Microbes and Infection 8 (2006) 332–339 www.elsevier.com/locate/micinf
Original Article
Two clones obtained from Urabe AM9 mumps virus vaccine differ in their replicative efficiency in neuroblastoma cells Gerardo Santos-López a,b, Carlos Cruz a, Nidia Pazos c, Verónica Vallejo b Julio Reyes-Leyva b,*, José Tapia-Ramírez a,* a
Departamento de Genética y Biología Molecular, Centro de Investigación y Estudios Avanzados del IPN (Cinvestav), Av. Instituto Politécnico Nacional 2508 Col. San Pedro Zacatenco CP 07360. México DF, Mexico b Lab. de Virología, Centro de Investigación Biomédica de Oriente, Instituto Mexicano del Seguro Social, Hospital General de Zona No. 5, Km. 4.5 Carretera Federal Atlixco-Metepec, 74360 Metepec, Pue, Mexico c Departamento de Microbiología, Fac. de Ciencias Químicas, Benemérita Universidad Autónoma de Puebla, 14 Sur y San Claudio, Jardines de San Manuel, 72570 Puebla, Pue., Mexico Received 28 January 2005; accepted 27 June 2005 Available online 18 October 2005
Abstract A high rate of post-vaccinal aseptic meningitis for Urabe AM9 mumps virus strain is well documented. This strain is composed of two virus variants differing at the nt 1081 (A/G) region in the hemagglutinin-neuraminidase (HN) gene. An association of HN-A1081 variant with neurovirulence has been proposed. In order to test for neurotropism we isolated the HN-A1081 and HN-G1081 virus variants from Urabe AM9 mumps virus vaccine. Sequential passages were performed in monkey kidney Vero cells and human neuroblastoma SH-SY5Y cells. Viral replication was determined by conventional and real-time RT-PCR. The results show that clone HN-A1081 can replicate efficiently in both cell types. However, a defective replication of clone HN-G1081, lacking its genetic marker, was observed after the third passage in neuroblastoma cells. Kinetics assays showed that clone HN-A1081 replicates faster than clone HN-G1081. Viral clones were also inoculated into the brains of newborn rats. Clone HNA1081 replicated 14 times, while clone HN-G1081 merely duplicated its level over the initial inoculum. These results suggest that there is a selective replication of HN-A1081 mumps virus variants in cells of nervous origin. © 2005 Elsevier SAS. All rights reserved. Keywords: Hemagglutinin-neuraminidase; Mumps virus; Neurovirulence; Vaccine; Point mutation; Replication; Real-time-RT-PCR
1. Introduction The mumps virus is a member of the Paramyxoviridae family and Rubulavirus genus and as such possesses a 15.3 kb non-segmented, negative-strand RNA that forms a helical nucleocapsid within a lipid envelope. Mumps virus produces an acute systemic infection involving glandular, lymphoid and
Abbreviations: CNS, central nervous system; DMEM, Dulbecco’s minimum essential medium; FBS, fetal bovine serum; HN, hemagglutinin-neuraminidase; MOI, multiplicity of infection; PFU, plaque forming units; PI, post infection. * Corresponding authors. E-mail addresses:
[email protected] (J. Reyes-Leyva),
[email protected] (J. Tapia-Ramírez).
1286-4579/$ - see front matter © 2005 Elsevier SAS. All rights reserved. doi:10.1016/j.micinf.2005.06.031
nervous tissues [1,2]. Before the introduction of live attenuated virus vaccines, mumps virus was the main cause of virus-induced disease in the central nervous system (CNS) in children [3,4]. The main CNS complication of mumps virus infection is aseptic meningitis although it is also associated with encephalitis, hydrocephalus and deafness [1,2,4]. Although vaccination programs have decreased the incidence of mumps virus infection worldwide, outbreaks have not been completely eliminated [5–8]. Mumps virus infections in vaccinated people may arise either by infection with wildtype virus, following primary vaccine failure (e.g. Rubini strain) [4,6], or as a result of inoculation by a relatively neurovirulent vaccine (e.g. Urabe AM9, Leningrad-3 and L-Zagreb strains) [4,7–15]. A high incidence of post-vaccinal aseptic me-
G. Santos-López et al. / Microbes and Infection 8 (2006) 332–339
333
ningitis has been associated with the Urabe AM9 strain [4,7,10, 11,14]. This vaccine strain possesses a mixture of two virus variants that differ at nucleotide 1081 (G/A) in the hemagglutinin-neuraminidase (HN) gene [11], the mutation comprising an amino acid exchange (Glu to Lys) at position 335 of the HN glycoprotein. Comparison of HN gene sequences amongst several vaccine and wild-type mumps virus strains has led to the identification of an association of HN-A1081 with neurovirulence [11,16]. It has been proposed that a selection process favors the replication of the HN-A1081 virus variant in human CNS. In order to support this hypothesis, Brown et al. [11] attempted to reproduce a selection event with Urabe AM9 mumps virus variants, using Vero cell cultures as a model. However, they obtained contradictory results in that there was a selection of the “attenuated” variant HN-G1081. Other studies do not support an association of virulence with the presence of either A or G at the nt 1081 region of the HN gene [17]. Although Vero cells are considered a good substrate for mumps virus replication [18] they are an inappropriate model for the study of neurovirulence. In this study, we isolated the two variants of the Urabe AM9 mumps viral strain, showing that only the HN-A1081 virus variant replicates efficiently in both human neuroblastoma cells and in newborn rat brain.
SBL985 (5′-GACAATATCTCCATCTGG-3′) and SBL1384 (5′-ATAGAGAGAGTTCATAGGG-3′). Pure water and total RNA from non-infected cells were used as negative controls in the RT-PCR assays. The 428 bp resultant product was cleaved by the MseI endonuclease (Invitrogen, Ca., USA), as reported. The HN-A1081 variant possesses two restriction sites for the MseI endonuclease that elicit three products of 266, 133 and 29 bp, while HN-G1081 variant possesses just one restriction site that elicits two products of 266 and 162 bp.
2. Material and methods
2.4. Serial passages in cell cultures
2.1. Viruses and cells
HN-A1081 and HN-G1081 viral clones were inoculated into Vero and SH-SY5Y cells at a multiplicity of infection (MOI) of 0.02. Re-inoculation of fresh cultures was carried out at 48 h post-infection (PI) with 10% of the infected cell supernatant volume. Viral replication and preservation of the virus genotype was confirmed by RT-PCR and MseI endonuclease digestion assays after each cell passage, as described previously in [11]. The cyclophilin (CP) housekeeping gene was included to validate the efficiency of the amplification reaction.
Urabe AM9 mumps viral vaccine lot MP47D41C (Smith Kline Beecham Laboratories, London, UK) was obtained from commercially available lots distributed in Mexico in 1999. Virus was replicated in green monkey kidney Vero and CV1P cell lines and also in human neuroblastoma SH-SY5Y cells. Cells were maintained in high glucose Dulbecco´s minimum essential medium (DMEM) (Sigma Chemicals, San Luis Mo., USA) supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin and 100 mg/ml streptomycin. Non-essential amino acids and 8 mM sodium pyruvate were added to the medium used for SH-SY5Y cell cultures. 2.2. Viral clone isolation In order to separate HN-A1081 and HN-G1081 viruses, the Urabe AM9 strain was allowed to progress through three subsequent passages in CV-1P cells, overlaid with 0.9% noble agar in DMEM supplemented with 2.5% FBS. Several lytic plaques were selected for each passage after 4–6 days of incubation and the contained virus were characterized by reverse transcription followed by polymerase chain reaction (RT-PCR). The presence of A or G at the nt 1081 region of the HN gene was determined by restriction fragment length polymorphism (RFLP) assays [11]. Briefly, 30 ng of total RNA purified from virus-infected cells was subjected to RT-PCR using the primers
2.3. Cloning and sequencing of HN gene The HN gene of both HN-A1081 and HN-G1081 clones was amplified by RT-PCR using the primers HNVP1 (5´-GAAA GATGGAGCCCTCAA-3´) and HNVP2 (5´-AGATTGAAG CACGCCCAT-3´), which produce a 1799 bp fragment that contains the complete open reading frame between nucleotides 85 and 1887 of the HN gene of Urabe AM9 mumps virus strain (GeneBank accession no. X99040). The RT-PCR products were cloned into the pCR2.1TOPO vector according to the manufacturer´s instructions (Invitrogen). Cloned products were sequenced for three rounds with M13+, M13- primers (included in the pCR2.1-TOPO kit) and SBL1384 primer, using the Big Dye 2.0 kit and an automatic sequencer (Applied BioSystems, USA).
2.5. Real time RT-PCR Two PCR primers and two TaqMan fluorescent probes were designed to discriminate A or G nt at 1081 position. The primers HNVP-1081F (GGGTGTCTTGCCCAATAGTACA) and HNVP-1081R (GGATTAACAGGCCGGAAA AATTCTC) amplify a 66 bp product. The fluorescent 3′ minor groove binding DNA probes were designed with two different dyes (VIC and FAM) to allow the allelic discrimination by a single nucleotide polymorphism assay. Probe HNVP-1081V1 ([VIC]TCGGAGTTAAATCAG-[NFQ]) specifically recognizes the HN-A1081 genotype, while the probe HNVP-1081M1 ([FAM]-TCGGAGTTGAATCAG-[NFQ]) recognizes the HNG1081 genotype. The TaqMan One-Step RT-PCR Master Mix Reagent kit, containing 0.9 μM of each primer, 0.2 μM of each probe and 50 ng of sample RNA was used at 25 μl per tube, and the amplification reaction was performed using the ABI
334
G. Santos-López et al. / Microbes and Infection 8 (2006) 332–339
Prism 7000 Sequence Detection System (Applied Biosystems). Cycling conditions were as follows: 30 min at 48 °C, 10 min at 95 °C, and 40 cycles of 15 s at 95 °C followed by 1 min at 60 ° C. RNA from non-infected cells was used as a negative control and purified HN-A and HN-G viruses were used as positive controls. Primers and VIC-labeled probes for the 18S ribosomal RNA were included to validate the efficiency of the amplification reaction. 2.6. Virus titration Viruses in infected cell supernatants were quantified by standard plaque assays in CV-1P cells overlaid with noble agar and results reported as plaque forming units per ml (PFU/ml). 2.7. Viral replication kinetics HN-A1081 and HN-G1081 clones were inoculated in Vero and SH-SY5Y cells cultured in 24-well plates at an MOI of 0.02, supernatants were extracted every 24 h over 5 days and then analyzed by plaque assay in CV-1P cells. 2.8. Neurovirulence test in neonatal rats 200 PFU in a 10 μl total volume of either HN-A1081 or HNG1081 viruses were intracerebrally inoculated into 1-day-old Wistar rats (N = 8 for each strain) and eight newborn rats inoculated with 10 μl DMEM were included as negative controls. Rats were sacrificed at 0, 2 and 4 days PI and brains were extracted and homogenized in DMEM to determine virus titers using the plaque assay [19]. Samples of homogenized brain tissue were used to identify the virus genotype by conventional RT-PCR. 2.9. Statistical analysis Analysis of variance (ANOVA) was performed to compare the HN-A1081 and HN-G1081 virus titers obtained in cell lines and neonatal rat model infection assays. The titers are reported as means ± standard error; the significance values were assigned for P < 0.05.
Fig. 1. Variants in the Urabe AM9 mumps virus vaccine. Vaccine virus was inoculated in Vero (A) and SH-SY5Y cells (B); supernatants were extracted at 48 h PI and re-inoculated thrice in fresh cell cultures. Thirty nanograms total RNA was recovered from infected cells to amplify a 428 bp HN gene fragment by RT-PCR, which was cleaved with MseI endonuclease, the resulting 162 and 133 bp bands indicating the presence of HN-G1081 and HN-A1081 virus variants, respectively. 1–4 indicate passage number. Lane 5 is the non-cleaved RT-PCR product.
passages in Vero cells. However, as viruses passed through these cells the HN-G variant (162 bp product) replication level increased while the HN-A variant (133 bp product) level decreased. In contrast, the HN-A1081 viral variant was preferentially replicated in human neuroblastoma cell cultures, confirmed by an increase in the 133 bp product being observed (Fig. 1B). A competitive event may have occurred between the virus variants since an increase in one appeared to be coupled with a decrease in the other. 3.2. Isolation of HN-A and HN-G viral clones Several viral clones were isolated from Urabe AM9 mumps virus vaccine by plaque assays on monkey kidney cells. Based on the above-mentioned results and considering the plaque size as a direct result of virus replication, we did a first selection; HN-G candidate viruses, producers of large plaques (high replication level; size: 1 ± 0.2 mm), and HN-A candidate viruses producers of small plaques (low replication level; size: 0.6 ± 0.15 mm). Once the third passage was completed the HN genotype of several candidate viruses was determined by RT-PCR/MseI restriction assay and direct cDNA sequencing. Based on genotype purity we selected two viral clones, termed HN-A1081 and HN-G1081. 3.3. HN gene sequences of Urabe AM9 clones
3. Results 3.1. Viral composition of Urabe AM9 vaccine Urabe AM9 mumps viral vaccine was sequentially passed through Vero and SHSY5Y cells, the virus genotype was analyzed by conventional RT-PCR and MseI endonuclease restriction assays. We were able to confirm that this vaccine possesses a mixture of virus variants with A or G at nt 1081 of HN gene. Fig. 1A shows that the HN-A variant replicated more efficiently than the HN-G variant at the first
The HN gene from HN-A1081 and HN-G1081 viruses was cloned into the pCR2.1TOPO vector originating pCRU-HNA1081 and pCRU-HN-G1081 plasmids. The sequence of the HN gene from HN-A1081 clone is identical to that of the prototype Urabe AM9 mumps virus strain (GeneBank accession No. X99040), except for the A at nt1081, that appears as R in GeneBank. The HN gene sequence of the HN-G1081 clone, possessed two silent mutations (T→C) at nt 786 and 1347, in addition to a G at nt 1081,. Therefore the amino acid sequence of HN proteins of both viral clones were identical except for
G. Santos-López et al. / Microbes and Infection 8 (2006) 332–339
335
the difference at amino acid 335, which corresponds to Lys in HN-A1081 and Glu in HN-G1081 viruses.
obtained, thus confirming that only the HN-A1081 virus replicates efficiently in neuroblastoma cells (not shown).
3.4. Selective replication of HN-A1081 virus variant in neuroblastoma cells
3.5. Genotype discrimination by real time-RT-PCR
Purified HN-A1081 and HN-G1081 virus variants were subjected to serial passages in Vero and SH-SY5Y cells. Considering the HN gene amplification product as a positive indication of virus replication, and the MseI endonuclease product as indicative of the virus genotype, we found that the HN-A1081 virus variant replicated efficiently in both Vero and human neuroblastoma cells, if inoculated alone (Fig. 2A and D). Although the HN-G1081 virus variant replicated efficiently in Vero cells (Fig. 2B) the replication in human neuroblastoma cells was poor and accordingly there was no RT-PCR product observed at the third passage in these cells (Fig. 2E). When the cells were inoculated with a mixture of the two purified virus variants in Vero cells the HN-G1081 variant replicated more efficiently than HN-A1081 (Fig. 3C), by contrast in SH-SY5Y cells only the HN-A1081 variant replicated (Fig. 3F). These results suggest that there is a cell type selection process occurring favoring one virus over the other. In order to investigate whether these results were a consequence of mutations in the areas of primer complementarity during the virus passage, the full-length HN gene and a fraction of the NP gene were amplified using other primer pairs. Similar results were
That a selective replication event was occurring was confirmed by means of a real time-RT-PCR assay designed to identify the polymorphism at nt 1081. Fig. 3 shows that the purified HN-A1081 virus variant efficiently replicates in Vero and neuroblastoma cells (upper group). It is important to note that infection of Vero cells with purified HN-A1081 variant resulted in a HN-G1081 signal that appeared after the fifth passage (arrow head). Although similar signals were observed in previous passages but they did not reach the threshold cycle (Ct) level. This was not observed in RFLP assays (Fig. 2A), probably due to its low sensitivity. Purified HN-G1081 variant replicates efficiently in Vero cells, but showed hardly any replication in neuroblastoma cells (Fig. 3 middle group). Infection of cells with the mixture of HN-A and HN-G virus variants confirmed a replicative selection of HN-A1081 in neuroblastoma cells and showed a more efficient replication for HN-G than HN-A in Vero cells, confirming the RFLP results. 3.6. Viral replication kinetics Virion release from infected cells was determined by plaque assays at 24 h intervals. HN-A1081 and HN-G1081 viruses
Fig. 2. Serial passage of virus variants. Purified HN-A1081 and HN-G1081 virus variants (0.02 PFU) were inoculated alone (A, B, D, E) or mixed (C, F) in Vero and SHSY5Y cells, and supernatants were re-inoculated in fresh cells at 48 h PI. Thirty nanograms of total RNA extracted from infected cells was used to amplify a 428 bp fragment of HN gene by RT-PCR and the product was cleaved by MseI endonuclease (RFLP). The resulting 133 bp band, corresponding to HN-A1081 virus variant, was always observed in Vero (A) and SH-SY5Y cells (D). The 162 bp band corresponding to HN-G1081 virus variant was observed after the five passages in Vero cells (B) but only in the first and second passage in SHSY-5Y cells (E). Note that in (E), only two lines are shown, this was due to the fact that there was no RTPCR product to make the restriction after the second passage. Selective replication of HN-G and HN-A in Vero and SHSY5Y cells, respectively, was observed (C and F). 1–5 indicate passage number.
336
G. Santos-López et al. / Microbes and Infection 8 (2006) 332–339
showed similar replication levels at start of the experiment, however, HN-G1081 virus replicates at about 1 log unit faster than HN-A1081 in Vero cells by 4 days PI (Fig. 4A). By contrast, evidence for differences in viral replication kinetics in
neuroblastoma cells was seen earlier in that HN-A1081 virus replicated at 0.7–1 log units higher than HN-G1081 at 1–2 days PI (Fig. 4B). Thus HN-A1081 virus replicates faster than HNG1081 virus in nerve cells.
Fig. 3. Genotype discrimination by real time RT-PCR. Fifty nanograms of total RNA extracted from cells infected with HN-A1081 (upper panel), HN-G1081 (central panel) or a mixture of them (lower panel), were analyzed by real time RT-PCR using a single nucleotide polymorphism assay. The blue and red curves correspond to VIC and FAM fluorescent dyes, which indicate the presence of HN-A1081 or HN-G1081 genotypes, respectively. The green line represents the Ct defined as 10 times the standard deviation of the background fluorescence intensity, which is measured between three and 15 cycles. 1–5 indicate passage number, the arrowhead indicates putative HN-G1081 in Vero cells inoculated with purified HN-A1081 variant. The lower panel shows HN-A (A) and HN-G (G) genotypes in cells infected with the mixture of virus variants.
G. Santos-López et al. / Microbes and Infection 8 (2006) 332–339
337
Fig. 4. Replicative kinetics. Vero and SH-SY5Y cells were infected at an MOI of 0.02. Infected-cell supernatants were harvested and virus titers were determined by standard plaque assays each day after infection.
3.7. Cytopathic effects Although both HN-G1081 and HN-A1081 viruses induce syncytia formation in Vero cells, HN-G1081 virus produced a twofold greater level of syncytia than did HN-A1081 (399 ± 71 vs. 201 ± 18 SFU) (Fig. 5A–C). Neither HN-A1081 or HN-G1081 viruses produced syncytia in SH-SY5Y cells (Fig. 5D–F), therefore the cytopathic effect in this kind of cells was evaluated as a monolayer lysis. Thus HN-A1081 virus caused the lysis of 60–65% of infected cells, while HN-G1081 produced lysis in only 20–30% of the neuroblastoma cells at 5 day PI. 3.8. HN-A1081 replicates in newborn rat CNS In order to confirm neurovirulence, viral clones were inoculated intracranially into newborn rats. The titers of recovered virus from infected rat brains increased from 102.44 and 102.35 PFU/g at day 0 (in rats sacrificed immediately after inoculation) to 103.58 and 102.65 PFU/g, for HN-A1081 and HN-G1081 clones, respectively, at 4 days PI (Fig. 6). HN-A1081 viruses therefore multiplied 14 times over the amount of original inoculum, eight times more than for HN-G1081 viruses, while HN-G1081 viruses only duplicated over the original inoculum. None of the mock-inoculated rats produced lytic plaques in the cell cultures. 4. Discussion A conserved point mutation (G to A) at nt 1081 of HN has been found in viruses isolated in cases of meningitis after vaccination with Urabe AM9 mumps virus. In order to know the importance of the HN1081 mutation on the infections process, we separated two virus variants of Urabe AM9, showing that HN-A1081 is better replicated than HN-G1081 in human neuroblastoma cells and newborn rat CNS. Selection of HN-A1081 variant in nervous cells was confirmed by real time RT-PCR
when the cells were infected with each variant, or with a mixture of both. It has been proposed that the HN-A1081 genotype could be considered a neurovirulence marker of Urabe AM9 mumps virus vaccines [11,16], while HN-G1081 was considered an attenuation marker [11]. Our work supports the proposal that a selection process favors the replication of HN-A1081 variant in the CNS [10,11] and that an opposite selection favors HNG1081 virus replication in Vero cells [10,11,20,21]. However, we are not in agreement with a lack of virulence of the HNG1081 variant since our kinetics assays showed that it was also replicated, albeit at a slower rate in nervous cells. Amexis et al. [17] rejected the relevance of the HN-A1081 marker, pointing out that Jeryl-Lynn and some other Urabe AM9 mumps virus vaccines that also contain 100% of the HNA1081 genotype, have never been observed to be involved in excessive adverse reactions. Jeryl-Lynn and Urabe AM9 strains differ over more than 900 nt [17], thus other molecules might determine the differences in virulence. Rubin et al. [22,23] reported the isolation of a Jeryl-Lynn-derived mumps virus variant adapted to SH-SY5Y cells (called JL-SY5Y), which produces more damage in the rat CNS than the original strain. In the case of the neuroadapted JL-SY5Y strain, changes in gene sequences were also detected in the nucleoprotein (NP), matrix (M) and polymerase (L) genes, with predicted changes in their encoding proteins [23]. Thus, other mutations presented in Urabe AM9 [16,17,21] must also contribute to its neurovirulence. Since viral neurovirulence is a complex problem that involves systemic, cellular and viral components, it cannot be simply assumed that one mutation is responsible for the neurovirulent phenotype of Urabe AM9. However this mutation could contribute to virulence in several ways, for example the presence of Lys335 not only modifies the interaction of HN with cells, but could also change the electrostatic potential around this site, modifying an antigenic determinant recognized by neutralizing antibodies. In this respect, Afzal et al. [18] found that amino acid 335 occupies an important antigenic
338
G. Santos-López et al. / Microbes and Infection 8 (2006) 332–339
Fig. 6. Replication of virus variants in newborn rat brain. One-day-old rats were inoculated with either HN-A1081 or HN-G1081 variants. Brains were extracted and viral titers were determined at 0, 2 and 4 days PI.
119); Gerardo Santos-López was supported by scholarships from CONACYT. References
Fig. 5. Cytophatic effect. Vero cells (left panel) and SH-SY5Y cells (right panel) were either not inoculated (A, D) or inoculated with 0.02 MOI of HNA1081 (B, E) and HN-G1081 (C, F) virus variants. Both viruses produce syncytia in Vero cells and lysis in SHSY5Y cells (magnification × 300).
domain in the HN glycoprotein of Urabe AM9 strain, since Glu335-containing variants were neutralized while those containing Lys335 escaped neutralization. Other work shows that a monoclonal antibody directed against a peptide containing Lys335 was able to neutralize wild type mumps viruses but it was unable to neutralize a sample of Urabe AM9 strain, the hypothesis being that the vaccine strain constituted HN-G variants [24]. These data involve characteristics not analyzed in our cell models, but they could be important in the wild type and post-vaccinal infection. Given the role of HN in the infectious process involving mumps virus it is probable that this mutation modifies either the virus affinity to cell receptors or the enzymatic activity of the HN protein. These are issues under current investigation in our laboratory. Acknowledgments This work was supported by grants from Consejo Nacional de Ciencia y Tecnología (CONACYT, 30625-M) and Fondo para el Fomento de la Investigación Médica, IMSS (FP-2002/
[1] K.M. Carbone, J.S. Wolinsky, Mumps Virus, in: D.M. Knipe, P.M. Howley (Eds.), Fields Virology, fourth ed, Lippincott, Williams & Wilkins, Philadelphia, 2001, pp. 1381–1400. [2] S.A. Plotkin, Mumps vaccine, in: S.A. Plotkin, W.A. Orenstein, P.A. Offit (Eds.), Vaccines Fourth edition, WB Saunders, Philadelphia, 2004, pp. 441–469. [3] J.C. McDonald, D.L. Moore, P. Quennec, Clinical and epidemiologic features of mumps meningoencephalitis and possible vaccine-related disease, Pediatr. Infect. Dis. J. 8 (1989) 751–755. [4] A.M. Galazka, S.E. Robertson, A. Kraigher, Mumps and mumps vaccine: a global review, Bull WHO 77 (1999) 3–14. [5] J.M. Echeverria, F. de Ory, C. Echeverria, A. Lozano, A. Tenorio, Reemergencia de la meningitis linfocitaria aguda por virus de la parotiditis en España, Enferm. Infecc. Microbiol. Clin. 17 (1999) 373–374. [6] K.T. Goh, Resurgence of mumps in Singapore caused by the Rubini mumps virus vaccine strain, Lancet 354 (1999) 1355–1356. [7] J. Dourado, S. Cunha, M.G. Teixeira, C.P. Farrington, A. Melo, R. Lucena, M.L. Barreto, Outbreak of aseptic meningitis associated with mass vaccination with a Urabe-containing measles–mumps–rubella vaccine: Implications for immunization programs, Am. J. Epidemiol. 151 (2000) 524–530. [8] C.M. Nascimento-Carvalho, O.A. Moreno-Carvalho, Frequency of lymphocytic meningitis associated with mumps before and after a mass campaign for mumps vaccination in children from Salvador, Northeast Brazil. Arq. Neuropsiquiatr. 61 (2003) 728–730. [9] M. Cizman, M. Mozetic, R. Radescek-Rakar, D. Pleterski-Rigler, M. Susec-Michieli, Aseptic meningitis after vaccination against measles and mumps, Pediatr. Infect. Dis. J. 8 (1989) 302–308. [10] E.G. Brown, J. Furesz, K. Dimock, W. Yarosh, G. Contreras, Nucleotide sequence analysis of Urabe mumps vaccine strain that caused meningitis in vaccine recipients, Vaccine 9 (1991) 840–842. [11] E.G. Brown, K. Dimock, K.E. Wright, The Urabe AM9 mumps vaccine is a mixture of viruses differing at amino acid 335 of the hemagglutininneuraminidase gene with one form associated with disease, J. Infect. Dis. 174 (1996) 619–622. [12] M.G. Cusi, P. Correale, M. Valassina, M. Sabatino, P.E. Valensin, M. Donati, R. Gluck, Comparative study of the immune response in mice im-
G. Santos-López et al. / Microbes and Infection 8 (2006) 332–339
[13]
[14]
[15]
[16]
[17]
[18]
munized with four live attenuated strains of mumps virus by intranasal or intramuscular route, Arch. Virol. 146 (2001) 1241–1248. W.O. Arruda, C. Kondageski, Aseptic meningitis in a large MMR vaccine campaign (590,609 people) in Curitiba, Parana, Brazil, 1998, Rev. Inst. Med. Trop. Sao Paulo 43 (2001) 301–302. F. Lista, G. Faggioni, M.S. Peragallo, F. Tontoli, A. Stella, P. Salvatori, M. Pusino, M.A. Germani, V. Contreas, R. D’Amelio, Molecular analysis of early postvaccine mumps-like disease in Italian military recruits, JAMA 287 (2001) 1114–1115. S.S. da Cunha, L.C. Rodrigues, M.L. Barreto, I. Dourado, Outbreak of aseptic meningitis and mumps after mass vaccination with MMR vaccine using the Leningrad-Zagreb mumps strain, Vaccine 20 (2002) 1106– 1112. M.G. Cusi, L. Santini, S. Bianchi, M. Valassina, P.E. Valensin, Nucleotide sequence at position 1081 of the Hemagglutinin-neuraminidase gene in wild-type strains of mumps virus is the most relevant marker of virulence, J. Clin. Microbiol. 36 (1998) 3743–3744. G. Amexis, N. Fineschi, K. Chumakov, Correlation of genetic variability with safety of mumps vaccine Urabe AM9 strain, Virology 287 (2001) 234–241. M.A. Afzal, V. Dussupt, P.D. Minor, P.A. Pipkin, R. Fleck, D.J. Hockley, G.N. Stacey, Assessment of mumps virus growth on various continuos
[19]
[20]
[21]
[22]
[23]
[24]
339
cell lines by virological, immunological, molecular and morphological investigations, J. Virol. Methods 126 (2005) 149–156. S.A. Rubin, M. Pletnikov, R. Taffs, P.J. Snoy, D. Kobasa, E.G. Brown, K.E. Wright, K.M. Carbone, Evaluation of a neonatal rat model for prediction of mumps virus neurovirulence in humans, J. Virol. 74 (2000) 5382–5384. C. Mori, T. Tooriyama, T. Imagawa, K. Yamanishi, Nucleotide sequence at position 1081 of the hemagglutinin-neuraminidase gene in the mumps virus Urabe vaccine strain, J. Infect. Dis. 175 (1997) 1548. M.A. Afzal, P.J. Yates, P.D. Minor, Nucleotide sequence at position 1081 of the Hemagglutinin-neuraminidase gene in the mumps Urabe vaccine strain, J. Infect. Dis. 177 (1998) 265–266. S.A. Rubin, M. Pletnikov, K.M. Carbone, Comparison of the neurovirulence of a vaccine and a wild-type mumps virus strain in the developing rat brain, J. Virol. 72 (1998) 8037–8042. S.A. Rubin, G. Amexis, M. Pletnikov, Z. Li, J. Vanderzanden, J. Mauldin, C. Sauder, T. Malik, K. Chumakov, K.M. Carbone, Changes in mumps virus gene sequence associated with variability in neurovirulent phenotype, J. Virol. 77 (2003) 11616–11624. M.G. Cusi, S. Fisher, R. Sedlmeier, M. Valassina, P.E. Valensin, M. Donati, W.J. Neubert, Localization of a new neutralizing epitope on the mumps virus hemagglutinin-neuraminidase protein, Virus Res. 74 (2001) 133–137.
