetic tools. The ability to use t r a n s p o s o n s to tag genes o f interest w o u l d be a significant advance.

Acknowledgements. We are grateful to A. Coddington for constructing the cosmid library, L. Flegg for technical assistance, Mark Coleman for helpful discussions and M. Oliver for help with the figures. This work was supported by grants to R.P.O. from the AFRC and the Gatsby Charitable foundation and from NERC for the sequencer and a studentship to M.T.M. from SERC. References

Bingham PM, Zachar Z (1989) Retrotransposons and the FB transposon from Drosophila melanogaster. In: Berg DE, Howe MM (eds) Mobile DNA. American Society for Microbiology, Washington DC, pp 485-502 Boeke JD, Corces VG (1989) Transcription and reverse transcription of retrotransposons. Annu Rev Microbiol 43 : 403-434 Boeke JD (1989) Transposable elements in Saccharornyces cerevisiae. In: Berg DE, Howe MM (eds) Mobile DNA. American Society for Microbiology, Washington DC, pp 403-434

Bozarth RF (1972) A new dimension in microbiology. In: Environmental health perspectives. United States Department of Health Education and Welfare, Washington, pp 23-39 Buck KW (1986) Fungal virology - an overview. In: Buck FW (ed) Fungal virology. CRC Press, Boca Raton, Florida, pp 1-84 Cappello J, Handelsman K, Lodish HF (1985) Sequence of Dictyostelium DIRS-I: An apparent retrotransposon with inverted terminal repeats and internal circle junction. Cell 43:105-115 Clare J, Frabaugh P (1985) Nucleotide sequence of a yeast Ty element: evidence for an unusual mechanism ofgene expression. Proc Natl Acad Sci USA 82:2829-2833 Clark D J, Bilanchone VW, Haywood LJ, Dildine SL, Sandmeyer SB (1988) A yeast sigma composite element Ty3 has properties of a retrotransposon. J Biol Chem 263:1413-1423 Covey SN (1986) Amino acid sequence homology in 9ag region of reverse transcribing elements and the coat protein of canliflower mosaic virus. Nucleic Acids Res 14: 623-633 de Wit PJGM (1977) A light and scanning-electron microscope study of infection of tomato plants by virulent and avirulent races of Cladosporiumfulvum. Neth J Plant Pathol 83:109-122 Dinoor A, Eshed N, Nof E (1988) Puccinia coronata crown rust of oats and grasses. In: Sidhu GS (ed) Advances in plant pathology, vol 6. Academic press, New York, pp 333-344 Doolittle RF, Feng DF, Johnson MS, McClure MA (1989) Origins and the evolutionary relationships of retroviruses. Q Rev Biol 64:1-30 Dunsmuir P, Brorein WJ, Simon MA, Rubin GM (1980) Insertion of the Drosophila transposable element copia generates a 5 base pair duplication. Cell 21:575-579 E1-Sherbeini M, Tipper D J, Mitchell D J, Bostian KA (1984) Viruslike particle capsid proteins encoded by different L doublestranded RNAs of Saccharornyces cerevisial: their roles in maintenance of M double-stranded killer plasmids. Mol Cell Biol 4:2818-2827 Errede B, Company M, Ferchak JD, Hutchinson CA III (1985) Activation regions in a yeast transposon have homology to mating type control sequences and to mammalian enhancers. Proc Natl Acad Sci USA 82:5423-5427 Fink GR, Boeke JD, Garfinkel DJ (1986) The mechanism and consequences of retrotransposition. Trends Genet 2:118-123 Friesen PD, Nissen MS (1990) Gene organisation and transcription of TED, a lepidopteran retrotransposon integrated within the baculovirus genome. Mol Cell Biol 10:3067-3077 Gardner RC, Howarth AJ, Hahn P, Brown-Leudi M, Shepherd RJ, Messing J (1981) The complete nucleotide sequence of an infectious clone of cauliflower mosaic virus by M13mp7 shotgun sequencing. Nucleic Acids Res. 9:2871-2887 Garfinkel D J, Boeke JD, Fink GR (1985) Ty element transposition: reverse transcriptase and virus-like particles. Cell 42:507-517 Geever RF, Case ME, Tyler BM, Buxton F, Giles NH (1983) Point mutations and DNA rearrangements 5' to the inducible oa-2 gene of Neurospora allow activator protein-independent transcription. Proc Natl Acad Sci USA 80:7298-7302 Gilliquet V, Legrain M, Hilger F (1987) Sequence of the region 5' to the negative regulatory gene PH080 of Saccharomyces cerevisiae. Nucleic Acids Res 15 : 5893 Goreleva TV, Resnik NL, Schuppe NG (1989) Retrotransposon transposition intermediates are encapsidated into virus-like particles. FEBS Lett 244:307-310 Grandbastien MA, Spielman A, Caboche M (1988) Tnt-l, a mobile retroviral-like element of tobacco isolated by plant cell genetics. Nature 337:376-380 Gurr SJ, Unkles SE, Kinghorn JR (1987) The structure and organisation of nuclear genes of filamentous fungi. In: Kinghorn JR (ed) Gene structure in eukaryotic microbes. IRL Press, Washington, pp 117-127 Hansen LJ, Chalker DL, Sandmeyer SB (1988) Ty3, a yeast retrotransposon associated with tRNA genes has homology to animal retroviruses. Mol Cell Biol 8:5245-5256 Harling R, Kenyon L, Lewis BG, Oliver RP, Turner JG, Coddington A (1988) Conditions for efficient isolation and regenera-

347 tion of protoplasts from Fulvia fulva. J Phytopathol 122:143-146 Hodgson CP, Fisk RZ (1987) Hybridization probe size control: optimised "oligolabelling". Nucleic Acid Res 5:6295-6296 Hull R, Sadler J, Longstaff M (1986) The sequence of the Carnation Etched Ring Virus DNA: comparison with cauliltower mosaic virus and retroviruses. EMBO J 5:3083-3090 Inouye S, Yuki S, Saigo K (1986) Complete nucleotide sequence and genome organisation of a Drosophila transposable element 297. Eur J Biochem 154:417-425 Kikuchi Y, Ando Y, Shiba T (1986) Unusual priming mechanism of RNA-directed DNA synthesis in copia retrovirus-like particles of Drosophila. Nature 323: 824-826 Kingsman AJ, Kingsman SM (1988) Ty: a retroelement moving forward Cell 53 : 333-334 Kinsey JA, Helber J (1989) Isolation of a transposable element from Neurospora crassa. Proc Natl Acad Sci USA 86:1929-1933 Kohli J, Munz P, Aebi R, Amstutzt H, Gysler C, Heyer WD, Lehmann L, Schuchert P, Thuriaux P, Leupold U, Bell J, Gamulin V, Hottinger H, Pearson D, Soell D (1984) InteralMic and intergeneic conversion in three serine tRNA genes of Sehizosaccharomyces pomnbe. Cold Spring Harbor Symp Quant Biol 49:31-40 Levin HL, Weaver DC, Boeke JD (1990) Two related families of retrotransposans from Sehizosaceharomyees pombe. Mol Cell Biol 10:6791-6798 Lindhout P, Korta W, Cislik M, Vos I, Gerlagh T (1989) Further identification of races of CIadosporiumfulvum (Fulviafulva) on tomato originating from the Netherlands, France and Poland. Neth J Plant Pathol 95:43-148 Maniatis T, Fritsch EF, Sambrook J (1982) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York Marlor R, Parkhurst S, Corces V (1986) The Drosophila melanogaster gypsy transposable element encodes putative gene products homologous to retroviral proteins. Mol Cell Biol 6:1129-1134 McHale MT, Roberts IN, Talbot NJ, Oliver RP (1989) Expression of reverse transcriptase genes in Fulviafulva. Mol Plant-Microbe Interact 4:165-168 Mellor J, Malim MH, Gull K, Tuite MF, McCready S, Dibbayawan T, Kingsman SM, Kingsman AJ (1985) Reverse transcriptase activity and Ty RNA are associated with virus-like particles in yeast. Nature 318:583-586 Michel F, Lang BF (1985) Mitochondrial class II introns encode proteins related to the reverse transcriptases of retroviruses. Nature 316:641-642 Mount SM, Rubin GM (1985) Complete nucleotide sequence of the Drosophila transposable element copia: homology between copia and retroviral proteins. Mol Cell Biol 5:1630-1638 Norrander J, Kemp T, Messing J (1983) Construction of improved M13 vectors using oligodeoxynucleotide-directedmutagenesis. Gene 26:101-106 Poch O, Sauvaget I, Delarue M, Tordo N (1989) Identification of four conserved motifs among the RNA-dependent polymerase encoding elements. EMBO J 8:3867-3874 Punt P J, Oliver RP, Dingemanse MA, Pouwels PH, van den Hondel CAMJJ (1987) Transformation of Aspergillus based on the

hygromycin B resistance marker from Escherich& coli. Gene 56:117-124 Raeder U, Broda P (1985) Rapid preparation of DNA from filamentous fungi. Lett Appl Microbiol 1 : 17-20 Ratner L, Haseltine W, Patarca R, Livak K J, Starciach B, Josephs SF, Doran ER, Rafalski JA, Whitehorn EA, Baumeister K, Ivanoff L, Petteway SR, Pearson ML, Lautenberger JA, Papas TS, Ghrayeb J, Chang NT, Gallo RC, Wong-Stahl F (1985) Complete nucleotide sequence of the AIDS virus, HTLV-III. Nature 313:277-283 Saigo K, Kugimiya W, Matsuo Y, Inouye S, Yoshioka K, Yuki S (1984) The identification of the coding sequence for a reverse transcriptase-like enzyme in a transposable genetic element in Drosophila melanogaster. Nature 312: 659-661 Sentry JW, Smyth DR (1989) An element with LTRs and its variant arrangements in the genome of Lilium henryi. Mol Gen Genet 215: 349-354 Shiba T, Saigo K (1983) Retreovirus-like particles containing RNA homologous to the transposable element copia in Drosophila melanogaster. Nature 302:119-123 Smyth DR, Kalitsis P, Joseph JL, Sentry JW (1989) A plant retrotransposon from Lilium henryi is related to Ty3 of yeast and the gypsy group of Drosophila. Proc Natl Acad Sci USA 86:5015-5019 Swofford DL (1990) PAUP: Phylogenetic analysis using parsimory. Version 3.0. Computer program distributed by the Illinois Natural History Survey, Champaign, Illinois Talbot NJ, Coddington A, Oliver RP (1991) Pulsed field gel electrophoresis reveals chromosome length polymorphisms between strains of Cladosporium fulvurn (syn. Fulvia fulva). Mol Gen Genet 229 : 267-272 Tanda S, Shrimpton AE, Ling-Ling C, Itayama H, Matsubayashi K, Saigo K, Tobari YN, Langley CH (1988) Retrovirus-like features and site specific insertions of a transposable element tom in Drosophila ananassae. Mol Gen Genet 214:405-411 van Kan JAL, Van den Ackerveken GFJM, De Wit PJGM (1991) Cloning and characterisation of a cDNA of avirulence gene avr9 of the fungal pathogen C. fulvumn; causal agent of tomato leaf mold. Mol Plant Microbe Interact 4: 52-60 Voytas DF, Ausubel FM (1988) A copia-like transposable element family in Arabidopsis thaliana. Nature 336:242-244 Weber F, De Villiers J, Schaffner W (1984) An SV40 "enhancer trap" incorporates exogenous enhancers or generates enhancers from its own sequences. Cell 36:983-992 Xiong Y, Eickbush HT (1988) Similarity of reverse transcriptaselike sequences of viruses, transposable elements and mitochondrial introns. Mol Biol Evol 6:675-690 Xu H, Boeke JD (1990) Localisation of sequences required in cis for yeast Tyl element transposition near the long teminal repeats - analysis of mini-Tyl elements. Mol Cell Biol 10:2695-2702 Yuki S, Inouye Y, Ishimaru S, Saigo K (1986) Nucleotide sequence characterisation of a Drosophila retrotransposon 412. Eur J Biochem 158:403M10

C o m m u n i c a t e d b y D.J. F i n n e g a n