Ventral midbrain glia express region-specific transcription factors and regulate dopaminergic neurogenesis through Wnt-5a secretion

www.elsevier.com/locate/ymcne Mol. Cell. Neurosci. 31 (2006) 251 – 262

Ventral midbrain glia express region-specific transcription factors and regulate dopaminergic neurogenesis through Wnt-5a secretion Gonc¸alo Castelo-Branco, Kyle M. Sousa, Vitezslav Bryja, Luisa Pinto,1 Joseph Wagner,2 and Ernest Arenas* Laboratory of Molecular Neurobiology, Department of Medical Biochemistry and Biophysics, Karolinska Institute, Scheeles vag 1, A1, plan 2, 17177 Stockholm, Sweden Received 17 June 2005; revised 8 September 2005; accepted 16 September 2005 Available online 21 October 2005

Glial cells have been classically described as supporting cells for neurons. Recently, additional roles during neural development have begun to emerge. Here, we report that ventral midbrain glia, including astrocytes and radial glia, are the source of signals required by neural precursors to acquire a dopaminergic phenotype. We found that ventral midbrain glia, but not cortical glia, secrete high levels of the glycolipoprotein Wnt-5a, express region-specific transcription factors such as Pax-2, En-1 and Otx-2 and increase the differentiation of cortical or ventral midbrain Nurr1 precursors into tyrosine hydroxylase-positive neurons. Moreover, blocking experiments using a Wnt-5a blocking antibody indicated that the effects of ventral midbrain glia on Nurr1-positive neural precursors are partially mediated by Wnt-5a. Thus, our results identify Wnt-5a as an important component of the dopaminergic inductive activity of the ventral midbrain glia. D 2005 Elsevier Inc. All rights reserved.

Introduction Glia constitute around 90% of the cells in the adult human brain (Rowitch, 2004) and are essential regulators of neuronal function. Astrocytes are one of the major glial subtypes and have been described to provide trophic, metabolic and structural support to neurons and to intervene in the synaptic transmission (Doetsch, 2003; Rowitch, 2004). Astrocytes can also function as adult neural stem cells (NSC) (Doetsch, 2003; Doetsch et al., 1999; Laywell et al., 2000; Sanai et al., 2004) and play important roles during neuronal development. Type 1 (T1) astrocytes from the ventral * Corresponding author. Fax: +46 8 341960. E-mail address: [email protected] (E. Arenas). 1 Present address: GSF—National Research Centre for Environment and Health, ISF—Institute of Stem Cell Research, Ingolsta¨dter Landstr. 1, D85764 Neuherberg, Munich, Germany. 2 Present address: Neuronyx Inc., 1 Great Valley Parkway, Malvern, PA 19355, USA. Available online on ScienceDirect (www.sciencedirect.com). 1044-7431/$ - see front matter D 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.mcn.2005.09.014

midbrain (VM) provide trophic support to differentiating dopaminergic (DA) neurons, primarily through mechanisms involving survival (Engele, 1998; Engele and Bohn, 1991; Engele et al., 1996; O’Malley et al., 1992; O’Malley et al., 1994; Petrova et al., 2003; Schaar et al., 1994; Takeshima et al., 1994) or proliferation (Casper et al., 1994). Factors expressed by VM glia, such as glial cell line derived neurotrophic factor (GDNF) (Lin et al., 1993, 1994) and fibroblast growth factor 2 (FGF-2) (Casper et al., 1994), among others (Engele, 1998; Hyman et al., 1991; Petrova et al., 2003), have been identified as dopaminotrophic. Previously, we reported that mouse NSCs overexpressing the nuclear receptor-related factor 1 (Nurr1) can be differentiated into DA neurons when cocultured with T1 astrocytes from rat embryonic day 15 (E15) to postnatal day 1 (P1) VM (Wagner et al., 1999). These results have led us to suggest that astrocytes could be the source of not only survival and mitogenic factors, but also signals involved in the acquisition of a neuronal DA phenotype (Hall et al., 2003). These factor(s) are likely to be specifically expressed in the VM neurogenic niche as astrocytes from structures other than the VM could not induce a DA phenotype in NSCs (Wagner et al., 1999). We have described the VM T1 astrocytederived inductive factor(s) as poorly soluble and labile (Wagner et al., 1999), and its/their identification has since remained elusive. The Wnt family of secreted proteins shares some of the properties of this/these factor(s) as they are mainly short range signaling molecules and poorly soluble in water (Willert et al., 2003). Wnts are also involved in cellular proliferation and differentiation during development (Ciani and Salinas, 2005; Ille and Sommer, 2005; Kleber and Sommer, 2004; Patapoutian and Reichardt, 2000). In addition, we have previously shown that Wnts are key regulators of DA neurogenesis in the VM (Castelo-Branco et al., 2003). In particular, Wnt-1 mainly leads to the proliferation of rat VM E14.5 precursors, while Wnt-5a is involved in the acquisition of a DA phenotype from the Nurr1 precursor pool. In this study, we examined whether Wnts are produced by glia and whether they mediate the inductive effects of VM T1 astrocytes. We found that P1 VM glia regulated the neurogenic

252

G. Castelo-Branco et al. / Mol. Cell. Neurosci. 31 (2006) 251 – 262

step involving the differentiation of Nurr1-expressing VM precursors into DA neurons. This effect was specific for VM glia and could not be replicated with glia from the cerebral cortex (Cx). Interestingly, the gene expression in the VM and Cx glia from E13.5 and P1 was very different. VM glia expressed regionspecific transcription factors such as paired box containing transcription factor (Pax)-2, engrailed 1 (En-1) and the orthodenticle transcription factor Otx-2. VM glia also expressed higher levels of Wnt-5a when compared to cortical glia, which in turn expressed Emx-2 and Pax-6 at higher levels. Moreover, we observed that our VM glia preparations contained not only T1 astrocytes but also radial glia, which appear prior to neurons and astrocytes during development (Doetsch, 2003). Both P1 VM glia and Wnt-5a, but not Cx glia, were able to induce a TH-positive phenotype in Nurr1-positive cortical precursors. Furthermore, the induction of DA differentiation in VM precursors by VM glia could be blocked by an anti-Wnt-5a antibody. In summary, our results indicate that VM glia induce a DA phenotype in Nurr1expressing neuronal precursors and that this effect is specific and involves the secretion of Wnt-5a.

Results P1 VM glia increase the number of DA neurons in VM precursors cultures by multiple mechanisms In order to study the properties of the factors released by VM glia, conditioned media from P1 VM T1 astrocytes (VM M) were collected and added to rat neuronal precursor cultures isolated from E14.5, a stage at which dopaminergic neurogenesis is still taking place in vivo (Perrone-Capano et al., 2000). Immunostaining for tyrosine hydroxylase (TH) revealed a significant increase in the number of DA neurons after 3 days in vitro following treatment with VM M, when compared to control (Figs. 1A and B). An increase in TH mRNA levels was also detected by real-time PCR (data not shown). The increase in the number of TH-positive cells induced by VM M was greater than the effects produced by known survival and proliferation molecules, such as GDNF, FGF-2 or FGF-8b (Fig. 1A). Conditioned media from T1 astrocytes derived from P1 cortex (Cx M), a target area for VM DA neurons (Specht et al., 1981;

Fig. 1. P1 VM glia increase the number of DA neurons derived from E14.5 VM precursors through diverse mechanisms (such as proliferation). (A, B) Addition of conditioned media from P1 VM glia (VM M) to VM E14.5 precursor cultures increased the number of TH-immunoreactive cells after 3 days in vitro, while P1 cortex glia-conditioned media (Cx M) or other dopaminotrophic factors like GDNF, FGF-2 and FGF-8b (all at 10 ng/ml) had less significant effects. Cells were counterstained with Hoechst 33258 in panel B. (C) Addition of VM M to E14.5 VM precursor cultures increased the percentage of Nurr1 precursors that incorporated S-phase marker BrdU, after 1 day in vitro. (D) Double immunostaining with antibodies against BrdU and Nurr1 showed higher co-localization in precursors treated with VM M, compared to N2 control. (E) Addition of VM M to E14.5 VM precursor cultures increased the number of Nurr1immunoreactive cells, after 1 day in vitro. Statistical analysis was performed using one-way ANOVA with Fisher’s post hoc test. Scale bar, 50 Am.

G. Castelo-Branco et al. / Mol. Cell. Neurosci. 31 (2006) 251 – 262

Voorn et al., 1988), also increased the numbers of THimmunoreactive cells in our cultures, although to a lesser extent than VM M (Fig. 1A). These data are consistent with previous reports showing that T1 astrocytes from the cortex increases the survival of E14/E15 DA neurons (Engele, 1998; Takeshima et al., 1994). We also investigated whether proliferation could account for the effects induced by VM glia. We found that addition of VM M to E14.5 precursor cultures increased both the proportion of Nurr1-positive precursor cells incorporating the S-phase marker BrdU after 1 day in vitro (Figs. 1C and D) and the number of Nurr1-positive cells (Fig. 1E). Thus, one of the effects of VM M was to expand the DA precursor pool. P1 VM glia promote the differentiation of VM precursors into DA neurons We have previously reported that glial cultures isolated from P1 VM can induce a DA phenotype in Nurr1-overexpressing NSCs (Wagner et al., 1999). Instead, Cx P1 glia induced the differentiation of Nurr1 NSCs into neurons with cortical morphologies, but not into DA neurons (Wagner et al., 1999). These results suggested that region-specific differentiation factors might also be expressed specifically in the VM or cortical glia. We now found that VM M up-regulated the cyclin-dependent kinase inhibitor p21 mRNA (Fig. 2A), but not p27 and p57 (data not shown), in the precursor cultures. Since p21 promotes cell cycle arrest and differentiation in progenitors (van de Wetering et al., 2002), this result suggested that signals from the VM glia were also promoting cell cycle exit and differentiation. In agreement with this result,

253

VM M increased the total number of neurons (h-tubulin-III (TUJ)positive) in the cultures (Figs. 2B and C) and, importantly, increased the proportion of DA cells out of the total neuronal population (%TH+ cells out of total TUJ-positive cells, Fig. 2D). These results demonstrate a specific role of VM glia in DA differentiation. Given that we previously reported that VM glia is the source of a DA inductive signal (Wagner et al., 1999), we next examined whether treatment of VM neuronal precursors (Nurr1positive/TH-negative cells) with VM M influenced their conversion into DA neurons (Nurr1-positive/TH-positive cells). While 44.8% (T2.4%—SEM) of all Nurr1-positive cells expressed TH in control conditions, VM M increased the proportion of TH-positive/ Nurr1-positive cells up to 91% (T1.5%) (Figs. 2E and F). Thus, our results indicate that conditioned media from VM glia increase the number of TH+ DA neurons in VM precursor cultures not only through survival or proliferation, but also via the differentiation of Nurr1-positive precursors. E13.5 VM glia preparations express high levels of Wnt-5a mRNA We have previously described that Wnt-1 and Wnt-5a increase the number of DA neurons being generated from E14.5 VM precursors. In particular, the effects of Wnt-5a on the proliferation and differentiation of DA precursors (Castelo-Branco et al., 2003) were similar to the ones we hereby describe for VM M. These results suggested that Wnt-5a could be responsible for some of the effects of the VM glia, so we investigated whether VM glia could be the source of Wnts in the developing VM. Since the birth of DA neurons in the rat VM peaks at E13.5 (Castelo-Branco et al., 2003),

Fig. 2. P1 VM glia-conditioned media enhance DA differentiation of E14.5 VM precursors. (A) p21 mRNA was up-regulated upon E14.5 VM precursors exposure to conditioned media from P1 VM glia (VM M) for 3 days, as assessed by real-time RT-PCR. (B, C) Addition of VM M to E14.5 VM precursors cultures increased the number of h-tubulin-III (TUJ)-immunoreactive cells, after 3 days in vitro. Cells were counterstained with Hoechst 33258 in panel C. (D) The percentage of neurons (TUJ+) that were dopaminergic (TH+/TUJ+) and (E, F) the percentage of Nurr1+ precursors that differentiated into dopaminergic neurons (TH+/Nurr1+) increased upon treatment with VM M, after 3 and 1 days in vitro, respectively. Statistical analysis was performed using one-way ANOVA with Fisher’s post hoc test and unpaired t test (A). Arbitrary units—a.u.; scale bar, 50 Am.

254

G. Castelo-Branco et al. / Mol. Cell. Neurosci. 31 (2006) 251 – 262

we assessed which cell populations express Wnts at this stage in the VM neurogenic niche by isolating and characterizing rat VM E13.5 neuronal precursor (NP) and glia-enriched (G) cultures (O’Malley et al., 1992; Wagner et al., 1999). Neuronal precursor preparations expressed high levels of the precursor marker nestin (Fig. 3A) and neuronal markers such as TUJ (Figs. 3B and E) and microtubule-associated protein 2 (MAP2) (data not shown), indicating that we had isolated a neuronal precursor population which was undergoing differentiation in culture. The astrocytic marker GFAP was not expressed in this population but was present at very high levels in VM E13.5 glial preparations (Figs. 3C and E). We also observed the expression of nestin and vimentin in the VM glial preparations (Figs. 3A and D), consistent with previous descriptions of their presence in radial glia cells (Shults et al., 1990; Takano and Becker, 1997; Tohyama et al., 1992). Therefore,

our results indicated that the VM glial preparations were primarily composed of astrocytes and radial glia cells. Next, we examined the levels of Wnt mRNA by real-time RTPCR in the VM E13.5 neuronal precursor and glial preparations. We observed that Wnt-3a was not present in any of the preparations (data not shown), in agreement with its low levels in the developing VM (Castelo-Branco et al., 2003). Wnt-1 was expressed at low levels in E13.5 VM glia and at higher levels in differentiating neuronal precursors (Fig. 3F). Instead, Wnt-5a was highly expressed in both VM E13.5 glia and neuronal precursor populations (Fig. 3G). These results suggested that VM DA progenitors could differentiate into DA neurons by autocrine or paracrine exposure to Wnts. To assess whether Wnt expression could reflect the expression of patterning genes in both VM glial and neuronal precursor cells, we examined the expression of

Fig. 3. E13.5 VM glia express Wnt-5a and are regionally patterned. Real-time RT-PCR analysis showed that the E13.5 VM neuronal precursors (NP) expressed mainly nestin (A) and TUJ (B), while glial cells (G) from E13.5 VM expressed GFAP (C) and vimentin (D); (E) Neuronal precursors isolated from E13.5 VM were immunoreactive for h-tubulin III (TUJ), but not for glial fibrillary acidic protein (GFAP), after 3 days in vitro. Glial cell preparations isolated from E13.5 VM, after 7 – 10 days expansion in serum media and 3 days in serum-free media, were immunoreactive for GFAP, but rarely to TUJ. (F, G) Wnt-1 and Wnt-5a were expressed in both VM neuronal precursor and glial populations, as assessed by real-time RT-PCR. (H – M) VM E13.5 neuronal precursors express higher levels of transcriptional regulators as Pax-2 (H), Pax-5 (I), engrailed-1 (En-1) (J), Otx-2 (K), Pax-6 (L) and Emx-2 (M) then VM glial cells, as assessed by realtime RT-PCR. Statistical analysis was performed using one-tailed (A – D) and two-tailed (F – M) unpaired t test. Arbitrary units—a.u.; scale bar, 50 Am.

G. Castelo-Branco et al. / Mol. Cell. Neurosci. 31 (2006) 251 – 262

transcription factors involved in fate determination of the developing brain. We found that neuronal precursors from the E13.5 VM expressed high levels of key midbrain regulators, including Pax-2, Pax-5 and En-1 (Wurst and Bally-Cuif, 2001), and low levels of Otx-2 (Puelles et al., 2003, 2004; Vernay et al., 2005; Wurst and Bally-Cuif, 2001) (Figs. 3H – K). Interestingly, our neuronal precursor population also expressed Pax-6 and the homeodomain transcription factor Emx-2 (Figs. 3L and M). Surprisingly, we also observed that the E13.5 VM glial preparation also expressed all these transcription factors, albeit at lower levels than the neuronal precursors. Because this expression pattern could reflect the presence of neuronal precursors in the VM E13.5 glial preparations, we analyzed P1 VM and Cx glial preparations and examined whether the expression of these transcription factors was retained in glial cells in a region-specific manner after the neurogenic period in the absence of contaminating proliferating precursors. P1 VM glial cultures express Wnt-5a mRNA and retain a region specific transcriptional code We first examined our P1 VM glial cultures by immunocytochemistry and real-time PCR and found abundant glial fibrillary acidic protein (GFAP)-positive T1 astrocytes (Fig. 4A), radial glial cells positive for the markers vimentin (Shults et al., 1990), 3CB2 (Prada et al., 1995) (Fig. 4A) and nestin (data not shown) and much lower levels of TUJ (close to detection level, data not shown). Thus, when compared to E13.5 VM glia, P1 VM glia preparations show an enrichment in glial cells. Similar to our observation with E13.5 glia, P1 VM glia (VM G) expressed Pax-2, En-1 and very low levels of the Otx-2 (Figs. 4C – E) but, surprisingly, not Pax-5 (data not shown). The expression of

255

all these transcription factors in VM G was higher than in P1 Cx glia (Cx G) (Figs. 4C – E). Instead, Pax-6 and Emx-2 were expressed at higher levels in the Cx G (Figs. 4F and G). We then investigated the presence of Wnt transcripts in these P1 VM and Cx glial cultures. Wnt-1 and Wnt-3a were not detected in either VM or Cx glial preparations (data not shown). However, Wnt-5a mRNA was expressed at much higher levels in VM glia, compared to Cx glia (Fig. 4B). Thus, our results indicate that P1 glia retain the expression of some Wnts and region-specific transcription factors, being P1 cortical glia Emx-2+++/Pax-6++/Wnt-5a+/ and P1 VM glia Pax-2++/En-1++/Wnt-5a++. Wnt-5a protein is secreted by P1 VM glia and increases the DA differentiation of cortical Nurr1+ precursors To confirm that the expression of Wnt-5a mRNA in VM glia resulted in secreted protein, we examined if the Wnt-5a protein was present in partial purified P1-conditioned media (p.p. M) from VM (VM M) and cortex (Cx M) by immunoblotting with an anti-Wnt-5a antibody. Secreted Wnt-5a was not detected in the P1 Cx M samples, while a band corresponding to the expected size for Wnt-5a (¨50 kDa) was present in the P1 VM M (Fig. 5A). Using a dilution series of recombinant Wnt-5a (data not shown), we estimated that the concentration of Wnt-5a in P1 VM-conditioned media was 30 – 100 ng/ml, a range at which recombinant Wnt-5a has been shown to be biologically active (Schulte et al., 2005). These results confirmed that cortex and ventral midbrain exhibit region-specific differences concerning protein expression. In order to determine whether cortical glia expressed any other additional factor that could contribute to the differentiation of Nurr1-positive/TH-negative precursors into

Fig. 4. P1 VM glia express Wnt-5a and retain regional specificity. (A) Glia from the P1 VM (VM G) immunoreacted against antibodies for radial glia markers 3CB2 and vimentin and for the astrocytic marker GFAP. (B) P1 VM glia expressed higher levels of Wnt-5a than Cx glia (Cx G), as assessed by real-time RTPCR. (C – G) VM G expressed Pax-2 (C), engrailed 1 (En-1) (D) and very low levels of Otx-2 (E). Cx G expressed Emx-2 (G) and higher levels of Pax-6 (F) than VM G, as assessed by real-time RT-PCR. Statistical analysis was performed using two-tailed unpaired t test. Arbitrary units—a.u.; scale bar, 50 Am.

256

G. Castelo-Branco et al. / Mol. Cell. Neurosci. 31 (2006) 251 – 262

Fig. 5. P1 VM glia secrete Wnt-5a and, upon coculture of E13.5 VM or Cx Nurr1+ precursors, induce DA differentiation, unlike P1 Cx glia. (A) P1 partial purified conditioned media (p.p. M) from P1 VM glia contained Wnt-5a, as assessed by immunoblot with a Wnt-5a antibody; p.p. P1 Cx M did not contain any secreted Wnt-5a. Similar amounts of protein were loaded, as shown by the total protein. 50 ng of recombinant Wnt-5a was used as a positive control. (B, C) Direct coculture of E13.5 VM precursors with P1 cortex glia (Cx G) did not increase the conversion of Nurr1 precursors into DA neurons, while coculture with P1 VM glia (VM G) significantly increased the percentage of double TH+/Nurr1+ cells, as assessed by immunocytochemistry for Nurr1+/TH+ DA neurons (D, E) E13.5 Cx precursors treated with Wnt-5a or in direct coculture with P1 VM G differentiated in higher numbers into DA neurons, compared to control, as assessed by immunocytochemistry for Nurr1+/TH+ DA neurons; direct coculture with P1 Cx G or treatment with Wnt-1 or Wnt-3a did not increase significantly the number of DA neurons. Statistical analysis was performed using one-way ANOVA with Fisher’s post hoc test.

Nurr1-positive/TH-positive neurons, we cocultured E13.5 VM precursors with P1 cortical glia, using VM glia as control. P1 VM G led to an increase from 40.8% (T3.4%) to 91.9% (T2.8%) in the conversion of Nurr1+ precursors into TH+ neurons. However, direct coculture of the same precursors with P1 cortical glia had no effect (Figs. 5B and C). These results indicate that Cx glia (which express undetectable levels of Wnt5a protein) do not have any effect on the differentiation of DA precursors (Nurr1-positive/TH-negative) into DA neurons (THpositive/Nurr1-positive). Instead, VM glia (expressing high levels of Wnt-5a) increased the DA differentiation of VM Nurr1positive precursors. Since Nurr1 is also expressed in the mouse cortex from E11.5 (Zetterstrom et al., 1996), we next examined if at an equivalent stage in the rat (E13.5), Nurr1+ cortical precursors could be induced to acquire a TH-positive phenotype. Previous reports have indicated that the embryonic rat cortex contains a transient population of DA neurons (E12 – E16) that can be increased in vitro by treatment with neurotrophic factors and/or dopamine (Iacovitti et al., 1987, 1989; Zhou et al., 1994, 1996). We found that cortical precursors only very rarely develop into Nurr1positive/TH-positive neurons (0.75% T 0.479). However, direct coculture of E13.5 cortical precursors with P1 VM G induced a significant increase in the numbers of Nurr1-positive/TH-positive neurons (Figs. 5D and E), indicating that P1 VM glia can

modulate the differentiation of not only VM DA precursors, but also of Cx Nurr1-positive precursors. No changes in the differentiation of DA neurons were observed upon direct coculture of the cortical precursors with P1 cortical glia (Figs. 5D and E), confirming that P1 Cx glia do not express/secrete the DA precursor differentiation factor(s) present in P1 VM glia. Interestingly, treatment of cortical cultures with Wnt-5a produced increases in the number of TH+ cells similar to those observed in the VM G cocultures (Figs. 5D and E). The selectivity of Wnt-5a effects on DA differentiation of E13.5 Nurr1+ cortical precursors was underscored by the lack of effect of Wnt-3a and the poor effects of Wnt-1 (Fig. 5D). These results indicate that VM glia express Wnt-5a protein and that Wnt-5a induces the differentiation of Nurr1+ precursors (from either cortex or VM) into TH+ neurons. Wnt-5a blocking antibody reduces the differentiation of VM neuronal precursors into DA neurons, induced by P1 VM glia We have previously shown that blocking antibodies to FGF-2 or Shh cannot prevent the effects of ventral midbrain glia on dopaminergic neurogenesis (Wagner et al., 1999). To confirm whether Wnt-5a is an important component of the DA inductive activity, we aimed at blocking Wnt-5a signaling using an antibody that has been previously shown to block the effects

G. Castelo-Branco et al. / Mol. Cell. Neurosci. 31 (2006) 251 – 262

257

Fig. 6. Blocking Wnt-5a signaling inhibits the increase in DA neurons in E14.5 VM precursors, induced by P1 VM glia. (A) Wnt-5a antibody (final concentration in Ag/ml) was added to SN4741 cells before addition of recombinant Wnt-3a and Wnt-5a (final concentration: 100 ng/ml). This antibody was able to partially block Wnt-5a binding to the SN4741 cells, as assessed by immunoblotting for Wnt-5a. Similar amounts of protein were loaded, as shown by the total protein. (B, C) Immunostaining for TH showed that a blocking antibody against Wnt-5a reduced the numbers of DA neurons in E14.5 VM precursors in indirect coculture with P1 VM astroglia (VM G). Statistical analysis was performed using paired t test. Scale bar, 50 Am.

of this glycolipoprotein in hematopoietic stem cells (Murdoch et al., 2003). In order to test its capacity to block Wnt-5a, this antibody was added to the dopaminergic precursor cell line SN4741 cells (Son et al., 1999), prior to the addition of recombinant 100 ng/ml Wnt-3a or Wnt-5a. We found that the antibody was able to partially block Wnt-5a binding to the SN4741, as assessed by immunoblotting for Wnt-5a in cell preparations (Fig. 6A). Moreover, the Wnt-5a blocking antibody led to a 26% reduction in the number of TH-positive DA neurons in E14.5 VM precursors in indirect coculture with P1 VM glia (Figs. 6B and C). Thus, our results show that the secretion of Wnt-5a by VM G promotes DA differentiation of VM precursors and that Wnt-5a is a key component for the DA differentiation activity of VM glia.

Discussion In the last decade, glial cells were identified as the source of trophic factors for several types of neurons including DA neurons (Engele, 1998; Engele and Bohn, 1991; Engele et al., 1996; O’Malley et al., 1992, 1994; Petrova et al., 2003; Schaar et al., 1994; Takeshima et al., 1994). More recently, we reported that astrocytes were the source of soluble factors controlling DA neurogenesis, as VM glia, but not Cx glia, promoted DA neurogenesis in Nurr1 overexpressing neural stem cells (Wagner et al., 1999). An effect of adult glia on neurogenesis in the adult subgranular zone NSC was subsequently described (Song et al., 2002). Collectively, these reports support the idea that regionspecific glial-derived factors regulate neurogenesis. Radial glia, the first glial cell type appearing during development in the brain, were also originally described as a scaffold for migrating neurons in several brain structures, including the cerebral cortex (Rakic, 2003) and VM (Kawano et al., 1995; Shults et al., 1990). However, radial glia have been recently found to give rise to neurons and to exhibit neurogenic functions in several regions of the CNS (Anthony et al., 2004; Goldman, 2003; Gotz, 2003; Heins et al., 2002; Malatesta et al., 2000; Noctor et al., 2001). Here, we report that glial cell preparations, containing both astrocytes and radial glial cells, express region-specific transcription factors and secrete distinct members of the Wnt family

of glycolipoproteins. Moreover, we report that secretion of Wnt5a by VM glia promotes the development of Nurr1+ VM or Cx precursors into TH+ neurons. However, cortical glia are not involved in the differentiation of dopaminergic precursors into dopaminergic neurons (see Figs. 5B – E) and therefore increase the numbers of DA neurons in the cultures through alternative mechanisms, most likely involving proliferation and survival (Engele, 1998; Takeshima et al., 1994). Thus, our results, together with the data in the literature, suggest a model in which VM radial glia and astrocytes constitute part of the VM DA neurogenic niche and play a key role in VM DA neurogenesis. The function of glia may derive from their capacity to retain the expression of region-specific transcription factors and secreted factors (including Wnts and other factors) and to regulate diverse aspects of neuronal development, including proliferation, neurogenesis, migration, survival and differentiation, in a regionspecific manner. One of the implications of this model is that glial cells, by expressing region-specific transcription factors involved in the patterning of the central nervous system, may contribute to provide regional identity to neuronal precursors. Indeed, P1 VM glial cells retained a DA-inducing activity capable of promoting the DA differentiation of VM stem/ progenitor or precursor cells. Furthermore, P1 cortical glia expressed Emx-2 and Pax-6, which are involved in the specification of cortical neuronal identities (Bishop et al., 2000, 2002; Gotz et al., 1998; Heins et al., 2001; Muzio et al., 2002; Muzio and Mallamaci, 2003). Emx-2 is also a direct repressor of Wnt-1 during telencephalon development (Ligon et al., 2003). In agreement with this finding, P1 Cx glia did not express Wnt-1 mRNA. Instead, VM glia expressed Pax-2, En-1 and Otx-2 at higher levels than Cx glia, but also low levels of Pax-6. Different Pax proteins also regulate Wnt expression during development (Funahashi et al., 1999; Mansouri and Gruss, 1998; Wiggan and Hamel, 2002). Pax-2 is one of the first transcription factors expressed at the developing mid – hindbrain (Wurst and BallyCuif, 2001) and is required for the proper development of this region (Schwarz et al., 1997). Pax-2 binds to a Wnt-1 enhancer sequence (Rowitch et al., 1998), and Pax-5, which was expressed at E13.5 but not P1 glial cells, up-regulates Wnt-1 (Funahashi et al., 1999). Thus, transcription factors like Emx-2 and Pax might modulate the function of region-specific neurogenic niches not

258

G. Castelo-Branco et al. / Mol. Cell. Neurosci. 31 (2006) 251 – 262

only by cell autonomous mechanisms (Bishop et al., 2002; Gotz et al., 1998; Heins et al., 2001, 2002; Muzio and Mallamaci, 2003), but also by modulating non-cell-autonomous signals (such as glial-derived Wnts), which in turn regulate neurogenesis. Our results also highlight Wnt-1 as a key player in regulating earlier stages of DA neuron development. We found that Wnt-1 was expressed at E13.5 in VM neuronal precursors and glial cell preparations, but not by P1 VM glia. Thus, in addition of the Wnt5a function in the differentiation of Nurr1+ precursors into neurons, our results suggest a role for Wnt-1 at early stages. Accordingly, Wnt-1 has been shown to be required for the development of midbrain – hindbrain regions (Danielian and McMahon, 1996; McMahon et al., 1992; Thomas and Capecchi, 1990) and to be necessary to maintain the levels of Pax-2 in the mid – hindbrain boundary (Lekven et al., 2003). We have previously found that Wnt-1 promotes the proliferation of VM Nurr1+ precursors and their differentiation to TH+ DA neurons (Castelo-Branco et al., 2003). Wnt-1 could function at E13.5 to maintain Pax-2 expression and expand the precursor pool in the VM DA neurogenic niche. By contrast, Wnt-5a, consistent with a later function, was expressed in glial cells from E13.5 to P1 VM. Glial-derived Wnt-5a promoted the DA differentiation of neural precursor cells, in a similar way as partially purified Wnt-5a and recombinant Wnt-5a (Castelo-Branco et al., 2003; Schulte et al., 2005). However, the increase in the number of TH+ cells could not be completely abolished with Wnt5a antibodies both in the precursors (Fig. 6) and rat E12.5 VM neural stem/progenitor cell cultures (preliminary data, not shown), suggesting that additional components exist and contribute to the powerful effects of VM glia in the generation of DA neurons (Hall et al., 2003; Wagner et al., 1999). In summary, our results highlight the important function of glial-derived Wnt-5a in the differentiation of Nurr1-expressing precursors into DA neurons. Our data also suggest that VM radial glia and astrocytes are important components of the DA neurogenic niche since they retain region-specific identity (through the expression of Pax-2, En-1 and Otx-2) and regulate neurogenesis in a region-specific manner by providing instructive, proliferative and differentiation signals, such as Wnt-1 and Wnt-5a.

Experimental methods Precursor cultures and treatments E13.5 and 14.5 Cx and VMs obtained from time-mated Sprague – Dawley rats (ethical approval for animal experimentation was granted by Stockholms Norra Djurfo¨rso¨ks Etiska Na¨mnd) were dissected, mechanically dissociated and plated at a final density of 1  105 cells per cm2 on poly-d-lysine (10 Ag/ml)coated plates (Falcon) in serum-free N2 medium, consisting of a 1:1 mixture of F12 and MEM (Invitrogen) with 15 mM HEPES buffer, 1 mM glutamine (Invitrogen), 5 Ag/ml insulin, 100 Ag/ml apo-transferrin, 60 AM putrescine, 20 nM progesterone, 30 nM selenium, 6 mg/ml glucose and 1 mg/ml BSA (all purchased from Sigma). Cultures were grown for 1 to 3 days in vitro, in a 37-C incubator, at 5% CO2, before fixation. BrdU (10 AM) was added to the cultures 6 h prior to fixation, and Wnt-conditioned media was prepared, partial purified and added (at 10 Al/ml of a 25 Ag/Al stock) according to Castelo-Branco et al. (2003). Conditioned media of type 1 astrocytes preparations (VM M) were added at

40% of the final volume or at 10 Al/ml of a 25 Ag/Al stock (after partial purification, as described in Castelo-Branco et al., 2003). Human FGF-2, mouse FGF-8b and human GDNF (all from R&D Systems) were used at a final concentration of 10 ng/ml in Fig. 1. Wnt-5a antibody (R&D Systems) was added to precursor or neurosphere cultures prior to the addition of the glial cells at a concentration of 2 Ag/ml. Neural stem/progenitor cultures E12.5 VMs obtained from time-mated Sprague – Dawley rats were dissected, mechanically dissociated and plated at a final density of 1  105 cells per cm2 in serum-free N2 medium, with human fibroblast growth factor (FGF)-2 (20 ng/ml) (Biosite Nordic), mouse FGF-8 (20 ng/ml) and amino-terminal peptide sonic hedgehog (N-Shh) (500 ng/ml) (R&D Systems). Neural stem/progenitor cells were expanded as neurospheres for 7 – 9 days, with fresh factors added every second day, in a 37-C incubator, at 5% CO2. For differentiation, cells were dissociated with collagenase/dispase (0.7 Ag/ml; Roche) for 20 min in an orbital shaker at 37-C and 80 rotations per min (rpm). Cells were then mechanically dissociated and centrifuged for 5 min at 1000 rpm. The supernatant was discarded, and cells were re-suspended in N2 media and plated at a density of 26.25  103 cells per cm2 in poly-d-lysine/laminin (10 Ag/ml)-coated plates. Differentiation proceeded for 5 days before fixation. Glial cultures and coculture experiments Glial cultures (O’Malley et al., 1992) were established from E13.5 and P1 VMs and Cxs, obtained from time-mated Sprague – Dawley rats. After mechanical dissociation, 10  106 cells were plated in previously poly-d-lysine (10 Ag/ml)-coated 25 cm2 flasks, in NM15 medium (containing 15% fetal bovine serum, 7.2 mg/ml glucose, 2.4 mM glutamine, 0.5% fungizone and 0.6% gentamycin in MEM (all from Invitrogen)). Cells were grown to monolayer, and then microglia and debris were removed by shaking for 1 h at 37-C and 190 rpm. The attached cells were then washed with sterile PBS and incubated for 1 – 2 h in a 37-C incubator, at 5% CO2, before overnight shaking at 37-C and 210 rpm. The supernatant media containing oligodendrocyte precursors and other cell types were discarded. The glia monolayer was trypsinized and replated (1:2 to 1:4 split) in poly-d-lysine (10 Ag/ ml)-coated 6- and 12-well plates or in insert membranes (0.4 Am polyethylene terephthalate) for indirect coculture (BD Biosciences). The glia were allowed to grow until confluency in NM15 media, washed with PBS (to remove any remaining serum) and changed to N2 media. After 1 – 3 days, conditioned media were collected (after centrifugation at 2000 rpm for 10 min to remove cell debris), and cocultures were initiated in fresh N2. In the case of direct cocultures, precursor cells were directly plated on top of the monolayer of glia, while, in the indirect cocultures, precursors or neurospheres-derived cells were plated in the bottom of 12-well plates, and then inserts containing the monolayer of glia were added to the well, on top of the differentiating cells. These inserts allowed diffusion of factors from the glia monolayer to the differentiating cells and vice versa, without direct contact between the cells. Glia in inserts were fixed before and after coculture for immunocytochemistry. We have previously shown that the DA inductive activity is labile and can be better recovered from indirect or direct cocultures than from conditioned media (Wagner et al.,

G. Castelo-Branco et al. / Mol. Cell. Neurosci. 31 (2006) 251 – 262

1999). The effects of both preparations are comparable, but the coculture system was more reliable. Real-time PCR and quantification of gene expression Total RNA was isolated from E13.5 and P1 glial cultures or E13.5 – 14.5 VM precursor cultures (n = 2 – 6). Reverse transcription reaction and real-time RT-PCR were performed according to Castelo-Branco et al. (2003). The following PCR program was used for SYBR Green detection on the ABI PRISM 5700 Detection System (PE Applied Biosystems, Foster City, CA, USA): 94-C for 2 min, 35 – 40 cycles of 94-C for 30 s, 59 – 60-C for 30 s, 72-C for 15 s and 80-C for 5 s. Alternatively, the Platinum Quantitative PCR SuperMix-UDG (Invitrogen) was used, according to the manufacturer’s instructions (but with a 4 dilution from the original mastermix, instead of 2). In Table 1, the sequences of the primers (purchased from DNA Technology A/S, Aarhus, Denmark) are stated. Quantum RNA classical 18S internal standard primers were purchased from Ambion (Austin, USA). All data were normalized to the levels of the housekeeping gene 18S, and statistical analysis of the results was performed by unpaired t test, with Prism 4 software (GraphPad). Significance for all tests was assumed at the level of P < 0.05 (*P < 005; **0.01 < P < 0.001; ***P < 0.001).

259

Immunocytochemistry Cells were fixed in ice-cold 4% paraformaldehyde for 20 min, washed in PBS and blocked for 15 min with PBT (PBS with 1% BSA, 0.3% Triton X100 and 0.02% sodium azide, all from Sigma). After an overnight incubation at 4-C (or 1 h at room temperature) with the primary antibody, cells were washed twice with PBS for 10 min and incubated for 2 h with an appropriate secondary antibody. After 2 washes with PBS, the cells were either counterstained with Hoechst 33258 for 10 min (in case of immunofluorescence) or incubated with avidin – biotin complex solution (Vector) for 2 h. After 2 washes with PBS, the staining was developed with chromogenic dyes. The following primary and secondary antibodies were used: mouse a-TH (1:500 to 1:1000 dilution—Immunostar), rabbit a-TH (1:100 to 1:250—Pelfreeze), mouse a h-III-tubulin (1:1000—Promega), mouse a-Nurr1 (1:250—BD Biosciences), rabbit a-Nurr1 (1:2000—a kind gift from T. Perlmann, Karolinska Institute, Stockholm), rabbit a-Nurr1 (1:1000—Santa Cruz), rabbit a-GFAP (1:400—Dako), mouse aBrdU (1:100—Dako), mouse a-nestin (Rat401, 1:100—Developmental Studies Hybridoma Bank, Iowa), mouse a-vimentin (1:100—Dako), mouse 3CB2 (1:100—Developmental Studies Hybridoma Bank, Iowa), biotinylated 1:500 goat a-rabbit or a-

Table 1 DNA sequences of real-time PCR primers mRNA

Annealing temperature (-C)

Sequence (5V– 3V)

p21 forward p21 reverse p27 forward p27 reverse p57 reverse p57 forward vimentin forward vimentin reverse TUJ forward TUJ reverse MAP2 forward MAP2 reverse GFAP forward GFAP reverse TH forward TH reverse nestin forward nestin reverse wnt1 forward wnt1 reverse wnt3a forward wnt3a reverse wnt5a forward wnt5a reverse Pax2 forward Pax2 reverse Pax5 forward Pax5 reverse Pax6 forward Pax6 reverse Otx-2 forward Otx-2 reverse Emx2 forward Emx2 reverse En-1 forward En-1 reverse

60

AGCAAAGTATGCCGTCGTCTGT TCTCCGTGACGAAGTCAAAGTTC TTAATTGGGTCTCAGGCAAACTCT CTAACCCAGCCTGATTGTCTGAC GAGGACCAGAACCGCTGGGACTT ACTCGCTGTCCACCTCCATCCA CTTCCCTGAACCTGAGAGAAACTAA CAGGAGGTGTCTTTTTGAGTGGGT CCATTCAGAGTAAGAACAGTAGTTACT GGATGTCACACACCGCTACCTT GGTATCTGCAAGGATAGTTCAAGTAGTCAC CCTTCTCTTGTTCTCCTTTCAGGAC CTCAAGAGGAACATCGTGGTAAAG TCCTGCTTCGAGTCCTTAATGAC AGTACTTTGTGCGCTTCGAGGTG CTTGGGAACCAGGGAACCTTG GTCAGATCGCTCAGATCCTGGA CCAGACTAAGGGACATCTTGAGGT CTTCGGCAAGATCGTCAACCGCGAAGATGAACGCTGTTTCT GAACGCGACCTGGTCTACTACG GTTAGGTTCGCAGAAGTTGGGT AATAACCCTGTTCAGATGTCA TACTGCATGTGGTCCTGATA AGTCTTTGAGCGTCCTTCCTATCC CATTCCCCTGTTCTGATTTGATGT AACAGGATCATTCGGACAAAAGTA AGCCTGTAGACACTATGCTGTGAC TCAGACCTCCTCATACTCGTGCA TGTAGGTATCATAACTCCGCCCA TGTAGAAGCTATTTTTGTGGGTGA GAGCATCGTTCCATCTAACTTTTT ACGCTTTTGAGAAGAACCATTACGT ACCTGAGTTTCCGTAAGACTGAGAC CAGAGACTCAAGGCGGAGTT CCTGTGGCTTTCTTGATCTTG

57 65 59 60 61 60 62 59 60 60 58 59 59 59 59 59 59

260

G. Castelo-Branco et al. / Mol. Cell. Neurosci. 31 (2006) 251 – 262

mouse IgG, Cyanine-2 or rhodamine-coupled horse-a-mouse or goat a-rabbit IgG 1:200, from Vector and Jackson Laboratories. BrdU immunocytochemistry included a pre-incubation for 30 min with 2 N HCL. Nurr1 staining was done prior to TH and BrdU stainings. Images were acquired from stained cells in PBS at room temperature with a Zeiss Axioplan 100 M microscope (LD Achrostigmat 20, 0.3 PH1 V 0 – 2 and LD Achroplan 40, 0.60 Korr PH2 V 0 – 2) and collected with a Hamamatsu camera C4742 – 95 (with QED imaging software). Quantitative immunocytochemical data represent means T standard error of the mean, obtained from 10 non-overlapping fields in 2 – 4 replicates per condition from 3 to 4 separate experiments. Statistical analysis was performed in StatView (Cary, NC, USA) or Prism 4 software (Graph Pad, San Diego, USA) as described in the figure legends, and significance for all tests was assumed at the level of P < 0.05 (*P < 0.05; **0.01 < P < 0.001; ***P < 0.001). Immunoblotting Conditioned media from Cx and VM astrocytes (p.p. VM M/Cx M) were collected, partially purified (Castelo-Branco et al., 2003) and mixed with 1 Laemmli buffer (1:20). SN4741 cells (Son et al., 1999) were grown at 37-C on 6-well plates and were sequentially treated with blocking antibody (0.5 – 2 Ag/ml) and Wnts (100 ng/ml). Cells were washed twice with PBS (pH 7.2), lysed in 120 Al of 100 mM Tris/HCl (pH 6.8), 10% glycerol and 1% SDS and mixed (10:1, v/v) with 10% h-mercaptoethanol and 1% bromophenol blue. These SN4741 protein samples and p.p. VM/Cx M were boiled and subjected to 10% SDS-PAGE (20 Al of cell sample and 15 Al of media sample per lane) and electrotransferred onto Hybond-P PVDF membrane. Membranes were blocked in 5% milk and immunodetected using anti-Wnt-5aspecific primary antibody (AF 645, R&D Systems) and appropriate secondary antibody. Signal was visualized by ECL Plus detection system (Amersham Biosciences) according to manufacturer’s instructions. After immunodetection, total protein was stained by amidoblack to confirm equal protein loading.

Acknowledgments We wish to thank Dr. Anita Hall for fruitful discussions and critical reading of the manuscript and Lena Amaloo, Lottie Jansson-Sjostrand, Claudia Tello and the Scheele animal house staff for additional assistance. Financial support was obtained from the Swedish Foundation for Strategic Research, Swedish Royal Academy of Sciences, Knut and Alice Wallenberg Foundation, Michael J Fox Foundation, European Commission, Juvenile Diabetes Research Foundation, Swedish MRC and Karolinska Institutet. Praxis XXI programme of the Portuguese Fundac¸a˜o para a Cieˆncia e Tecnologia/European Social Fund, the Karolinska Institute and Calouste Gulbenkian Foundation supported G.C.-B.

References Anthony, T.E., Klein, C., Fishell, G., Heintz, N., 2004. Radial glia serve as neuronal progenitors in all regions of the central nervous system. Neuron 41, 881 – 890. Bishop, K.M., Goudreau, G., O’Leary, D.D., 2000. Regulation of area

identity in the mammalian neocortex by Emx2 and Pax6. Science 288, 344 – 349. Bishop, K.M., Rubenstein, J.L., O’Leary, D.D., 2002. Distinct actions of Emx1, Emx2, and Pax6 in regulating the specification of areas in the developing neocortex. J. Neurosci. 22, 7627 – 7638. Casper, D., Roboz, G.J., Blum, M., 1994. Epidermal growth factor and basic fibroblast growth factor have independent actions on mesencephalic dopamine neurons in culture. J. Neurochem. 62, 2166 – 2177. Castelo-Branco, G., Wagner, J., Rodriguez, F.J., Kele, J., Sousa, K., Rawal, N., Pasolli, H.A., Fuchs, E., Kitajewski, J., Arenas, E., 2003. Differential regulation of midbrain dopaminergic neuron development by Wnt-1, Wnt-3a, and Wnt-5a. Proc. Natl. Acad. Sci. 100, 12747 – 12752. Ciani, L., Salinas, P.C., 2005. WNTS in the vertebrate nervous system: from patterning to neuronal connectivity. Nat. Rev., Neurosci. 6, 351 – 362. Danielian, P.S., McMahon, A.P., 1996. Engrailed-1 as a target of the Wnt-1 signalling pathway in vertebrate midbrain development. Nature 383, 332 – 334. Doetsch, F., 2003. The glial identity of neural stem cells. Nat. Neurosci. 6, 1127 – 1134. Doetsch, F., Caille, I., Lim, D.A., Garcia-Verdugo, J.M., Alvarez-Buylla, A., 1999. Subventricular zone astrocytes are neural stem cells in the adult mammalian brain. Cell 97, 703 – 716. Engele, J., 1998. Spatial and temporal growth factor influences on developing midbrain dopaminergic neurons. J. Neurosci. Res. 53, 405 – 414. Engele, J., Bohn, M.C., 1991. The neurotrophic effects of fibroblast growth factors on dopaminergic neurons in vitro are mediated by mesencephalic glia. J. Neurosci. 11, 3070 – 3078. Engele, J., Rieck, H., Choi-Lundberg, D., Bohn, M.C., 1996. Evidence for a novel neurotrophic factor for dopaminergic neurons secreted from mesencephalic glial cell lines. J. Neurosci. Res. 43, 576 – 586. Funahashi, J.I., Okafuji, T., Ohuchi, H., Noji, S., Tanaka, H., Nakamura, H., 1999. Role of Pax-5 in the regulation of a mid – hindbrain organizer’s activity. Dev. Growth Differ. 41, 59 – 72. Goldman, S., 2003. Glia as neural progenitor cells. Trends Neurosci. 26, 590 – 596. Gotz, M., 2003. Glial cells generate neurons-master control within CNS regions: developmental perspectives on neural stem cells. Neuroscientist 9, 379 – 397. Gotz, M., Stoykova, A., Gruss, P., 1998. Pax6 controls radial glia differentiation in the cerebral cortex. Neuron 21, 1031 – 1044. Hall, A.C., Mira, H., Wagner, J., Arenas, E., 2003. Region-specific effects of glia on neuronal induction and differentiation with a focus on dopaminergic neurons. Glia 43, 47 – 51. Heins, N., Cremisi, F., Malatesta, P., Gangemi, R.M., Corte, G., Price, J., Goudreau, G., Gruss, P., Gotz, M., 2001. Emx2 promotes symmetric cell divisions and a multipotential fate in precursors from the cerebral cortex. Mol. Cell. Neurosci. 18, 485 – 502. Heins, N., Malatesta, P., Cecconi, F., Nakafuku, M., Tucker, K.L., Hack, M.A., Chapouton, P., Barde, Y.A., Gotz, M., 2002. Glial cells generate neurons: the role of the transcription factor Pax6. Nat. Neurosci. 5, 308 – 315. Hyman, C., Hofer, M., Barde, Y.A., Juhasz, M., Yancopoulos, G.D., Squinto, S.P., Lindsay, R.M., 1991. BDNF is a neurotrophic factor for dopaminergic neurons of the substantia nigra. Nature 350, 230 – 232. Iacovitti, L., Lee, J., Joh, T.H., Reis, D.J., 1987. Expression of tyrosine hydroxylase in neurons of cultured cerebral cortex: evidence for phenotypic plasticity in neurons of the CNS. J. Neurosci. 7, 1264 – 1270. Iacovitti, L., Evinger, M.J., Joh, T.H., Reis, D.J., 1989. A muscle-derived factor(s) induces expression of a catecholamine phenotype in neurons of cultured rat cerebral cortex. J. Neurosci. 9, 3529 – 3537. Ille, F., Sommer, L., 2005. Wnt signaling: multiple functions in neural development. Cell. Mol. Life Sci. 62 (10), 1100 – 1108. Kawano, H., Ohyama, K., Kawamura, K., Nagatsu, I., 1995. Migration of dopaminergic neurons in the embryonic mesencephalon of mice. Brain Res. Dev. Brain Res. 86, 101 – 113.

G. Castelo-Branco et al. / Mol. Cell. Neurosci. 31 (2006) 251 – 262 Kleber, M., Sommer, L., 2004. Wnt signaling and the regulation of stem cell function. Curr. Opin. Cell Biol. 16, 681 – 687. Laywell, E.D., Rakic, P., Kukekov, V.G., Holland, E.C., Steindler, D.A., 2000. Identification of a multipotent astrocytic stem cell in the immature and adult mouse brain. Proc. Natl. Acad. Sci. U. S. A. 97, 13883 – 13888. Lekven, A.C., Buckles, G.R., Kostakis, N., Moon, R.T., 2003. Wnt1 and wnt10b function redundantly at the zebrafish midbrain – hindbrain boundary. Dev. Biol. 254, 172 – 187. Ligon, K.L., Echelard, Y., Assimacopoulos, S., Danielian, P.S., Kaing, S., Grove, E.A., McMahon, A.P., Rowitch, D.H., 2003. Loss of Emx2 function leads to ectopic expression of Wnt1 in the developing telencephalon and cortical dysplasia. Development 130, 2275 – 2287. Lin, L.F., Doherty, D.H., Lile, J.D., Bektesh, S., Collins, F., 1993. GDNF: a glial cell line-derived neurotrophic factor for midbrain dopaminergic neurons. Science 260, 1130 – 1132. Lin, L.F., Zhang, T.J., Collins, F., Armes, L.G., 1994. Purification and initial characterization of rat B49 glial cell line-derived neurotrophic factor. J. Neurochem. 63, 758 – 768. Malatesta, P., Hartfuss, E., Gotz, M., 2000. Isolation of radial glial cells by fluorescent-activated cell sorting reveals a neuronal lineage. Development 127, 5253 – 5263. Mansouri, A., Gruss, P., 1998. Pax3 and Pax7 are expressed in commissural neurons and restrict ventral neuronal identity in the spinal cord. Mech. Dev. 78, 171 – 178. McMahon, A.P., Joyner, A.L., Bradley, A., McMahon, J.A., 1992. The midbrain – hindbrain phenotype of Wnt-1 /Wnt-1 mice results from stepwise deletion of engrailed-expressing cells by 9.5 days postcoitum. Cell 69, 581 – 595. Murdoch, B., Chadwick, K., Martin, M., Shojaei, F., Shah, K.V., Gallacher, L., Moon, R.T., Bhatia, M., 2003. Wnt-5A augments repopulating capacity and primitive hematopoietic development of human blood stem cells in vivo. Proc. Natl. Acad. Sci. U. S. A. 100, 3422 – 3427. Muzio, L., Mallamaci, A., 2003. Emx1, emx2 and pax6 in specification, regionalization and arealization of the cerebral cortex. Cereb. Cortex 13, 641 – 647. Muzio, L., DiBenedetto, B., Stoykova, A., Boncinelli, E., Gruss, P., Mallamaci, A., 2002. Conversion of cerebral cortex into basal ganglia in Emx2( / ) Pax6 (Sey/Sey) double-mutant mice. Nat. Neurosci. 5, 737 – 745. Noctor, S.C., Flint, A.C., Weissman, T.A., Dammerman, R.S., Kriegstein, A.R., 2001. Neurons derived from radial glial cells establish radial units in neocortex. Nature 409, 714 – 720. O’Malley, E.K., Sieber, B.A., Black, I.B., Dreyfus, C.F., 1992. Mesencephalic type I astrocytes mediate the survival of substantia nigra dopaminergic neurons in culture. Brain Res. 582, 65 – 70. O’Malley, E.K., Sieber, B.A., Morrison, R.S., Black, I.B., Dreyfus, C.F., 1994. Nigral type I astrocytes release a soluble factor that increases dopaminergic neuron survival through mechanisms distinct from basic fibroblast growth factor. Brain Res. 647, 83 – 90. Patapoutian, A., Reichardt, L.F., 2000. Roles of Wnt proteins in neural development and maintenance. Curr. Opin. Neurobiol. 10, 392 – 399. Perrone-Capano, C., Da Pozzo, P., di Porzio, U., 2000. Epigenetic cues in midbrain dopaminergic neuron development. Neurosci. Biobehav. Rev. 24, 119 – 124. Petrova, P., Raibekas, A., Pevsner, J., Vigo, N., Anafi, M., Moore, M.K., Peaire, A.E., Shridhar, V., Smith, D.I., Kelly, J., Durocher, Y., Commissiong, J.W., 2003. MANF: a new mesencephalic, astrocytederived neurotrophic factor with selectivity for dopaminergic neurons. J. Mol. Neurosci. 20, 173 – 188. Prada, F.A., Dorado, M.E., Quesada, A., Prada, C., Schwarz, U., de la Rosa, E.J., 1995. Early expression of a novel radial glia antigen in the chick embryo. Glia 15, 389 – 400. Puelles, E., Acampora, D., Lacroix, E., Signore, M., Annino, A., Tuorto, F., Filosa, S., Corte, G., Wurst, W., Ang, S.L., Simeone, A., 2003. Otx dose-dependent integrated control of antero-posterior and dorso-ventral patterning of midbrain. Nat. Neurosci. 6, 453 – 460.

261

Puelles, E., Annino, A., Tuorto, F., Usiello, A., Acampora, D., Czerny, T., Brodski, C., Ang, S.-L., Wurst, W., Simeone, A., 2004. Otx2 regulates the extent, identity and fate of neuronal progenitor domains in the ventral midbrain. Development 131, 2037 – 2048. Rakic, P., 2003. Elusive radial glial cells: historical and evolutionary perspective. Glia 43, 19 – 32. Rowitch, D.H., 2004. Glial specification in the vertebrate neural tube. Nat. Rev., Neurosci. 5, 409 – 419. Rowitch, D., Echelard, Y., Danielian, P., Gellner, K., Brenner, S., McMahon, A., 1998. Identification of an evolutionarily conserved 110 base-pair cis-acting regulatory sequence that governs Wnt-1 expression in the murine neural plate. Development 125, 2735 – 2746. Sanai, N., Tramontin, A.D., Quinones-Hinojosa, A., Barbaro, N.M., Gupta, N., Kunwar, S., Lawton, M.T., McDermott, M.W., Parsa, A.T., ManuelGarcia Verdugo, J., Berger, M.S., Alvarez-Buylla, A., 2004. Unique astrocyte ribbon in adult human brain contains neural stem cells but lacks chain migration. Nature 427, 740 – 744. Schaar, D.G., Sieber, B.A., Sherwood, A.C., Dean, D., Mendoza, G., Ramakrishnan, L., Dreyfus, C.F., Black, I.B., 1994. Multiple astrocyte transcripts encode nigral trophic factors in rat and human. Exp. Neurol. 130, 387 – 393. Schulte, G., Bryja, V., Rawal, N., Castelo-Branco, G., Sousa, K.M., Arenas, E., 2005. Purified Wnt-5a increases differentiation of midbrain dopaminergic cells and dishevelled phosphorylation. J. Neurochem. 92, 1550 – 1553. Schwarz, M., Alvarez-Bolado, G., Urbanek, P., Busslinger, M., Gruss, P., 1997. Conserved biological function between Pax-2 and Pax-5 in midbrain and cerebellum development: evidence from targeted mutations. Proc. Natl. Acad. Sci. U. S. A. 94, 14518 – 14523. Shults, C.W., Hashimoto, R., Brady, R.M., Gage, F.H., 1990. Dopaminergic cells align along radial glia in the developing mesencephalon of the rat. Neuroscience 38, 427 – 436. Son, J.H., Chun, H.S., Joh, T.H., Cho, S., Conti, B., Lee, J.W., 1999. Neuroprotection and neuronal differentiation studies using substantia nigra dopaminergic cells derived from transgenic mouse embryos. J. Neurosci. 19, 10 – 20. Song, H., Stevens, C.F., Gage, F.H., 2002. Astroglia induce neurogenesis from adult neural stem cells. Nature 417, 39 – 44. Specht, L.A., Pickel, V.M., Joh, T.H., Reis, D.J., 1981. Light-microscopic immunocytochemical localization of tyrosine hydroxylase in prenatal rat brain: II. Late ontogeny. J. Comp. Neurol. 199, 255 – 276. Takano, T., Becker, L.E., 1997. Developmental change of the nestinimmunoreactive midline raphe glial structure in human brainstem and spinal cord. Dev. Neurosci. 19, 202 – 209. Takeshima, T., Johnston, J.M., Commissiong, J.W., 1994. Mesencephalic type 1 astrocytes rescue dopaminergic neurons from death induced by serum deprivation. J. Neurosci. 14, 4769 – 4779. Thomas, K.R., Capecchi, M.R., 1990. Targeted disruption of the murine int1 proto-oncogene resulting in severe abnormalities in midbrain and cerebellar development. Nature 346, 847 – 850. Tohyama, T., Lee, V.M., Rorke, L.B., Marvin, M., McKay, R.D., Trojanowski, J.Q., 1992. Nestin expression in embryonic human neuroepithelium and in human neuroepithelial tumor cells. Lab. Invest. 66, 303 – 313. van de Wetering, M., Sancho, E., Verweij, C., de Lau, W., Oving, I., Hurlstone, A., van der Horn, K., Batlle, E., Coudreuse, D., Haramis, A.P., Tjon-Pon-Fong, M., Moerer, P., van den Born, M., Soete, G., Pals, S., Eilers, M., Medema, R., Clevers, H., 2002. The beta-catenin/TCF-4 complex imposes a crypt progenitor phenotype on colorectal cancer cells. Cell 111, 241 – 250. Vernay, B., Koch, M., Vaccarino, F., Briscoe, J., Simeone, A., Kageyama, R., Ang, S.L., 2005. Otx2 regulates subtype specification and neurogenesis in the midbrain. J. Neurosci. 25, 4856 – 4867. Voorn, P., Kalsbeek, A., Jorritsma-Byham, B., Groenewegen, H.J., 1988. The pre- and postnatal development of the dopaminergic cell groups in the ventral mesencephalon and the dopaminergic innervation of the striatum of the rat. Neuroscience 25, 857 – 887.

262

G. Castelo-Branco et al. / Mol. Cell. Neurosci. 31 (2006) 251 – 262

Wagner, J., Akerud, P., Castro, D.S., Holm, P.C., Canals, J.M., Snyder, E.Y., Perlmann, T., Arenas, E., 1999. Induction of a midbrain dopaminergic phenotype in Nurr1-overexpressing neural stem cells by type 1 astrocytes. Nat. Biotechnol. 17, 653 – 659. Wiggan, O.N., Hamel, P.A., 2002. Pax3 regulates morphogenetic cell behavior in vitro coincident with activation of a PCP/non-canonical Wnt-signaling cascade. J. Cell Sci. 115, 531 – 541. Willert, K., Brown, J.D., Danenberg, E., Duncan, A.W., Weissman, I.L., Reya, T., Yates III, J.R., Nusse, R., 2003. Wnt proteins are lipidmodified and can act as stem cell growth factors. Nature 423, 448 – 452. Wurst, W., Bally-Cuif, L., 2001. Neural plate patterning: upstream and downstream of the isthmic organizer. Nat. Rev., Neurosci. 2, 99 – 108.

Zetterstrom, R.H., Solomin, L., Mitsiadis, T., Olson, L., Perlmann, T., 1996. Retinoid X receptor heterodimerization and developmental expression distinguish the orphan nuclear receptors NGFI-B, Nurr1, and Nor1. Mol. Endocrinol. 10, 1656 – 1666. Zhou, J., Bradford, H.F., Stern, G.M., 1994. The stimulatory effect of brainderived neurotrophic factor on dopaminergic phenotype expression of embryonic rat cortical neurons in vitro. Brain Res. Dev. Brain Res. 81, 318 – 324. Zhou, J., Bradford, H.F., Stern, G.M., 1996. Induction of dopaminergic neurotransmitter phenotype in rat embryonic cerebrocortex by the synergistic action of neurotrophins and dopamine. Eur. J. Neurosci. 8, 2328 – 2339.