Molecular Phylogenetics and Evolution 63 (2012) 500–509
Contents lists available at SciVerse ScienceDirect
Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev
Variation in ribosomal and mitochondrial DNA sequences demonstrates the existence of intraspecific groups in Paramecium multimicronucleatum (Ciliophora, Oligohymenophorea) Sebastian Tarcz a,⇑, Alexey Potekhin b, Maria Rautian c, Ewa Przybos´ a a b c
Department of Experimental Zoology, Institute of Systematics and Evolution of Animals, Polish Academy of Sciences, Sławkowska 17, 31-016 Kraków, Poland Department of Microbiology, Faculty of Biology and Soil Science, St. Petersburg State University, Saint Petersburg 199034, Universitetskaya nab. 7/9, Russia Laboratory of Protistology and Experimental Zoology, Faculty of Biology and Soil Science, St. Petersburg State University, Saint Petersburg 199034, Universitetskaya nab. 7/9, Russia
a r t i c l e
i n f o
Article history: Received 28 September 2011 Revised 27 January 2012 Accepted 31 January 2012 Available online 8 February 2012 Keywords: Paramecium multimicronucleatum Syngens Internal transcribed spacer (ITS) region LSU ribosomal DNA (LSU rDNA) Cytochrome c oxidase subunit I gene (COI) Molecular phylogeny
a b s t r a c t This is the first phylogenetic study of the intraspecific variability within Paramecium multimicronucleatum with the application of two-loci analysis (ITS1–5.8S–ITS2–50 LSU rDNA and COI mtDNA) carried out on numerous strains originated from different continents. The species has been shown to have a complex structure of several sibling species within taxonomic species. Our analysis revealed the existence of 10 haplotypes for the rDNA fragment and 15 haplotypes for the COI fragment in the studied material. The mean distance for all of the studied P. multimicronucleatum sequence pairs was p = 0.025/0.082 (rDNA/ COI). Despite the greater variation of the COI fragment, the COI-derived tree topology is similar to the tree topology constructed on the basis of the rDNA fragment. P. multimicronucleatum strains are divided into three main clades. The tree based on COI fragment analysis presents a greater resolution of the studied P. multimicronucleatum strains. Our results indicate that the strains of P. multimicronucleatum that appear in different clades on the trees could belong to different syngens. Ó 2012 Elsevier Inc. All rights reserved.
1. Introduction Paramecium is one of the best studied ciliates. The species of this genus are present in freshwater bodies (lakes, ponds, rivers, marshes, streams, and lakes) (Sonneborn, 1975) and may live in different environmental conditions at temperatures from about 3 to 28 °C (Landis, 1988). They can also be found in brackish environments (Fokin and Chivilev, 1999). The genus Paramecium includes 12 relatively widely distributed valid species and four endemic African species (Fokin et al., 2004; Wichterman, 1986). Paramecium multimicronucleatum (Powers and Mitchell, 1910) belongs to the ‘‘aurelia’’ morphological subgroup (cigar-shaped cells) of the Paramecium genus (Wenrich, 1928; Wichterman, 1953) together with the other species of the Paramecium subgenus (Fokin et al., 2004; Fokin, 2010/2011). The species is characterized by a single macronucleus, several (3–12, usually 4) vesicular micronuclei; the length of the body ranges from 180 to 310 lm (Vivier, 1974). Electron micrograph images of P. multimicronucleatum micronuclei were presented in (Fokin, 1997) and drawings of the vesicular micronucleus in (Fokin, 2010/2011). Morphometric analysis of the species was done by (Fokin and Chivilev, 2000). It is a cosmopolitan species (Fokin, 2010/2011). ⇑ Corresponding author. Fax: +48 12 422 42 94. E-mail address:
[email protected] (S. Tarcz). 1055-7903/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. doi:10.1016/j.ympev.2012.01.024
The cytological details of P. multimicronucleatum conjugation have been described (Wichterman, 1953), and mating types have been studied (Giese, 1957). P. multimicronucleatum has two mating types within a syngen, and it shows the caryonidal inheritance of mating types after conjugation (Beale and Preer, 2008). In some strains, the mating type can undergo reversal in a circadian rhythm, which is very special of P. multimicronucleatum (Barnett, 1966). Four to five syngens were found in this species according to (Sonneborn, 1970), and five non-interbreeding syngens were reported by Nyberg (1988). The species demonstrates outbreeding (Sonneborn, 1957) and is not capable of autogamy (Phadke and Zufall, 2009). In comparison with many papers on the P. aurelia species complex (Coleman, 2005; Hori et al., 2006; Przybos´ et al., 2007, etc.) concerning molecular phylogeny of this group and relationships between the geographical distribution, genetics, physiology, etc. of P. aurelia sibling species, there are only few publications of that kind devoted to P. multimicronucleatum. In the seventies, allozymes were studied in this species and it was shown that P. multimicronucleatum has the same four types of esterases as those occurring in the P. aurelia species (Allen et al., 1973); 10 years later, syngens 1– 5 were used for comparison of esterases and acid phosphatases in P. multimicronucleatum (Allen et al., 1983). As there is no collection of P. multimicronucleatum syngens since of seventies, only a few studies on the phylogenetic relationships using DNA fragments
S. Tarcz et al. / Molecular Phylogenetics and Evolution 63 (2012) 500–509
comparison have been conducted for a limited number (2–8) of P. multimicronucleatum strains (Barth et al., 2006, 2008; Catania et al., 2009; Strüder-Kypke and Lynn, 2010). Apart from that, P. multimicronucleatum was generally used as an outgroup in the studies concerning intraspecific polymorphism within the species of the P. aurelia complex (Tarcz et al., 2006; Przybos´ et al., 2011a) or P. bursaria (Greczek-Stachura et al., 2010). The most common approach to the phylogeny of unicellular organisms is based on comparative analysis of ribosomal DNA sequences and mitochondrial genome fragments. Phylogeny obtained using one DNA fragment carries a high risk of error due to the choice of the sequence, so at least a two-locus approach should be used (Dunthorn et al., 2011). Therefore, our analysis applying two loci (rDNA and COI mtDNA) might shed some light on intraspecific relationships within P. multimicronucleatum, which is closely related to the P. aurelia species complex, one of the best studied groups of protozoan species, but remains almost under-researched as compared to the latter. We supposed that the genome regions which were studied in the case of the P. aurelia species complex would also be useful in P. multimicronucleatum. Here, we employed the primers for COI gene amplification used by (Barth et al., 2006; Strüder-Kypke and Lynn, 2010). To amplify a portion of ribosomal DNA, we developed primers for the amplification of the 50 end of the LSU gene, which, after merging with ITS1–5.8S–ITS2 rDNA, gives an over 1000-bplong marker for Paramecium phylogenetic analysis. Moreover, we successfully applied these primers in the analysis of other Paramecium species (Greczek-Stachura et al., 2011; Przybos´ et al., 2011b). The present paper is the first phylogenetic study of more than thirty P. multimicronucleatum strains originated from distant geographical localities. The aim of our study was to investigate the molecular level of the intraspecific variation across the species by using two loci proposed above. 2. Material and methods 2.1. Material The 33 strains of P. multimicronucleatum studied in this paper originated from Europe, Asia, and North America, with the strain P. bursaria (Italy, Pisa, obtained from S.I. Fokin) used as an outgroup for phylogenetic analysis. The strains are presented in Table 1. 2.2. Methods of strains maintenance and their identification Strains were cultivated on lettuce medium inoculated with Enterobacter aerogenes according to Sonneborn’s (1970) method. The strains were identified as P. multimicronucleatum by the type and number of micronuclei – not less than two, but mostly three to six vesicular micronuclei per cell (Wichterman, 1986; Fokin, 2010/2011), observed at vital slides and at preparations stained by Feulgen reaction (Pearse, 1960), in combination with cigar shape of the cells and their relative size – P. multimicronucleatum is the largest species of Paramecium genus (Fokin, 2010/2011). 2.3. Molecular methods Paramecium genomic DNA was isolated from vegetative cells at the end of the exponential phase (approx. 1000 cells were used for DNA extraction) using a NucleoSpin Tissue Kit (Macherey–Nagel, Germany), according to the manufacturer’s instructions for DNA isolation from cell cultures. The only modification was centrifugation of the cell culture for 20 min at 13,200 rpm. Then, the supernatant was removed and the remaining cells were suspended in lysis buffers and proteinase K.
501
Fragments of rDNA (1074–1076 bp) and COI gene (637–638 bp) were sequenced and analyzed. The rDNA fragment was amplified by ITS1 and ITS4 universal eukaryotic primers (http://www. biology.duke.edu/fungi/mycolab/primers.htm) as well as ITS3zg and 3pLSU primers developed in OligoAnalyzer 3.1 (http://www. eu.idtdna.com/analyzer/applications/oligoanalyzer). F388dT and R1184dT primers (Table 2) and the protocol previously described by (Strüder-Kypke and Lynn, 2010) were used for the amplification of the COI fragment of mitochondrial DNA. In some cases, when the above COI pair of primers did not produce a defined product, instead R1184dT, the internal CoxH10176 primer (Barth et al., 2006) was used. In all cases, PCR amplification was carried out in a final volume of 40 lL containing 30 ng of DNA, 1.5 U Taq-Polymerase (Qiagen, Germany), 0.6 lL of 10 lM of each primer, 10 PCR buffer, and 0.6 lL of 10 mM dNTPs in a T-personal thermocycler™ (Biometra GmbH, Germany) or Mastercycler-ep (Eppendorf GmbH, Germany). After amplification, the PCR products were electrophoresed in 1% agarose gel for 45 min at 85 V with a DNA molecular weight marker (Mass Ruler Low Range DNA Ladder, Fermentas, Lithuania). NucleoSpin Extract II (Macherey–Nagel, Germany) was used for purifying PCR reactions. In some PCR reactions, additional subbands were obtained apart from the main band. In these cases, 30 lL of each PCR product was separated on 1.8% agarose gel (100 V/60 min) with a DNA molecular weight marker (Mass Ruler Low Range DNA Ladder, Fermentas, Lithuania). Then, the band representing the examined fragment was cut out and purified. Cycle sequencing was done in both directions with the application of BigDye Terminator v3.1 chemistry (Applied Biosystems, USA). The primers used in PCR reactions were applied for sequencing the rDNA region, and the primer pair M13F/M13R (StrüderKypke and Lynn, 2010) was used for sequencing the COI fragment (Table 2). The sequencing reaction was carried out in a final volume of 10 lL containing 3 lL of template, 1 lL of BigDye (1/4 of the standard reaction), 1 lL of sequencing buffer, and 1 lL of 5 lM primer. Sequencing products were precipitated using Ex Terminator (A&A Biotechnology, Poland) and separated on an ABI PRISM 377 DNA Sequencer (Applied Biosystems, USA). The sequences are available from the NCBI GenBank database (see Table 1 for accession numbers).
2.4. Data analysis Sequences were examined using Chromas Lite (Technelysium, Australia) to evaluate and correct chromatograms. The alignments of the studied sequences were performed using ClustalW (Thompson et al., 1994) in the BioEdit software (Hall, 1999) and checked manually. Phylograms were constructed for the studied fragments with Mega v5.0 (Tamura et al., 2007), using neighbor joining (NJ) (Saitou and Nei, 1987), maximum parsimony (MP) (Nei and Kumar, 2000), and maximum likelihood (ML). All positions containing gaps and missing data were eliminated. The NJ analysis was performed using the Kimura 2-parameter (chosen in Mega v5.0) correction model (Kimura, 1980) by bootstrapping with 1000 replicates (Felsenstein, 1985). MP analysis was evaluated with the min-mini heuristic parameter (at level 2) and bootstrapping with 1000 replicates. Bayesian inference (BI) was performed with MrBayes 3.1.2 (Ronquist and Huelsenbeck, 2003); the analysis was run for 5,000,000 generations and trees were sampled every 100 generations. All trees for BI analysis were constructed with TreeView 1.6.6 (Page, 1996). Analysis of haplotype diversity, nucleotide diversity, and variable nucleotide positions was done with DnaSP v5.10.01 (Librado and Rozas, 2009). Analysis of nucleotide frequencies, p-distance estimation and identification of substitution
502
S. Tarcz et al. / Molecular Phylogenetics and Evolution 63 (2012) 500–509
Table 1 Paramecium multimicronucleatum strains used in present study. Lp.
Strain designation
Origin
1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13.
CyL 3-13 CyL 3-16 CyL 3-17 ITR SZ-1 MB 1-1 MB 2-5 SR 213-1 SR 212-9 SPb 63-2 OP 13 V 105-2 D 237-6
Europe
14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29.
Ns 2-2 Ns 2-16 Ir 3-6 Kr 113-3 Kr 154-4 Kr 153-36 TRB 99-21 TRB 101-1 TRB 101-4 TRB 101-6 TRB 101-8 Vv 171-1 Vv 171-14 RWL PrO 166-3 KCHI 186-1
Asia
30. 31. 32. 33.
Wg 8 AB 9-8 AB 9-20 BR
Northern America
Collector’s name
Larnaka, Cyprus
M. Rautian
Rome, Italy Szczecin, Poland Bendery, Moldova Bendery, Moldova Rzhev, Tver’ region, Russia Rzhev, Tver’ region, Russia St. Petersburg, Russia St. Petersburg, Russia Sukhona river, Vologda region, Russia Dubna region, Russia
A. Potekhin M. Rautian A. Vishnyakov A. Vishnyakov M. Rautian M. Rautian A. Potekhin D. V. Ossipov M. Rautian M. Rautian
Novosibirsk, Russia Novosibirsk, Russia Omsk, Russia Krasnoyarsk, Russia
Tulun, Irkutsk region, Russia
M. Rautian et M. Rautian et A. Rodionov M. Rautian et M. Rautian et M. Rautian et M. Rautian
Vladivostok, Russia
A. Potekhin, I. Nekrasova
Okeanskaya, Maritime Territory, Russia Kamchatka, Lake Chalaktyrskoye, Russia
A. Potekhin, I. Nekrasova M. Rautian
Williamsburg, Virginia, USA Boston, USA
I. Skoblo
Baton Rouge, Louisiana, USA
S. Fokin
al. al. al. al. al.
GenBank Accession Numbers ITS1–5.8S–ITS2–50 LSU rDNA
COI mtDNA
JF741220 JF741221 JF741222 JF741210 JF741211 JF741212 JF741213 JF741214 JF741215 JF741216 JF741217 JF741218 JF741219
JF741252 JF741253 JF741254 JF741242 JF741243 JF741244 JF741245 JF741246 JF741247 JF741248 JF741249 JF741250 JF741251
JF741223 JF741224 JF741225 JF741226 JF741227 JF741228 JF741229 JF741230 JF741231 JF741232 JF741233 JF741234 JF741235 JF741236 JF741237 JF741238
JF741255 JF741256 JF741257 JF741258 JF741259 JF741260 JF741261 JF741262 JF741263 JF741264 JF741265 JF741266 JF741267 JF741268 JF741269 JF741270
JF741239 JF741240 JF741241 JF304172
JF741271 JF741272 JF741273 JF304189
Table 2 Primers used for amplification and sequencing of studied DNA fragments.
a
DNA fragment
Primer
Sequence 50 –30
References
ITS1–5.8S–ITS2 ITS1–5.8S–ITS2 LSU rDNA LSU rDNA COI mtDNA COI mtDNA COI mtDNA Sequencing primer Sequencing primer
ITS1 ITS4 ITS3zg 3pLSU F388dT R1184dT CoxH10176 M13_F M13_R
TCCGTAGGTGAACCTGCGG TCCTCCGCTTATTGATATGC CryAwCGATGAAGAACGCAGCC CAAGACGGGTCAGTAGAAGCC TGTAAAACGACGGCCAGTGGwkCbAAAGATGTwGC CAGGAAACAGCTATGACTAdACyTCAGGGTGACCrAAAAATCA GAAGTTTGTCAGTGTCTATCC TGTAAAACGACGGCCAGT CAGGAAACAGCTATGAC
Universal eukaryotic primera Universal eukaryotic primera This study This study Strüder-Kypke and Lynn (2010) Strüder-Kypke and Lynn (2010) Barth et al. (2006) Strüder-Kypke and Lynn (2010) Strüder-Kypke and Lynn (2010)
http://www.biology.duke.edu/fungi/mycolab/primers.htm.
models for ML analysis were done with Mega v5.0 (Tamura et al., 2004, 2007).
ITS1–5.8S–ITS2 rDNA gives an over 1000-bp-long marker for Paramecium phylogenetic studies.
3. Results 3.2. Analysis of the studied DNA fragments 3.1. Primer design Previous studies on P. aurelia genetic variability showed that the 50 LSU region was even more variable than the ITS1–5.8S–ITS2 region of rDNA (Tarcz et al., 2006). We developed primers for the amplification of the 50 LSU fragment based on the ITS1–5.8S–ITS2 sequence (forward primer) and the previously analyzed (Tarcz et al., 2006) region of 50 LSU rDNA (reverse primer). Apart from using this primer combination in P. multimicronucleatum, we successfully tested it in the P. aurelia species complex, P. caudatum, P. jenningsi, P. schewiakoffi, P. bursaria, and P. calkinsi (Przybos´ et al., 2011b). Analysis of the 50 LSU rDNA fragment together with
Sequences of the genes encoding the ITS1–5.8S–ITS2–50 end of LSU rDNA (1074–1076 bp) and cytochrome c oxidase subunit I (637–638 bp) were obtained from 33 strains of P. multimicronucleatum. All positions containing gaps and missing data were eliminated. There were a total of 1073 positions in the final dataset of ribosomal and 620 of mitochondrial DNA fragment. The intraspecific haplotype diversity value was Hd = 0.722 (SD = 0.079) for the rDNA fragment and Hd = 0.930 (SD = 0.023) for COI. Our analysis shows the existence of 10 haplotypes for the rDNA fragment and 15 haplotypes for the COI gene sequence in the studied material.
S. Tarcz et al. / Molecular Phylogenetics and Evolution 63 (2012) 500–509
503
Fig. 1. Phylogram constructed for 43 P. multimicronucleatum strains and P. bursaria strain as an outgroup, based on a comparison of sequences from ITS1–5.8S–ITS2 rDNA fragment using the neighbor joining method. Bootstrap values for neighbor joining, maximum parsimony analysis, maximum likelihood and posterior probabilities for Bayesian inference are shown. All positions containing gaps and missing data were eliminated. There were a total of 450 positions in the final dataset. Phylogenetic analyses were conducted in MEGA 5.0. Marked in gray are the strains for which sequences of analyzed DNA fragments were taken from GenBank database.
504
S. Tarcz et al. / Molecular Phylogenetics and Evolution 63 (2012) 500–509
Fig. 2. Phylogram constructed for 44 P. multimicronucleatum strains and P. bursaria strain as an outgroup, based on a comparison of sequences from COI mtDNA fragment using the neighbor joining method. Bootstrap values for neighbor joining, maximum parsimony analysis, maximum likelihood and posterior probabilities for Bayesian inference are shown. All positions containing gaps and missing data were eliminated. There were a total of 620 positions in the final dataset. Phylogenetic analyses were conducted in MEGA 5.0. Marked in gray are the strains for which sequences of analyzed DNA fragments were taken from GenBank database.
S. Tarcz et al. / Molecular Phylogenetics and Evolution 63 (2012) 500–509
505
Fig. 3. Phylogram constructed for 33 P. multimicronucleatum strains and P. bursaria strain as an outgroup, based on a comparison of sequences from ITS1–5.8S–ITS2–50 LSU rDNA fragment using the neighbor joining method. Bootstrap values for neighbor joining, maximum parsimony analysis, maximum likelihood and posterior probabilities for Bayesian inference are shown. All positions containing gaps and missing data were eliminated. There were a total of 1073 positions in the final dataset. Phylogenetic analyses were conducted in MEGA 5.0 (NJ/MP/ML) and Mr. Bayes 3.1.2 (BI).
The levels of nucleotide diversity were p = 0.0252 for rDNA and p = 0.0819 for COI. The nucleotide frequencies were A = 0.312, T = 0.286, C = 0.171, and G = 0.231 for rDNA and A = 0.337, T = 0.426, C = 0.119, and G = 0.118 for COI. The mean distance for all of the studied P. multimicronucleatum sequence pairs was p = 0.025 (SE = 0.003)/0.082 (SE = 0.006) (rDNA/COI). The variation across all of the studied Paramecium strains (P. multimicronucleatum and P. bursaria) is presented in Tables 3 and 4 (Supplementary material). In the studied fragments, we found 92/171 (rDNA/COI) variable positions (79/146 parsimony informative) across P.
multimicronucleatum strains. Mega 5.0 identified the T92 + G model for the ITS1–5.8S–ITS2–50 end of LSU rDNA (I = 0, G = 0.05) and also T92 + G for COI mtDNA (I = 0, G = 0.32) as the best nucleotide substitution models for Maximum Likelihood analysis. 3.3. Phylogenetic analysis of P. multimicronucleatum strains Based on the analysis of the rDNA fragment (Fig. 3), investigated P. multimicronucleatum strains can be divided into three main clades. The first clade (A) comprises twenty strains from around
506
S. Tarcz et al. / Molecular Phylogenetics and Evolution 63 (2012) 500–509
the world (e.g., Rome, Italy; Vladivostok, Russia; or Williamsburg, USA); the second clade (B) consists of seven P. multimicronucleatum strains (also from different continents: Europe and North America), and clade C encompasses the remaining six strains (all of them from the European and Asiatic parts of Russia). The average variation (p-distance) between the studied strains of P. multimicronucleatum is 0.025; however, that observed within the particular clades is not as high, amounting to 0.000 for clade A, 0.004 for clade B, and 0.011 for clade C. Analysis of the COI mtDNA fragment (Fig. 4) demonstrates much greater variation between the investigated strains of P. multimicronucleatum. As in the case of rDNA analysis, the studied strains also form three major clades on the phylogenetic tree, with one of them (A) comprising 19 of the studied strains, the second one (B) including nine strains, and the third one (C) consisting of the remaining
five. Due to the greater variation between the strains, clades A and B can be subdivided into smaller groups (A1, A2, B1, B2). The average variation (p-distance) between the studied strains of P. multimicronucleatum is greater (0.084) than in the analysis of the ribosomal fragment (0.025). Variation within particular groups is generally higher than in the case of ribosomal DNA fragment analysis. In group A, the average variation is 0.029, whereas in subgroups A1 and A2, it is 0.011 and 0.008, respectively. In the second group (B), the mean distance between the strains is 0.063, whereas in subgroups B1 and B2, there were no differences among the studied P. multimicronucleatum strains. Group C is characterized by a mean variation of 0.009. Despite the greater variation of the COI gene fragment, the tree topology is similar to that constructed on the basis of the rDNA fragment. The positions of strains in these phylograms differ
Fig. 4. Phylogram constructed for 33 P. multimicronucleatum strains and P. bursaria strain as an outgroup, based on a comparison of sequences from COI mtDNA fragment using the neighbor joining method. Bootstrap values for neighbor joining, maximum parsimony analysis, maximum likelihood and posterior probabilities for Bayesian inference are shown. All positions containing gaps and missing data were eliminated. There were a total of 620 positions in the final dataset. Phylogenetic analyses were conducted in MEGA 5.0 (NJ/MP/ML) and Mr. Bayes 3.1.2 (BI).
S. Tarcz et al. / Molecular Phylogenetics and Evolution 63 (2012) 500–509
slightly in two points: the strain Kr113-3 from Krasnoyarsk, Russia appears as a separate branch in clade C in ribosomal DNA fragment phylogeny, while it exists as a separate branch in clade B in the case of the COI tree. The strain from Baton Rouge, USA belongs to clade A in terms of ribosomal DNA fragment phylogeny, while COI analysis places it within clade B. The tree based on COI gene fragment analysis presents a greater resolution of the studied P. multimicronucleatum strains. For example, the indistinguishable strains included in clade A according to the ribosomal DNA fragment appear to be well differentiated in terms of their mitochondrial COI. 3.4. Intraspecific relationships between P. multimicronucleatum strains In the present study, we had the opportunity to study variation among strains from one water sample as well as among different samples from one locality collected both at the same time and over different years. Comparing ITS1–5.8S–ITS2–50 LSU rDNA and COI mtDNA, we did not find molecular differences between strains of P. multimicronucleatum derived from one water sample: CyL 3-13, CyL 3-16, CyL 3-17 (Larnaka, Cyprus); Ns 2-2, Ns 2-16 (Novosibirsk, Russia,); Vv 171-1, Vv 171-14 (Vladivostok, Russia), TRB 101-1, TRB 101-4, TRB 101-6, TRB 101-8 (Tulun, Russia), and AB 9-8, AB 9-20 (Boston, USA). One base substitution in the COI fragment was found in TRB 101-1, in comparison with TRB 101-4, TRB 101-6, and TRB 101-8 (Tulun, Russia). Similarly, various samples from the same area such as MB 1-1, MB 2-5 (Bendery, Moldova); Kr 153-36, Kr 154-4 (Krasnoyarsk, Russia), or SR 212-9, SR 213-1 (Rzhev, Russia) demonstrated no molecular differences with one exception: strains from Moldova differed in two nucleotide positions of the COI fragment. We also found that some strains collected in the same area revealed substantial differentiation both in the ribosomal and mitochondrial DNA fragments. These included strains OP 13 and SPb 63-2 (St. Petersburg, Russia), which were collected over different years and from different bodies of water; Kr 153-36 and Kr 154-4 versus Kr 113-3 (Krasnoyarsk, Russia): Kr 153 and Kr 154 are from the Kacha river in Krasnoyarsk (with the kind of brackish water typical of a small polluted river flowing through a town), while Kr 113 is from the Yenisei river (a great, clean river) in Krasnoyarsk, all of them collected in 2002; and TRB 99-21 versus TRB 101-1, TRB 101-4, TRB 101-6, and TRB 101-8 (Tulun, Russia), all of them collected in 2009. 4. Discussion 4.1. P. multimicronucleatum forms a monophyletic cluster distinct from Paramecium bursaria According to the system proposed by Jankowski (1969), P. multimicronucleatum belongs to the subgenus Paramecium, which includes P. aurelia complex, P. jenningsi, P. schewiakoffi, and P. caudatum (Fokin, 2010/2011). Analysis of rDNA sequences corroborates the monophyly of this subgenus (Fokin et al., 2004). Other molecular markers (hsp70, COI) also confirm this. The evolutionary relationships among the syngens and sibling species in the genus Paramecium were investigated by analysis of sequences of the cytosol-type hsp70 gene in the sibling species of the P. aurelia complex, P. caudatum, and P. multimicronucleatum (Hori et al., 2006). P. multimicronucleatum strains originated from the USA and Japan were used in that study. It was shown that P. multimicronucleatum was monophyletic with P. jenningsi and P. aurelia complex and that these three morphospecies were more closely related to each other than to P. caudatum. Comparative analysis of the mitochondrial cytochrome c oxidase subunit I gene was carried out in ciliates,
507
including P. multimicronucleatum (Strüder-Kypke and Lynn, 2010). It was shown that Paramecium presents 20–26% variability across the genus. P. multimicronucleatum forms a monophyletic clade next to the species P. aurelia. In concert with this, our analysis of both ribosomal and mitochondrial DNA fragments showed that the studied P. multimicronucleatum forms a monophyletic cluster distinct from P. bursaria, which was used as an outgroup. 4.2. Taxonomic relationships within P. multimicronucleatum Phylogenetic research of the genus Paramecium has been mainly concentrated on the P. aurelia species complex, and different molecular approaches have been used, for example, RAPD analysis (Stoeck et al., 1998), RFLP and ARDRA (Przybos´ et al., 2007), molecular karyotyping (Nekrasova et al., 2010), and comparison of protein-coding genes (Catania et al., 2009). Information about genetic variation and, thus, phylogenetic relationships within other Paramecium species remains rather sparse. Our results reveal significant genetic variation for the ribosomal DNA fragment (p = 0.025) and for the mitochondrial DNA fragment (p = 0.082) of the studied P. multimicronucleatum strains, which is greater than the variation in 26 P. bursaria strains assigned to five different syngens (p = 0.015 for rDNA and p = 0.063 for COI) (Greczek-Stachura et al., 2011). In comparison to the data obtained for P. calkinsi (p = 0.008/0.116 for rDNA/COI sequences) (Przybos´ et al., 2011b), the mean divergence of all studied P. multimicronucleatum sequence pairs was higher for the rDNA fragment and lower for the COI gene. Based on comparison with the results of previous studies, for example, P. bursaria (Greczek-Stachura et al., 2011) where existence of syngens was confirmed by molecular analysis, our data suggest that the strains of P. multimicronucleatum which appear in different clades on the trees (Figs. 3 and 4) may belong to different syngens. But clear taxonomic interpretation is impossible without mating tests. With no doubt, the breeding system also plays a significant role in speciation. It seems that the rate of evolution is faster in inbreeding ciliates than in outbreeding ciliates (Nyberg, 1988). As P. multimicronucleatum is characterized by outbreeding (Sonneborn, 1975), its intraspecific variation may be associated with this kind of breeding system. This can be supported by comparison with mitochondrial COI sequences. Paramecium multimicronucleatum (N = 33) reveals a slightly higher (0.082) polymorphism than extreme outbreeder P. bursaria (p = 0.063, N = 26; Greczek-Stachura et al., 2011), lower than P. calkinsi (p = 0.116, N = 11; Przybos´ et al., 2011b), and significantly lower than the P. aurelia complex, in which the mean genetic distance between the studied sibling species equals p = 0.156 at N = 73 (Tarcz, 2011 – per. comm.). The first phylogeny of P. multimicronucleatum was based on ITS1–5.8S–ITS2 rDNA and COI mtDNA fragments shorter than those analyzed here (Barth et al., 2006). Barth and coauthors study of intraspecific genetic variation in Paramecium (P. caudatum and P. multimicronucleatum) revealed that intraspecific variation (up to 9.5%) in P. multimicronucleatum was comparable to that between the species of the P. aurelia complex (Coleman, 2005). The eight strains used in their study originated from Australia, Europe, North and South America. As their COI gene sequences formed a tree with several branches, Barth and coauthors supposed that the strains they had used might belong to different syngens. In order to obtain the most reliable dendrograms, we used all appropriate information and compared our data with sequences deposited in GenBank. For rDNA analysis, we included previously submitted ITS1–5.8S–ITS2 (Barth et al., 2006; Hoshina et al., 2006) and COI (Barth et al., 2006; Strüder-Kypke and Lynn, 2010) DNA fragments (Figs 1 and 2). Clade A, which appeared in both phylograms, includes the same strains from different continents, the only exception being the
508
S. Tarcz et al. / Molecular Phylogenetics and Evolution 63 (2012) 500–509
strain BR from Louisiana, which belongs to clade A according to the ITS1–5.8S–ITS2 tree, but appears in clade B in the COI tree. Analysis of the COI mtDNA fragment reveals better resolution of phylograms and shows, for example, the distant position of strain BSP-7 (Rio, Brazil) which was indistinguishable in comparison with ITS1– 5.8S–ITS2 fragments. Clade B includes strains from the Eastern coast of the USA, Poland, Cyprus, and the North-Western region of Russia. Thus, it is also represented worldwide; if subgroups B1 and B2 in the COI gene tree correspond to different syngens, then these phylogenetically related syngens might be called ‘‘American’’ and ‘‘European’’. It is worth mentioning that, in ITS1–5.8S–ITS2 analysis, the strain TH105 (from an unknown locality), which appeared in clade B1, was classified as syngen 2 of P. multimicronucleatum in previous studies (Hoshina et al., 2006). Consequently, it seems that both strains from Boston could also be syngen 2. Clade C, which is the most distant branch in both ribosomal and mitochondrial trees, consists of four strains from the Baikal Lake region and one strain from the North-Western part of Russia (the distance between these localities is about 6000 km). The position of the strain Kr 113-3 isolated from the Yenisei river in Krasnoyarsk is very special in both trees—although it may be formally included in clade C, it actually forms its own branch. It is also interesting that P. multimicronucleatum strains from the same cluster were characterized by a certain type of macronuclear genome molecular organization revealed by PFGE (Nekrasova et al., 2011 – per. comm.), thus resembling the situation in the P. aurelia species complex, where in several cases, the phylogenetically closest species appeared to have the same variant of the macronuclear molecular karyotype (Nekrasova et al., 2010). 4.3. Biogeography of P. multimicronucleatum For many years protozoologists extensively discuss the hypothesis that every unicellular eukaryotic species is ‘‘everywhere’’. It is controversial whether particular ciliate species are present in a limited geographical range (Foissner, 1999) or are ubiquitous (Finlay et al., 1996). Evidence in support of both hypotheses was found in the P. aurelia species complex. Some of the species, like P. primaurelia and P. biaurelia, are abundant and cosmopolitan (Potekhin et al., 2010; Przybos´ and Surmacz, 2010; Sonneborn, 1975). However, other species seem to be distributed only locally; for example, P. quadecaurelia has been found only in Australia Sonneborn (1975) and Namibia (Przybos et al., 2003a). Studied dataset of P. multimicronucleatum presents no clear connection between the geographical origin of the strains and their molecular distance – for example, strains from Russia (Krasnoyarsk) belong to different groups, while strains from Asia, Europe, and America have almost identical sequences regardless of geographical distance. Moreover, a comparison of our data (Figs. 1 and 2) with the results of previous studies (Barth et al., 2006; Strüder-Kypke and Lynn, 2010) shows that the same haplotype can be observed in samples from distant localities. On the other hand, Paramecium populations in a particular body of water may represent more than one haplotype, which was revealed in analysis of P. caudatum (Barth et al., 2006) and in the case of the P. aurelia species complex, where three haplotypes of P. dodecaurelia were found in one pond (Przybos´ et al., 2011a). Although the species of the genus Paramecium are some of the best-known protozoans, the manner of their distribution has not been thoroughly elucidated. So far, there is no evidence of the occurrence of cysts in Paramecium (Wichterman, 1986). Their cells must therefore be transferred in drops of water. It is supposed that paramecia can be transmitted by insects whose habitats are associated with water, by water currents, or by larger animals (water-
fowl or mammals), but this way of dispersal has not been confirmed yet (Tarcz, unpubl.). 4.4. Intraspecific groups in P. multimicronucleatum A comparison of the present results with data obtained for other Paramecium species shows that molecular phylogenetic approaches confirm the existence of morphologically indistinguishable intraspecific groups, which are quite common in Paramecium. The intraspecific groups exist in the molecular phylogenies of P. aurelia Catania et al. (2009), P. bursaria GreczekStachura et al. (2011), P. calkinsi Przybos´ et al. (2011b), P. jenningsi (Maciejewska, 2007; Przybos et al., 2003b), and P. multimicronucleatum (present study). We suppose, just as Barth and co-authors (2006), that our set of strains may contain representatives of several syngens and that the strains clustered together belong to the same syngen or sibling species. However, we cannot prove it without having the relevant standards of the species. Probably, further on, it may be possible to perform mating reactions between the strains belonging to the same groups and to different groups (as defined by the molecular phylogenetic approach) to test whether these groups in fact correspond to syngens. Thus, a set of standard strains of identified syngens would be established. Syngens have been documented for all morphological species of Paramecium (Wichterman, 1986). The only exception is P. caudatum—in this species, syngens are revealed by mating (Gilman, 1941, 1949), but the borders between them are not that distinctive according to the long-term observations accumulated at the Biological Institute of St. Petersburg State University, Russia (Skoblo and Ossipov, unpubl.). Molecular phylogenetic analyses have never shown sufficient evidence for intraspecific groups in P. caudatum (Barth et al., 2006; Hori et al., 2006; Stoeck et al., 2000). There is no explanation for this fact, and it is tempting to think that P. caudatum may have some unknown peculiarities in its breeding system.
5. Conclusions Our results show that the two-locus approach is the most appropriate way of studying intraspecific relationships within Paramecium. In problematic cases, where analysis of ribosomal and COI fragments gives no clear answer, other DNA fragments could be incorporated into research. In our opinion, sampling as many strains as possible of different species of Paramecium using only the two proposed DNA fragments gives an opportunity to screen relationships within the genus and may provide new information about the diversity and evolution of eukaryotic microorganisms like Paramecium.
Acknowledgments The authors are very grateful to S.I. Fokin for providing the Paramecium bursaria strain. This research was partly supported by Grant No. N N303 415636 awarded to S. Tarcz by the Ministry of Science and Higher Education, Warsaw, Poland. The work of the Russian laboratories was supported by RFBR Grants 10-0401192a, 10-04-01188 and by Grant NS-65439.2010.4.
Appendix A. Supplementary material Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.ympev.2012.01.024.
S. Tarcz et al. / Molecular Phylogenetics and Evolution 63 (2012) 500–509
References Allen, S.L., Farrow, S.W., Golembiewski, P.A., 1973. Esterase variations between 14 syngens of Paramecium aurelia under axenic growth. Genetics 73, 561– 573. Allen, S.L., Nerad, T.A., Rushford, C.L., 1983. Comparison of the esterases and acid phosphatases in Paramecium multimicronucleatum, syngens 1–5, P. jenningsi, P. caudatum, and the P. aurelia complex. J. Protozool. 30, 148–154. Barnett, A., 1966. A circadian rhythm of mating type reversals in Paramecium multimicronucleatum, syngen 2, and its genetic control. J. Cell. Physiol. 67, 239– 270. Barth, D., Krenek, S., Fokin, S.I., Berendonk, T.U., 2006. Intraspecific genetic variation in Paramecium revealed by mitochondrial cytochrome c oxidase I sequences. J. Eukaryot. Microbiol. 53, 20–25. Barth, D., Przybos´, E., Fokin, S.I., Schlehel, M., Berendonk, T.U., 2008. Cytochrome b sequence data suggest rapid speciation within the Paramecium aurelia species complex. Mol. Phylogenet. Evol. 49, 669–673. Beale, G., Preer, J.R., 2008. Paramecium: Genetics and Epigenetics. CRC Press, Taylor & Francis Group, Boca Raton, London; New York. Catania, F., Würmser, F., Potekhin, A.A., Przybos´, E., Lynch, M., 2009. Genetic diversity in the Paramecium aurelia species complex. Mol. Biol. Evol. 26, 421– 431. Coleman, A.W., 2005. Paramecium aurelia revisited. J. Eukaryot. Microbiol. 52, 68– 77. Dunthorn, M., Foissner, W., Katz, L.A., 2011. Expanding character sampling for ciliate phylogenetic inference using mitochondrial SSU-rDNA as a molecular marker. Protist 162, 85–99. Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783–791. Finlay, B.J., Corliss, J.O., Esteban, G., Fenchel, T., 1996. Biodiversity at the microbial level: the number of free-living ciliates in the biosphere. Quart. Rev. Biol. 71, 221–237. Foissner, W., 1999. Protist diversity: estimation of the near-impoderable. Protist 72, 6578–6583. Fokin, S.I., 1997. Morphological diversity of the micronuclei in Paramecium. Arch. Protistenkd. 148, 375–387. Fokin, S.I., 2010/2011. Paramecium genus: biodiversity, some morphological features and the key to the main morphospecies discrimination. Protistology 6, 227–235. Fokin, S.I., Chivilev, S.M., 1999. Brackish water Paramecium species and Paramecium polycaryum. Morphometric analysis and some biological peculiarities. Acta Protozool. 38, 105–117. Fokin, S.I., Chivilev, S.M., 2000. Paramecium morphometric analysis and taxonomy. Acta Protozool. 39, 1–14. Fokin, S.I., Przybos´, E., Chivilev, S.M., Beier, C.L., Horn, M., Skotarczak, B., Wodecka, B., Fujishima, M., 2004. Morphological and molecular investigations of Paramecium schewiakoffi nov. spec. (Ciliophora, Oligohymenophorea) and current status of Paramecium distribution, and taxonomy of Paramecium spp.. Eur. J. Protistol. 40, 225–243. Giese, A.C., 1957. Mating types in Paramecium multimicronucleatum. J. Protozool. 4, 120–124. Gilman, L.C., 1941. Mating types in diverse races of Paramecium caudatum. Biol. Bull. 80, 384–402. Gilman, L.C., 1949. Intervarietal mating reactions in Paramecium caudatum. Biol. Bull. 97, 239. Greczek-Stachura, M., Tarcz, S., Przybos´, E., 2010. Intra-specific differentiation of Paramecium bursaria strains by molecular methods – preliminary studies. Folia Biol. (Kraków) 58, 35–45. Greczek-Stachura, M., Pothekin, A., Przybos´, E., Rautian, M., Skoblo, I., Tarcz, S., 2011. Identification of Paramecium bursaria syngens through molecular markers – comparative analysis of three loci in the nuclear and mitochondrial DNA. Protist. doi:10.1016/j.protis.2011.10.009. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids S. 41, 95–98. Hori, M., Tomikawa, I., Przybos´, E., Fujishima, M., 2006. Comparison of the evolutionary distances among syngens and sibling species of Paramecium. Mol. Phylogenet. Evol. 38, 697–704. Hoshina, R., Hayashi, S., Imamura, N., 2006. Intraspecific genetic divergence of Paramecium bursaria and re-construction of the paramecian phylogenetic tree. Acta Protozool. 45, 377–386. Jankowski, A.W., 1969. Proposed classification of Paramecium genus Hill, 1752 (Ciliophora). Zool. Zh. (Moscow) 48, 30–39 (in Russian with English summary). Kimura, M., 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 16, 111–120. Landis, W.G., 1988. Ecology. In: Görtz, H.D. (Ed.), Paramecium. Springer-Verlag, Berlin, pp. 419–433. Librado, P., Rozas, J., 2009. DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25, 1451–1452. Maciejewska, A., 2007. Relationships of new sibling species of Paramecium jenningsi based on sequences of the histone H4 gene fragment. Eur. J. Protistol. 43, 125– 130.
509
Nei, M., Kumar, S., 2000. Molecular Evolution and Phylogenetics. Oxford University Press, New York. Nekrasova, I.V., Przybos´, E., Rautian, M.S., Potekhin, A.A., 2010. Electrophoretic karyotype polymorphism of sibling species of the Paramecium aurelia complex. J. Eukaryot. Microbiol. 57, 494–507. Nyberg, D., 1988. The species concept and breeding systems. In: Görtz, H.D. (Ed.), Paramecium. Springer-Verlag, Berlin, pp. 41–58. Page, R.D.M., 1996. TreeView: an application to display phylogenetic tress on personal computers. Bioinformatics 12, 357–358. Pearse, A.G., 1960. Histochemistry, Theoretical and Applied. Churchill, London, 998p. Phadke, S.S., Zufall, R.A., 2009. Rapid diversification of mating systems in ciliates. Biol. J. Linnean Soc. 98, 187–197. Potekhin, A., Przybos´, E., Nekrasova, I., Yashcheko, V., Rautian, M., 2010. Species of the Paramecium aurelia complex in Russia: new stands and overall distribution. Folia Biol. (Kraków) 58, 73–78. Powers, J.H., Mitchell, C., 1910. A new species of Paramecium (P. multimicronucleata) experimentally determined. Biol. Bull. 19, 324–332. Przybos´, E., Surmacz, M., 2010. New, world-wide data on the distribution of species of the Paramecium aurelia complex (Ciliophora, Protozoa). Folia Biol. (Kraków) 58, 185–188. Przybos´, E., Hori, M., Fokin, S.I., 2003a. Strains of Paramecium quadecaurelia from Namibia, Africa; genetic and molecular studies. Acta Protozool. 42, 357–360. Przybos´, E., Skotarczak, B., Wodecka, B., 2003b. Phylogenetic relationships of Paramecium jenningsi strains (classical analysis and RAPD studies). Folia Biol. (Kraków) 51, 85–95. Przybos´, E., Prajer, M., Greczek-Stachura, M., Skotarczak, B., Maciejewska, A., Tarcz, S., 2007. Genetic analysis of the Paramecium aurelia species complex (Protozoa: Ciliophora) by classical and molecular methods. Syst. Biodivers. 5, 417–434. Przybos´, E., Tarcz, S., Greczek-Stachura, M., Surmacz, M., 2011a. Seasonal and spatial variability of species occurrence of the Paramecium aurelia complex in a single natural pond (Protista, Ciliophora). Hydrobiologia 663, 233–244. Przybos´, E., Tarcz, S., Potekhin, A., Rautian, M., Prajer, M., 2011b. A two-locus molecular characterization of Paramecium calkinsi. Protist. doi:10.1016/ j.protis.2011.06.006. Ronquist, F., Huelsenbeck, J.P., 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572–1574. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425. Sonneborn, T.M., 1957. Breeding systems, reproductive methods, and species problems in protozoa. In: Mayr, E. (Ed.), The Species Problem. AAAS, Washington, pp. 155–324. Sonneborn, T.M., 1970. Methods in Paramecium research. In: Prescott, D.M. (Ed.), Methods Cell Physiology, vol. 4. Academic Press, New York; London, pp. 242– 339. Sonneborn, T.M., 1975. The Paramecium aurelia complex of fourteen sibling species. Trans. Am. Micros. Soc. 94, 155–178. Stoeck, T., Przybos´, E., Schmidt, H.J., 1998. Combination of genetics with inter-and intra-strain crosses and RAPD-fingerprints reveals different population structures within the Paramecium aurelia species complex. Eur. J. Protistol. 34, 348–355. Stoeck, T., Welter, H., Seitz-Bender, D., Kusch, J., Schmidt, H.J., 2000. ARDRA and RAPD-fingerprinting reject the sibling species concept for the ciliate Paramecium caudatum (Ciliophora, Protista). Zool. Scr. 29, 75–82. Strüder-Kypke, M.C., Lynn, D.L., 2010. Comparative analysis of the mitochondrial cytochrome c oxidase subunit I (COI) gene in ciliates (Alveolata, Ciliophpra) and evaluation of its suitability as a biodiversity marker. Syst. Biodivers. 8, 131–148. Tamura, K., Nei, M., Kumar, S., 2004. Prospects for inferring very large phylogenies by using the neighbor-joining method. Proc. Natl. Acad. Sci. USA 101, 11030– 11035. Tamura, K., Dudley, J., Nei, M., 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599. Tarcz, S., 2011. Molecular polymorphism of Paramecium aurelia species complex (Ciliophora, Protozoa) inferred from analysis of ribosomal and mitochondrial DNA variation. In: GDRE International Meeting Paramecium Genome Dynamics and Evolution, Roscoff (France), May 7–11. Tarcz, S., Przybos´, E., Prajer, M., Greczek-Stachura, M., 2006. Intraspecific variation of diagnostic rDNA genes in Paramecium dodecaurelia, P. tredecaurelia and P. quadecaurelia (Ciliophora, Oligohymenophorea). Acta Protozool. 45, 255–263. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific penalties and weight matrix choice. Nucl. Acids Res. 22, 4673–4680. Vivier, E., 1974. Morphology, taxonomy and general biology of the genus Paramecium. In: Wagtendonk, W.I. (Ed.), Paramecium, A Current Survey. Elsevier, Amsterdam, pp. 1–89. Wenrich, D.H., 1928. Paramecium woodruffi nov. Spec. (Ciliata). Trans. Am. Microsc. Soc. 47, 256–261. Wichterman, R., 1953. The Biology of Paramecium. The Blakiston Company, New York; Toronto. Wichterman, R., 1986. The Biology of Paramecium, second ed. Plenum Press, New York; London.
