Triatoma virus structural polyprotein expression, processing and assembly into virus-like particles

Journal of General Virology (2015), 96, 64–73

DOI 10.1099/vir.0.071639-0

Triatoma virus structural polyprotein expression, processing and assembly into virus-like particles Rube´n Sa´nchez-Eugenia,1 Fernando Me´ndez,2 Jailson F. B. Querido,1,3,4 Marcelo Sousa Silva,4,5 Diego M. A. Gue´rin1,6 and Jose´ F. Rodrı´guez2 Correspondence Diego M. A. Gue´rin [email protected] Jose´ F. Rodrı´guez [email protected]

1

Unidad de Biofı´sica (CSIC, UPV/EHU), Barrio Sarriena S/N, 48940 Leioa, Bizkaia, Spain

2

Departamento de Biologı´a Molecular y Celular, Centro Nacional de Biotecnologı´a-CSIC, Darwin 3, 28049 Madrid, Spain

3

Fundacio´n Biofı´sica Bizkaia, Barrio Sarriena S/N, 48940 Leioa, Bizkaia, Spain

4

Centro de Mala´ria e Outras Doenc¸as Tropicais, Instituto de Higiene e Medicina Tropical, Universidade Nova de Lisboa, Rua da Junqueira, 100, 1349-008 Lisboa, Portugal

5

Departamento de Bioquı´mica, Universidade Federal do Rio Grande do Norte, Natal, Brazil

6

Departamento de Bioquı´mica y Biologı´a Molecular, Facultad de Ciencia y Tecnologı´a, Universidad del Paı´s Vasco (EHU), Barrio Sarriena S/N, 48940 Leioa, Bizkaia, Spain

Received 11 September 2014 Accepted 7 October 2014

In contrast to the current wealth of structural information concerning dicistrovirus particle structure, very little is known about their morphogenetic pathways. Here, we describe the expression of the two ORFs encoded by the Triatoma virus (TrV) genome. TrV, a member of the Cripavirus genus of the Dicistroviridae family, infects blood-sucking insects belonging to the Triatominae subfamily that act as vectors for the transmission of Trypanosoma cruzi, the aetiological agent of the Chagas disease. We have established a baculovirus-based model for the expression of the NS (non-structural) and P1 (structural) polyproteins. A preliminary characterization of the proteolytic processing of both polyprotein precursors has been performed using this system. We show that the proteolytic processing of the P1 polyprotein is strictly dependent upon the coexpression of the NS polyprotein, and that NS/P1 coexpression leads to the assembly of virus-like particles (VLPs) exhibiting a morphology and a protein composition akin to natural TrV empty capsids. Remarkably, the unprocessed P1 polypeptide assembles into quasispherical structures conspicuously larger than VLPs produced in NS/P1-coexpressing cells, likely representing a previously undescribed morphogenetic intermediate. This intermediate has not been found in members of the related Picornaviridae family currently used as a model for dicistrovirus studies, thus suggesting the existence of major differences in the assembly pathways of these two virus groups.

INTRODUCTION The Dicistroviridae family clusters a group of small picornavirus-like viruses harbouring positive-strand (+) ssRNA genomes characterized by the possession of two nonoverlapping cistrons or ORFs (Mayo, 2002). This family belongs to the Picornavirales order, and currently encompasses 15 characterized species grouped in two genera, Aparavirus and Cripavirus (Le Gall et al., 2008). Some dicistroviruses, e.g. Acute bee paralysis virus, are highly pathogenic to beneficial arthropods (Genersch & Aubert, 2010; de Miranda et al., 2010; Wertheim et al., 2009). Other family members, e.g. Drosophila C virus, have been used as models for characterizing antiviral defence mechanisms in insects (Kingsolver et al., 2013). Additionally, some dicistroviruses like Solenopsis invicta virus-1 and Triatoma 64

virus (TrV), the object of the present report, are highly relevant for human health (Bonning & Miller, 2010). A salient feature of dicistroviral genomes is the presence of two independent internal ribosome entry sites (IRES) located immediately upstream of each cistron (Czibener et al., 2005). A schematic representation showing the major elements of the Dicistroviridae genome is presented in Fig. 1. TrV ORF 1 is located at the 59-genome end and encodes a polyprotein with an estimated molecular size of 204 kDa, known as NS, harbouring the non-structural virus proteins, i.e. helicase, protease and RNA-dependent RNA polymerase (RdRp) (Czibener et al., 2000). Positions of the NS cleavage sites have been experimentally mapped only in Plautia Stali intestine virus (PSIV), another member of the Dicistroviridae family, and it turned out that the 071639 G 2015 The Authors

Printed in Great Britain

TrV gene expression and VLP assembly

processing gives rise to nine different products comprising one helicase, one protease, multiple VPgs (genome-linked virus proteins), one RdRp and other unidentified proteins (Nakashima & Ishibashi, 2010; Nakashima & Nakamura, 2008; Nakashima & Shibuya, 2006). TrV ORF 2 occupies the 39-genome region and encodes a polyprotein, known as P1, with a predicted Mr of 95.5 kDa. P1 is the precursor of the TrV structural proteins, i.e. VP0 (37.3 kDa), VP1 (29.7 kDa) and VP2 (28.4 kDa). VP0 is further processed releasing the VP3 (31.8 kDa) and VP4 (5.5 kDa) polypeptides (Agirre et al., 2011; Czibener et al., 2000). TrV infects several insect species belonging to the Triatominae subfamily (Hemiptera: Reduviidae) commonly known as triatomines or kissing bugs (Marti et al., 2013; Muscio et al., 1988). Triatomines are blood-sucking insects acting as the chief vectors for the transmission of Trypanosoma cruzi, a protozoan responsible for the Chagas disease (American Trypanosomiasis) (Grayson, 2010). TrV is transmitted both horizontally and vertically causing lethal and sublethal effects. This, together with the narrow host range of the virus that precludes the infection of mammalian species (Querido et al., 2013), has raised a growing interest in the use of TrV as a promising biological agent to control the spreading of Chagas disease vectors (Susevich et al., 2012; Bonning & Miller, 2010; Czibener et al., 2000; Muscio et al., 1997). The capsid structures of two dicistroviruses, TrV and Cricket paralysis virus (CrPV), have been characterized at the atomic level (Squires et al., 2013; Tate et al., 1999). These capsids are naked icosahedrons (T53 symmetry) built by 60 copies of each of the three major structural proteins VP1–3 (all folded with a jelly roll core). Both TrV and CrPV capsids are quite similar (Squires et al., 2013), ss(+)RNA Genome

Cloned cDNAs

5′

ORF 1

ORF 2

(549–5936)

Helicase Protease NS

RdRp

(6109–8715)

3′

VP2 VP0 VP1

(28.4) (37.3) (29.7)

P1

Fig. 1. Schematic representation of the TrV genome, and TrVderived cDNAs inserted into the genome of recombinant baculoviruses (rBVs). The TrV genome (9010 nt) harbours two ORFs, 1 and 2, encoding the NS and P1 polyproteins, respectively. Numbers correspond to nucleotide positions of each ORF. cDNAs versions of both TrV ORFs were generated and independently cloned into the BV genome. The organization of the different protein motifs found in NS and P1 polyproteins is indicated. The molecular size of P1-derived proteolytic processing products is indicated in kDa. Double arrows show protein regions used for the production of antibodies against the RNA-dependent RNA polymerase (RdRp) and the VP1 polypeptides. http://vir.sgmjournals.org

with the location of the VP4 peptide being the main structural difference between them (Tate et al., 1999; Squires et al., 2013). Characterization of the TrV capsid disassembly and genome release allowed us to propose a novel RNA-release mechanism for this virus (Agirre et al., 2013; Snijder et al., 2013) that differs from those proposed for members of the Picornaviridae family, i.e. Human Rhinovirus 2 (Garriga et al., 2012; Hewat et al., 2002) and Poliovirus (Bostina et al., 2011; Levy et al., 2010). Characterization of TrV gene expression has been largely hampered by the lack of cell lines supporting virus replication. To overcome this experimental limitation we have generated two recombinant baculoviruses (rBVs) independently expressing the TrV ORFs. Data presented here show that the proteolytic processing of the P1 polyprotein is strictly dependent upon coexpression of the NS polyprotein, and that coexpression of both TrV cistrons leads to the assembly of virus-like particles (VLPs) akin to natural TrV empty capsids (Agirre et al., 2011, 2013). We also demonstrate that the unprocessed form of the P1 polypeptide assembles into quasi-spherical structures larger than VLPs produced in NS/P1-coexpressing cells. Results presented here provide an important insight into the dicistrovirus molecular and structural biology, and open a new venue for the characterization of the TrV assembly pathway.

RESULTS Expression of recombinant TrV ORFs 1 and 2 in insect cells In order to assess the expression of TrV-encoded polypeptides, two rBVs, BV_NS and BV_P1, containing TrV ORF 1 and 2 respectively, were generated as described in the Methods section. As a first approach to assess the expression TrV ORFs 1 and 2, H5 monolayers grown in glass coverslips were infected using an m.o.i. of 0.3 p.f.u. per cell of either WT BV (BV_WT), BV_NS or BV_P1. Some cultures were coinfected with both BV_NS and BV_P1 also using an m.o.i. of 0.3 p.f.u. of each virus. The m.o.i. used for these experiments was to allow a proper scrutiny of the specificity of the used sera by having both infected and uninfected, as well as single and double infections, in every sample under analysis. At 48 h post-infection (p.i.), cultures were processed for immunofluorescence (IF) using sera against the RdRp and VP1 domains of the NS and P1 precursor polypeptides, respectively. As shown in Fig. 2(a, b), cells infected with either BV_NS or BV_P1 exhibited specific IF signals that in both cases were strictly restricted to the cytoplasm of rBV-infected cells. It is noteworthy that coinfected cultures showed the presence of both RdRp- and VP1-specific IF signals in a significant number of cells (Fig. 2c), thus showing that both protein precursors are efficiently coexpressed at a 65

R. Sa´nchez-Eugenia and others (a)

WT

NS

(b)

WT

P1

(c)

NS

P1

polypeptides in rBV-infected cells. However, Western blotting performed with the anti-RdRp serum revealed the presence of three immunoreactive bands with estimated Mr of y110, 90 and 63 kDa in samples from cells infected with BV_NS or coinfected with BV_NS and BV_P1 (Fig. 3b). The Mr of the smallest product is comparable to that reported (62 kDa) for the PSIV RdRp (Le Gall et al., 2008), thus possibly corresponding to the mature form of the TrV RdRp polypeptide. It seems likely that the two larger products might correspond to NS processing intermediates. A band matching the Mr of the full-length NS precursor was not detected. These data indicate that the NS protease domain efficiently directs the self-cleavage of its precursor polypeptide.

NS+P1

Fig. 2. Expression of NS and P1 polyproteins in H5 insect cells. (a) Digital confocal images of H5 cells infected with BV_WT (WT) or BV_NS (NS). Cells were processed for immunofluorescence using rabbit anti-RdRp serum followed by incubation with goat anti-rabbit Ig coupled to Alexa 488 (green). (b) Digital confocal images of H5 cells infected with BV_WT (WT) or BV_P1 (P1) incubated with rabbit anti-VP1 serum followed by incubation with goat anti-rabbit Ig coupled to Alexa 488 (green). (c) Images from H5 cells coinfected with BV_NS and BV_P1. Cells were incubated with rabbit anti-RdRp (NS) and mouse anti-VP1 (P1) sera followed by incubation with goat anti-rabbit Ig coupled to Alexa 594 (red) and goat anti-mouse Ig coupled Alexa 488 (green). Bars, 10 mm. In all cases, cell nuclei were stained with DAPI (blue).

single cell level. The specificity of the anti-RdRp and -VP1 polyclonal sera used for these experiments was further confirmed by the absence of significant IF signal in cells infected with the BV_WT control virus. To further characterize the expression of both TrV ORFs 1 and 2, a series of Western blot analyses were performed. For this, H5 cultures infected with BV-WT, BV_NS or BV_P1 at an m.o.i. of 2 p.f.u. per cell, or coinfected with both BV_NS and BV_P1 using a m.o.i. of 2 p.f.u. per cell of each virus, were harvested at 48 h p.i., and the corresponding extracts subjected to SDS-PAGE followed by Coomassie blue staining or Western blotting against the RdRp or VP1 polypeptides, respectively. As shown in Fig. 3(a), specific NS- or P1-derived polypeptides were not readily detectable in Coomassie blue-stained gels, thus suggesting a moderate expression of both recombinant 66

The anti-VP1 serum identified a major polypeptide with an electrophoretic mobility of y95 kDa, akin to that expected for the unprocessed form of the P1 polyprotein (Czibener et al., 2000), in extracts from cells infected with BV_P1 (Fig. 3c). The faint ladder of faster-migrating polypeptide also detected in this sample might represent P1 degradation products (Fig. 3c). It is noteworthy that the anti-VP1 serum recognized two protein products in extracts from cells coinfected with BV_NS and BV_P1; a major species corresponding to a polypeptide of y29 kDa, similar to the mature VP1 polypeptide found in natural TrV capsids (Agirre et al., 2011; Czibener et al., 2000), and a minor one, comigrating with the intact P1 product detected in cells infected with BV_P1 alone, thus likely corresponding to the unprocessed form of the P1 protein (Fig. 3c). This observation indicates that the NS-encoded protease specifically cleaves the P1 product rendering a VP1 polypeptide of the expected Mr. Proteolytic processing of NS and P1 precursor polypeptides To further characterize the processing of TrV precursor polyproteins, an immunoprecipitation (IP) analysis was performed using extracts from 35S-methionine-labelled rBV-infected cells. Two sets of H5 monolayers were infected with BV-WT, BV_NS or BV_P1 at an m.o.i. of 2 p.f.u. per cell, or coinfected with both BV_NS and BV_P1 using a m.o.i. of 2 p.f.u. per cell of each virus. At 48 h p.i. cells were labelled for 1 h with 35S-methionine. The first culture set was collected immediately after the labelling period whilst the second one was further incubated in medium containing a 10-fold excess of cold methionine for 12 h. Samples were processed for IP analysis. As shown in Fig. 4(a), no obvious differences were detected between the total radioactive polypeptide patterns from BV_WT- and BV_NS-infected cells. However, a distinctive band of a y95 kDa was clearly detectable on extracts from cells infected with BV_P1 or coinfected with BV_NS and BV_P1. In agreement with Western blot results, the IP performed with the anti-RdRp serum specifically recognized three polypeptides with electrophoretic mobilities of y110, 90 and 63 kDa, respectively, in extracts from both cultures Journal of General Virology 96

TrV gene expression and VLP assembly

(a) Mr 200

WT

NS

P1

NS + P1

(b) TrV

Mr 200

WT

NS

P1

NS + P1

(c) TrV

Mr 200

150

150

150

100

100

100

75

75

50

50

WT

NS

P1

NS + P1

TrV

75 50 37

37

37 25 20

25 25

Fig. 3. SDS-PAGE and Western blot analysis of NS and P1 expression in H5 cells. Samples from cells infected with BV_NS (NS) or BV_P1 (P1) or coinfected with both viruses (NS+P1) were subjected to SDS-PAGE followed by Coomassie blue staining (a) or Western blotting using anti-RdRp (b) or anti-VP1 (c) antibodies. Samples from WT baculovirus-infected cells (BV-WT) and from purified TrV particles (TrV) were used as controls for these experiments. Positions of Mr markers are indicated.

infected with BV_NS either alone or coinfected with BV_P1 (Fig. 4b). Additionally, IPs carried out with this serum also rendered several faster-migrating bands. These polypeptides might represent either NS-derived degradation products or minor NS processing polypeptides. The anti-RdRp serum also rendered a weak protein band of y95 kDa in extracts from cells infected with BV_P1, suggesting a possible crossreaction of this serum with the P1 precursor. As expected, the anti-VP1 serum specifically recognized a major 95 kDa protein band in extracts from BV_P1infected cells (Fig. 4c) collected both immediately after the radioactive pulse or following the 12 h chase period. This band was also found in the sample corresponding to BV_NS/BV_P1-coinfected cells harvested immediately after labelling, but not in that collected after the chase. Interestingly, both samples from BV_NS/BV_P1-coinfected cells showed the presence of new y29 kDa protein akin to that previously detected by Western blotting (Fig. 3c). TrV VLP assembly The results described above suggested the possibility that the coexpression of both TrV cistrons might lead to the assembly of TrV-derived VLPs. To explore this hypothesis, H5 cultures were infected with BV_WT, BV_NS or BV_P1, or coinfected with BV_NS and BV_P1, fixed at 48 h p.i., and used for thin-section transmission electron microscopy http://vir.sgmjournals.org

(TEM) analysis. As shown in Fig. 5(a), the cytoplasm of y40 % cells coinfected with BV_NS and BV_P1 contained isometric particles with a morphology akin to that expected for TrV particles. Some (y10 %) of the analysed cells contained large accumulations formed by hundreds of tightly packed particles (Fig. 5b). Unexpectedly, the cytoplasm of BV_P1-infected cells also contained quasi-spherical assemblages resembling VLPs (Fig. 5c). However, their diameter was conspicuously larger than that of the isometric structures detected in NS/P1-coexpressing cells. None of these assemblages were detected in BV_NS- or BV_WT-infected cells (not shown). To further characterize the detected assemblages, extracts from cells infected with BV_NS, BV_P1, or coinfected with both rBVs were subjected to sucrose gradient fractionation. As expected, samples from BV_NS-infected cells did not contain NS-derived polypeptides, thus indicating that products released upon NS processing do not assemble into particulate structures (data not shown). In contrast, high-density fractions from cells infected with BV_P1 contained a single protein band of y95 kDa, identical to the full-length P1 polypeptide detected in extracts from BV_P1-infected cells (Fig. 6a). The identity of this protein was checked by anti-VP1 Western blot analysis. High-density fractions from gradients from cells coinfected with BV_NS and BV_P1 contained five bands of y38, 35.5, 33, 29 and 27 kDa (Fig. 6b), that likely correspond to 67

R. Sa´nchez-Eugenia and others (a) Mr

WT P

NS C

P

P1 C

P

NS+P1 C

P

C

150 100 75 50 37

25 20

15 (b) 150 100 75 50 37

25

Immunoprecipitated proteins were also subjected to SDS-PAGE analysis and autoradiography. Triangles highlight the position of distinctive immunoprecipitated protein bands. Positions of Mr markers are indicated.

the VP0, VP3, VP1 and VP2 polypeptides, respectively. The identity of the 29 kDa product was confirmed to be VP1 by Western blot analysis (Fig. 6b). The 35.5 kDa product might correspond to PP3, a non-canonical TrV polypeptide previously detected in native TrV empty particles (Agirre et al., 2011). Selected gradient fractions from P1 or NS/P1 samples were pooled and subjected to ultracentrifugation to concentrate the particulate material, and visualized by TEM. As shown in Fig. 6(c), samples from BV_P1-infected cells contained a population of quasi-spherical particles with a diameter of 52.7±4.9 nm. In contrast, samples from BV_NS/ BV_P1-coinfected cells contained isometric particles with a diameter of 30.6±1.5 nm (Fig. 6d) and an icosahedral morphology indistinguishable from that of previously described native TrV empty capsids (31.1±1.8 nm of diameter; Fig. 6e) (Agirre et al., 2011). Average yields of particles purified from cells infected with BV_P1 or coinfected with BV_P1 and BV_NS were of y65 mg/1027 cells.

20

DISCUSSION 15 (c) 150 100 75 50 37

25 20 15

Fig. 4. NS and P1 immuprecipitation. H5 cultures were infected with BV_WT (WT), BV_NS (NS) or BV_P1 (P1) or coinfected with BV_NS and BV_P1 (NS+P1). At 48 h p.i., cultures were incubated in the presence of [35S]methionine for 1 h. After this period, cultures were either harvested (P) or further incubated for 12 h in medium supplemented with a 10-fold excess of nonradioactive methionine (C). Cultures were then resuspended in RIPA buffer and either subjected to SDS-PAGE analysis and autoradiography (a) to assess total radioactive protein patterns, or immunoprecipitated using either anti-NS (b) or -P1 (c) antisera. 68

Despite the current wealth of dicistrovirus particle structure data, the assembly pathways of this virus group remain poorly understood. This is largely due to the lack of reliable molecular tools facilitating the characterization of critical events such as the processing of virus-encoded polyproteins, and the assembly of structural polypeptides. Repeated attempts to express different versions of the TrV P1 precursor polypeptide using a variety of prokaryotic vectors failed due to aggregation of P1-derived products. To overcome this problem, we decided to explore the feasibility of using rBV expression vectors. TrV protein expression and proteolytic processing in rBV-infected cells Although the described NS and P1 recombinant genes are placed under the transcriptional control of the strong BV polyhedrin promoter, data presented in this report reveal that the level of expression of the TrV-derived polypeptides is somewhat lower than expected. Indeed, attempts to enhance NS and P1 expression levels, e.g. increasing the m.o.i. of infecting rBVs and extending the length of the infection, did not significantly improve the accumulation of recombinant TrV-derived products. The reasons underlying the moderate expression levels of both polyproteins are unknown at this point. Certainly, it would be interesting to determine whether recombinant TrV genes Journal of General Virology 96

TrV gene expression and VLP assembly (a)

(b)

200 nm

200 nm

(c)

200 nm

Fig. 5. TEM analysis of H5 cells infected with rBVs. (a) Ultra-thin section of a cell coinfected with BV_NS and BV_P1. The arrow points out a cluster of isometric assemblies found at the cell cytoplasm. (b) Detail of the cytoplasm of a cell coinfected with BV_NS and BV_P1 showing a highly ordered accumulation of isometric particles. (c) Ultra-thin section of a cell infected with BV_P1. Arrows indicate the location of assemblages within the cell cytoplasm. Insets show higher magnification (!4) details of the original images.

containing their corresponding IRES sequences might boost expression levels. Western blot and pulse–chase IP-analyses of radiolabelled polypeptides showed that BV-mediated TrV ORF 1 expression led to accumulation of three NS-derived products of 110, 90 and a 63 kDa, likely corresponding to the mature RdRp. IP data also show that after their release from the precursor polyprotein, these three polypeptides are not further processed. Interestingly, a product with the molecular size expected for the full-length NS precursor was not detected by Western blot or by IP analyses. This suggests that the recombinant NS polyprotein undergoes a swift self-proteolytic processing event preventing the accumulation of the precursor. Western blot and IP data revealed that expression of the TrV ORF 2 led to the synthesis of a 95 kDa product that, according to its size, represents the unprocessed form of the P1 precursor. In the absence of ORF 1, the P1 http://vir.sgmjournals.org

polyprotein remains unprocessed. However, in cells coexpressing the ORF 1, the P1 precursor is efficiently processed rendering a y29 kDa product that, as described above, likely represents the VP1 structural polypeptide found in purified TrV virions (Agirre et al., 2011), hence evidencing the accuracy of the processing performed by the 3C-protease expressed in this system. Data presented here show that the described rBV expression vectors are a useful tool to systematically characterize the series of proteolytic processing events undergone by both TrV precursor polyproteins. Indeed, additional antibodies against other NS and P1 protein domains might shed further light on their proteolytic processing. Assembly of TrV VLPs Electron microscopy (EM) analysis of thin sections of cells coexpressing the NS and P1 by EM revealed the presence of 69

R. Sa´nchez-Eugenia and others (a)

(b)

150

250 150

150

100

100

100

75 50

150 100 75

75

75

50

50

50 37

37

VP0 PP3 VP3 VP1 VP2

37 25

25

37

Western blot

Silver staining (c)

Silver staining

(d)

200 nm

25

Western blot

(e)

200 nm

200 nm

Fig. 6. Characterization of particles isolated from P1- and P1/NS-expressing cells. Fractions collected from sucrose gradients performed with samples from cells infected with BV_P1 (a) or coinfected with BV_NS and BV_P1 (b) were subjected to SDSPAGE followed by silver staining and anti-VP1 Western blot analysis, respectively. Positions of Mr markers are indicated. Triangles indicate the increasing sucrose concentration. Analysed fractions were pooled, concentrated, spotted onto carboncoated grids and negatively stained. Particles from cells infected with BV_P1 (c) or BV_NS and BV_P1 (d) are shown. A TEM image of naturally occurring empty capsids of TrV (e) is shown for comparison. Insets show higher magnification (!2) details of the original images.

virus-like assemblies within the cell cytoplasm, thus matching the subcellular localization of the VP1 and RdRp polypeptides, as determined by confocal laser scanning microscopy. Application of a sucrose gradient-based protocol to extracts of NS/P1-coexpressing cells led to the isolation of icosahedral VLPs undistinguishable from bona fide TrV particles when observed under EM. SDS-PAGE analysis of VLP-containing gradient fractions revealed that the protein composition of the purified VLPs was akin to that of natural empty TrV particles containing the VP0– VP3 polypeptides (Agirre et al., 2011). The TrV VLP protein pattern also showed a high proportion of the VP0 precursor along with a minor relative abundance of the putative mature VP3 product. The presence of the putative VP3 polypeptide in the VLPs suggested that the VP0A VP4+VP3 TrV maturation step (Agirre et al., 2011) is not 70

directly associated with the encapsidation of the virus genome. However, the possibility that ssRNA molecules, potentially mimicking the virus genome, might be incorporated during the assembly of TrV VLPs cannot be completely ruled out at this point. The absence of non-isometric assemblages and the P1 precursor form in purified VLP preparations suggests that the low amount of unprocessed precursor remaining in initial infected-cell extracts might be completely processed by the C3 protease, also present in the extracts, during the purification procedure. Interestingly, TrV VLPs contained a minor polypeptide band exhibiting an electrophoretic mobility akin to that of the PP3 protein found in both purified TrV virions and native empty particles (Agirre et al., 2011). This finding Journal of General Virology 96

TrV gene expression and VLP assembly

constitutes an additional indication that the PP3 product is not an adventitious contaminant, and that it might play a role during particle assembly. Proteomic analysis might be instrumental in establishing the PP3 origin. Whilst this manuscript was under revision, a report describing the generation of VLPs from Israeli acute paralysis virus (IAPV), another member of the Dicistroviridae family, was published. IAPV-derived VLPs were generated in insect cells infected with an rBV expressing a chimeric gene formed by the fusion the IAPV ORF 2 in-frame that corresponds to its cognate 3C-like protease from ORF 1 (Ren et al., 2014). Unprocessed P1 precursor particle assembly Members of the Picornaviridae family have been commonly used as a model for understanding dicistrovirus molecular and structural biology. Picornavirus particle assembly and maturation has been extensively characterized using different virus models, e.g. Foot-and-mouth disease virus (Goodwin et al., 2009), Enterovirus 71 (Hu et al., 2003), Poliovirus (Hellen & Wimmer, 1992) and Rhinovirus (Palmenberg, 1990). Picornaviruses also possess (+)ssRNA genomes but, unlike dicistroviruses, they harbour a single ORF encoding all the structural and non-structural polypeptides (Tuthill et al., 2010). In most picornaviruses, genome translation gives rise to a single polyprotein that is self-processed by the 2A-proteinase domain releasing a series of polypeptides, including the P1 capsid precursor polyprotein. The 3C-proteinase processes P1 releasing the VP0, VP3 and VP1 structural polypeptides. Processed structural proteins remain associated forming a protein complex that acts as a monomer for the self-assembly of the 12 pentameric subunits that build the virus capsid (Goodwin et al., 2009; Li et al., 2012). However, if the P1 capsid precursor is not processed into individual proteins, large-sized particles are not formed (Goodwin et al., 2009). It has been generally shown that P1 cleavage precedes and is necessary for the assembly of the pentameric subunits (Tuthill et al., 2010). Unexpectedly, data presented here show that the unprocessed form of the TrV P1 precursor gives rise to nonisometric assemblages accumulating in the cell cytoplasm. These assemblages, not detected in samples from TrVinfected specimens, are conspicuously larger than natural TrV VLPs. SDS-PAGE analysis demonstrated that the purified P1-particles are exclusively built by the 95 kDa P1 precursor polypeptide, thus indicating that, in contrast to what has been found for members of the Picornaviridae family, the unprocessed TrV form of the P1 polypeptide self-assembles into a coherent large-sized structure. At this point it is not feasible to determine whether P1-assemblages represent a true TrV morphogenetic intermediate or a deadend structure. Indeed, the three-dimensional reconstruction of this novel structure might shed some light on this intriguing question. Additionally, structural analysis of P1assemblages following incubation with recombinant TrV C3-protease might also help in further understanding their http://vir.sgmjournals.org

role during TrV assembly. These experiments are currently under way. Finally, TrV VLPs described here constitute a promising addition to the existing arsenal of VLP platforms currently used for recombinant vaccine generation (Rodriguez & Gue´rin, 2014).

METHODS Cells and viruses. Trichoplusia ni H5 insect cells (Invitrogen) were

used for rBV infections. H5 cells were grown in TC-100 medium (Gibco) containing 10 % FCS. rBVs were grown and titrated as previously described (Martinez-Torrecuadrada et al., 2000). Recombinant baculoviruses (rBVs). A cDNA fragment corres-

ponding to the TrV genome region encoding the P1 polyprotein (nucleotides 6109–8715 from TrV full-length RNA; NCBI reference sequence: NC_003783) was obtained by reverse transcriptionpolymerase chain reaction (RT-PCR) using the following primers: (sense) 59-CCGGAATTCATGCTCGCTGTAAATAATGTAAATATG, incorporating an EcoRI restriction site (underlined) and ATG initiation codon (bold); and (anti-sense) 59-ATAAGAATGCGGCCGCCTAAGTAGTGGACTCTGAAGTCG, incorporating a NotI restriction site (underlined) and a TAG termination codon (bold). A cDNA fragment encoding the NS polyprotein (nucleotides 549–5933 from TrV full-length RNA) was generated by RT-PCR using the following primers: (sense) 59-ATAAGAATGCGGCCGCATGGAATTTTTGCGAAAATTCTTAATTCC, incorporating a NotI restriction site (underlined) and an ATG initiation codon (bold); and (anti-sense) 59CCGCTCGAGTCACATAGTCAAGTCCGTAGG, incorporating an XhoI restriction (underlined) site and a TGA termination codon (bold). The resulting PCR products were cloned into pFastBac1 plasmid (Invitrogen) and the resulting plasmids, pFastBac1-P1 and pFastBac1-NS, were analysed to assess the correctness of the cloned TrV sequence and used to generate the corresponding bacmids by transforming DH10Bac Escherichia coli strain. Recombinant bacmids were selected, purified and transfected into H5 cells following the Bacto-Bac protocol as recommended by the manufacturer (Invitrogen). The resulting rBVs were termed BV_P1 and BV_NS, respectively. Additionally, an empty rBV, BV_WT, was generated using a bacmid produced following transformation of DH10Bac cells with pFastBac1. BV_WT was used as a control for some experiments. Purification of TrV-derived VLPs. H5 monolayers were infected with BV_P1 or coinfected with BV_P1 and BV_NS at an m.o.i. of 2

p.f.u. of each virus per cell. At 48 h p.i., cells were harvested by centrifugation and resuspended in lysis buffer [50 mM Tris/HCl pH 7, 500 mM NaCl, 1 mM MgCl2 and 0.25 % (v/v) Igepal CA-630 (Sigma-Aldrich)] supplemented with complete protease inhibitor cocktail (Roche). Cells were lysed by incubation in lysis buffer for 20 min at 4 uC followed by three freeze–thaw cycles, and sonication. Cell lysates were centrifuged at 15 000 g for 20 min to pellet cell debris, and supernatants centrifuged through a 20 % (w/v) sucrose cushion in NMT buffer at 100 000 g for 4 h at 4 uC. The resulting pellets were resuspended in 1 ml of NMT buffer (50 mM Tris/HCl pH 7, 10 mM NaCl and 1 mM MgCl2) and then loaded on the top of 35 ml discontinuous 10–30 % (w/v) sucrose gradients. The subsequent centrifugation was carried out at 100 000 g for 2.5 h at 4 uC. Gradients were fractionated into 1.5 ml aliquots. Fractions enriched in TrV structural proteins were collected, dialysed against NMT buffer, and loaded onto a Sephacryl S-500 HR (GE Healthcare) column equilibrated with gel filtration buffer (50 mM Tris pH 7.5 and 150 mM NaCl). Fractions enriched in structural proteins were concentrated by centrifugation at 180 000 g for 3 h at 4 uC. The 71

R. Sa´nchez-Eugenia and others resulting pellets were resuspended in NMT buffer. Purification steps were monitored by SDS-PAGE followed by silver staining and by antiVP1 Western blot analysis. Preparation of specific anti-VP1 and anti-RdRp polyclonal sera. For the preparation of antibodies against P1 and NS, two

different regions of these polyproteins were selected, cloned and overexpressed in the E. coli BL21(DE3). Polyclonal antibodies were prepared by immunizing BALB/c mice and New Zealand white rabbits with purified protein inclusion bodies following a previously described protocol (Querido et al., 2013). Confocal laser scanning microscopy (CLSM). H5 cells seeded

onto glass coverslips were subjected to either single or double infections with the indicated rBVs. At 48 h p.i., cells were fixed with cold methanol for 5 min at 220 uC, and then air-dried and blocked in PBS containing 5 % FCS for 30 min at room temperature. Coverslips corresponding to single infections were incubated with either rabbit anti-RdRp or rabbit anti-VP1 serum in PBS supplemented with 1 % FCS for 1 h at room temperature. Coverslips from double infections were first incubated with rabbit anti-RdRp and then with mouse anti-VP1 serum. After incubations with primary antibodies, coverslips were repeatedly washed in PBS, and incubated with the appropriate secondary antibodies: goat anti-rabbit coupled to Alexa-488 (green), or goat anti-mouse coupled to Alexa-594 (red), diluted in PBS supplemented with 1 % FCS for 45 min at 37 uC. Cell nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI; Sigma) diluted in PBS for 30 min at room temperature. Finally, coverslips were dehydrated with ethanol and mounted with ProLong antifade reagent (Invitrogen). Samples were visualized by epifluorescence. Fluorescent signals detected by confocal laser scanning microscopy were recorded separately by using appropriate filters. SDS-PAGE and Western blot analyses. SDS-PAGE and Western

blot analyses were carried out to analyse the expression and processing of both the P1 and NS precursors and to assess VLPs purification steps. Samples were loaded on 12 % SDS-polyacrylamide gels. Gels were either stained with Coomassie blue (Sigma) or electroblotted to nitrocellulose membranes (Whatman). After blocking with 5 % (w/v) milk in TBST buffer [10 mM Tris pH 7.5, 150 mM NaCl and 0.05 % (v/v) Tween 20 (Sigma-Aldrich)], membranes were incubated with primary rabbit antibodies (anti-VP1, anti-RdRp) diluted 1 : 1000 in blocking buffer. Thereafter, blots were incubated for 1 h with a 1 : 2000 dilution of goat anti-rabbit IgG conjugated to HRP (Sigma) in blocking buffer. After washing with PBS, immunoreactive bands were detected by incubation with PBS containing 0.02 % 1-chloro-4-naphthol and 0.006 % hydrogen peroxide. Immunoprecipitation (IP) analysis. H5 cell monolayers grown in

p100 dishes were infected with the described rBVs at an m.o.i. of 2 p.f.u. per cell of each virus. At 48 h p.i., monolayers were washed twice with PBS, and incubated for 30 min with methionine-free TC100 medium (Genaxxon Bioscience) for 1 h. Following this methionine-starving step, cultures were incubated with methioninefree TC-100 medium supplemented with 1.856106 Bq of [35S]methionine ml21 for 1 h at 28 uC. After this period, cultures were either harvested and stored at 280 uC until processing or washed twice with warmed PBS and further incubated in TC-100 medium supplemented with a 10-fold excess of methionine for 12 h before harvesting. Cell pellets were resuspended in radioimmunoprecipitation (RIPA) buffer (50 mM Tris/HCl pH 7.4, 150 mM sodium chloride, 1 mM EDTA, 1 % NP-40, 1 % sodium deoxycholic acid, 0.1 % SDS). Samples were then subjected to IP using the anti-RdRp and -VP1. IP reactions were performed using Protein A Sepharose CL-4B (GE Healthcare) as previously described (Rodriguez et al., 1989). The resulting samples were subjected to 12 % SDS-PAGE gels followed by autoradiography. 72

TEM. Infected H5 cells were fixed in situ with a mixture of 2 % glutaraldehyde and 2 % tannic acid in 0.4 M HEPES buffer (pH 7.5) for 1 h at room temperature. Fixed cells were harvested, pelleted, washed with HEPES buffer and post-fixed with a mixture of 1 % osmium tetroxide and 0.8 % potassium ferricyanide in distilled water. Finally, cells were processed for embedding in resin EML-812 (EML Laboratories) as previously described (On˜a et al., 2004).

Samples of purified VLPs were spotted onto carbon-coated copper grids and stained with 2 % uranyl acetate. Images were acquired using a Philips EM208S electron microscope operating at 180 kV combined with a digital camera at a nominal magnification of 688 000. Particle sizing was performed manually using populations of .300 particles.

ACKNOWLEDGEMENTS This work was supported by the Spanish Ministry of Economy and Competitiveness (AGL2011-24758), awarded to J. F. R. R. S.-E. was supported by a predoctoral fellowship from the Basque Government and F. M. by an FPI fellowship from the Spanish Ministry of Economy and Competitiveness. D. M. A. G. was supported by the Basque Government (MV-2012-2-41, AE-2012-1-44, S-PE12FB001) and by the MICINN (BFU2012-36241), Spain. We thank Antonio Varas and Dr Aritz Durana for their interest and excellent technical support as well as the Scientific Microscopy Service of the UPV/EHU (SGIker) for the use of EM facilities.

REFERENCES Agirre, J., Aloria, K., Arizmendi, J. M., Iloro, I., Elortza, F., Sa´nchezEugenia, R., Marti, G. A., Neumann, E., Rey, F. A. & Gue´rin, D. M. A. (2011). Capsid protein identification and analysis of mature Triatoma

virus (TrV) virions and naturally occurring empty particles. Virology 409, 91–101. Agirre, J., Goret, G., LeGoff, M., Sa´nchez-Eugenia, R., Marti, G. A., Navaza, J., Gue´rin, D. M. A. & Neumann, E. (2013). Cryo-electron

microscopy reconstructions of triatoma virus particles: a clue to unravel genome delivery and capsid disassembly. J Gen Virol 94, 1058–1068. Bonning, B. C. & Miller, W. A. (2010). Dicistroviruses. Annu Rev

Entomol 55, 129–150. Bostina, M., Levy, H., Filman, D. J. & Hogle, J. M. (2011). Poliovirus

RNA is released from the capsid near a twofold symmetry axis. J Virol 85, 776–783. Czibener, C., La Torre, J. L., Muscio, O. A., Ugalde, R. A. & Scodeller, E. A. (2000). Nucleotide sequence analysis of Triatoma virus shows

that it is a member of a novel group of insect RNA viruses. J Gen Virol 81, 1149–1154. Czibener, C., Alvarez, D., Scodeller, E. & Gamarnik, A. V. (2005).

Characterization of internal ribosomal entry sites of Triatoma virus. J Gen Virol 86, 2275–2280. de Miranda, J. R., Cordoni, G. & Budge, G. (2010). The Acute bee

paralysis virus–Kashmir bee virus–Israeli acute paralysis virus complex. J Invertebr Pathol 103 (Suppl 1), S30–S47. Garriga, D., Pickl-Herk, A., Luque, D., Wruss, J., Casto´n, J. R., Blaas, D. & Verdaguer, N. (2012). Insights into minor group

rhinovirus uncoating: the X-ray structure of the HRV2 empty capsid. PLoS Pathog 8, e1002473. Genersch, E. & Aubert, M. (2010). Emerging and re-emerging viruses

of the honey bee (Apis mellifera L.). Vet Res 41, 54. Goodwin, S., Tuthill, T. J., Arias, A., Killington, R. A. & Rowlands, D. J. (2009). Foot-and-mouth disease virus assembly: processing of

Journal of General Virology 96

TrV gene expression and VLP assembly recombinant capsid precursor by exogenous protease induces selfassembly of pentamers in vitro in a myristoylation-dependent manner. J Virol 83, 11275–11282.

polyprotein precursor of a Dicistrovirus lacking the NPGP motif. Arch Virol 155, 1477–1482.

Grayson, M. (2010). Chagas disease. Nature 465 (n7301_supp), S3–S22. Hellen, C. U. & Wimmer, E. (1992). Maturation of poliovirus capsid

region’’ in the nonstructural polyprotein precursor of a dicistrovirus. Arch Virol 153, 1955–1960.

proteins. Virology 187, 391–397.

Nakashima, N. & Shibuya, N. (2006). Multiple coding sequences for

Hewat, E. A., Neumann, E. & Blaas, D. (2002). The concerted

the genome-linked virus protein (VPg) in dicistroviruses. J Invertebr Pathol 92, 100–104.

conformational changes during human rhinovirus 2 uncoating. Mol Cell 10, 317–326. Hu, Y.-C., Hsu, J. T.-A., Huang, J.-H., Ho, M.-S. & Ho, Y.-C. (2003).

Nakashima, N. & Nakamura, Y. (2008). Cleavage sites of the ‘‘P3

On˜a, A., Luque, D., Abaitua, F., Maraver, A., Casto´n, J. R. & Rodrı´guez, J. F. (2004). The C-terminal domain of the pVP2

Formation of enterovirus-like particle aggregates by recombinant baculoviruses co-expressing P1 and 3CD in insect cells. Biotechnol Lett 25, 919–925.

precursor is essential for the interaction between VP2 and VP3, the capsid polypeptides of infectious bursal disease virus. Virology 322, 135–142.

Kingsolver, M. B., Huang, Z. & Hardy, R. W. (2013). Insect antiviral

Palmenberg, A. C. (1990). Proteolytic processing of picornaviral polyprotein. Annu Rev Microbiol 44, 603–623.

innate immunity: pathways, effectors, and connections. J Mol Biol 425, 4921–4936. Le Gall, O., Christian, P., Fauquet, C. M., King, A. M. Q., Knowles, N. J., Nakashima, N., Stanway, G. & Gorbalenya, A. E. (2008). Picorna-

virales, a proposed order of positive-sense single-stranded RNA viruses with a pseudo-T 5 3 virion architecture. Arch Virol 153, 715–727. Levy, H. C., Bostina, M., Filman, D. J. & Hogle, J. M. (2010). Catching a

virus in the act of RNA release: a novel poliovirus uncoating intermediate characterized by cryo-electron microscopy. J Virol 84, 4426–4441.

Querido, J. F. B., Agirre, J., Marti, G. A., Gue´rin, D. M. A. & Silva, M. S. (2013). Inoculation of Triatoma virus (Dicistroviridae: Cripavirus)

elicits a non-infective immune response in mice. Parasit Vectors 6, 66. Ren, J., Cone, A., Willmot, R. & Jones, I. M. (2014). Assembly of

recombinant Israeli Acute Paralysis Virus capsids. PLoS ONE 9, e105943. Rodriguez, J. F. & Gue´rin, D. M. A. (2014). VLPs, methods for their

obtention and application thereof. EU Patent EP14382001.7 pending.

Li, C., Wang, J. C.-Y., Taylor, M. W. & Zlotnick, A. (2012). In vitro

Rodriguez, D., Rodriguez, J. R., Rodriguez, J. F., Trauber, D. & Esteban, M. (1989). Highly attenuated vaccinia virus mutants for the

assembly of an empty picornavirus capsid follows a dodecahedral path. J Virol 86, 13062–13069.

generation of safe recombinant viruses. Proc Natl Acad Sci U S A 86, 1287–1291.

Marti, G., Echeverrı´a, M. G., Susevich, M. L., Ceccarelli, S., Balsalobre, A., Canale, D., Stariolo, R., Noireau, F., Garcı´a, A. L. & other authors (2013). Exploration for Triatoma virus (TrV) infection

Snijder, J., Uetrecht, C., Rose, R. J., Sanchez-Eugenia, R., Marti, G. A., Agirre, J., Gue´rin, D. M. A., Wuite, G. J., Heck, A. J. & Roos, W. H. (2013). Probing the biophysical interplay between a viral genome and

in laboratory-reared triatomines of Latin America: a collaborative study. Int J of Trop Insect Sci 33, 294–304. Martinez-Torrecuadrada, J. L., Casto´n, J. R., Castro, M., Carrascosa, J. L., Rodriguez, J. F. & Casal, J. I. (2000). Different architectures in

the assembly of infectious bursal disease virus capsid proteins expressed in insect cells. Virology 278, 322–331. Mayo, M. A. (2002). Virus taxonomy – Houston 2002. Arch Virol 147,

its capsid. Nat Chem 5, 502–509. Squires, G., Pous, J., Agirre, J., Rozas-Dennis, G. S., Costabel, M. D., Marti, G. A., Navaza, J., Bressanelli, S., Gue´rin, D. M. A. & Rey, F. A. (2013). Structure of the Triatoma virus capsid. Acta Crystallogr D Biol

Crystallogr 69, 1026–1037. Susevich, M. L., Marti, G. A., Serena, M. S. & Echeverrı´a, M. G. (2012). New Triatoma virus hosts in wild habitats of Argentina.

1071–1076.

J Invertebr Pathol 110, 405–407.

Muscio, O. A., La Torre, J. L. & Scodeller, E. A. (1988).

Tate, J., Liljas, L., Scotti, P., Christian, P., Lin, T. & Johnson, J. E. (1999). The crystal structure of cricket paralysis virus: the first view of

Characterization of Triatoma virus, a picorna-like virus isolated from the triatomine bug Triatoma infestans. J Gen Virol 69, 2929–2934.

a new virus family. Nat Struct Biol 6, 765–774.

Muscio, O. A., La Torre, J., Bonder, M. A. & Scodeller, E. A. (1997).

Tuthill, T. J., Groppelli, E., Hogle, J. M. & Rowlands, D. J. (2010).

Triatoma virus pathogenicity in laboratory colonies of Triatoma infestans (Hemiptera: Reduviidae). J Med Entomol 34, 253–256.

Picornaviruses. Curr Top Microbiol Immunol 343, 43–89.

Nakashima, N. & Ishibashi, J. (2010). Identification of the 3C-

A quick fuse and the emergence of Taura syndrome virus. Virology 390, 324–329.

protease-mediated 2A/2B and 2B/2C cleavage sites in the nonstructural

http://vir.sgmjournals.org

Wertheim, J. O., Tang, K. F. J., Navarro, S. A. & Lightner, D. V. (2009).

73