Transcription Factor IIIBGenerates Extended DNA Interactions in RNA Polymerase IIITranscription Complexes on tRNAGenes

MOLECULAR AND CELL-ULAR BIOLOGY, June 1989. p. 2551-2566 0270-7306/89/062551-16$02.00/0 Copyright © 1989. American Society for Microbiology

Vol. 9. No. 171

Transcription Factor IIIB Generates Extended DNA Interactions in RNA Polymerase III Transcription Complexes on tRNA Genes GEORGE A. KASSAVETIS, DANIEL L. RIGGS,+ RODOLFO NEGRI,t LAM H. NGUYEN, AND E. PETER GEIDUSCHEK* Departmtlenlt of Biology Center jOr Molecuilla(r Genetic.s, Unii'ersity' California at San1 Diego, La Jolla, Californiai 92093 (111(1

of

Received 14 December 1988/Accepted 9 March 1989

Specific transcription by RNA polymerase III (Pol III) requires the participation of multiple transcription factors. With the exception of the U6 and 7SK RNA genes (7, 14, 17. 41. 50, 53), the DNA-binding sites that anchor these factors are located within transcription units. It is a remarkable property of Pol III that it can transcribe through the bulky transcription complexes that are built up on these internal promoters (also called internal control regions) without dispersing them (69). Specific initiation of transcription at tRNA genes, with which this paper primarily deals, requires factors TFIIIB and -C. Although the yeast analog of TFIIIC (also called T) has been relatively highly purified as a single component (54: see below), HeLa TFIIIC splits into two components upon purification: C2 is the primary DNA-binding determinant, and Cl either modifies the binding properties of C2 or binds to DNA in a C2-dependent manner (12, 18, 71). Both HeLa C2 factor and yeast TFIIIC (T) are large (12, 54, 64). The Bonbvx moni tRNA gene transcription factors can also be separated into three fractions, whose relationship to TFIIIB, Cl, and C2 remains to be established (51). The first promoter dissections of Pol III genes identified essential gene-internal elements (10, 19, 25, 55) and implied that flanking DNA sequence was almost without effect on promoter strength. The general situation with regard to the effects of flanking sequence on promoter strength of Pol III genes is, however, diverse, and this fact has only gradually been recognized (3, 4, 20, 29, 52, 62, 63; reviewed in references 26 and 61). There are several examples of 5' sequence substitutions that have almost absolute effects on promoter strength (43, 60), and many examples of substitu-

tions with very substantial effects have been reported. Flanking sequences affecting promoter strength are located within 70 base pairs (bp) 5' of transcriptional start sites, and at least some sequence effects are sensitive to precise spacing. Influence of 3'-flanking sequence on promoter strength has also been documented (9, 58, 59: see additional references in references 26 and 61). Therefore, it is justifiable to think of such Pol III promoters as extending over their entire transcription units. However, there is an important distinction between intragenic and flanking promoter segments: the intragenic sequences have been clearly delineated and are highly conserved between genes and organisms (16), whereas the flanking sequences are as yet incompletely delineated, at least partly because they are diverse (26, 61). The work described here derives from observations on a Saccharomnces cerevisiae tRNA gene in a crude extract. Under conditions in which most molecules of added template were actively and specifically transcribed, proteinDNA interactions covered not only the internal control region of this gene but also a large segment of contiguous 5' sequence. P. Fruscoloni, G. P. Tocchini-Valentini, and co-workers (personal communication) have also observed such 5' extensions of DNA-protein interaction on a tRNA gene in a crude extract. The protein components contributing to these interactions and their relationships to the known yeast transcription factors, TFIIIC and -B, are the subject of this paper. MATERIALS AND METHODS Plasmids. pLNG56 (3,135 bp) contains the SUP4 tRNATYr C56 G promoter-down mutation in pGEM1 gene with (Promega Biotech, Milwaukee, Wis.); pTZ1 (3,135 bp) contains the SUP4 tRNATyr gene with a G62 -> C promoter-up mutation in pGEM1; pPC1 (3,029 bp) contains a tRNALeU-3 gene in pUC12. pTZ2 contains the 270-bp BamHI fragment insert of pTZ1 in the opposite orientation. pPC2 contains the 343-bp RsaI-MspI fragment insert of pPC1 in the opposite a

Corresponding author. Present address: Department of Biological Chemistry. University of California at Irvine, Irvine, CA 92717. t Present address: Centro di Studio per gli Acidi Nucleici del CNR, Rome, Italy. *

t

2551

-*

Downloaded from http://mcb.asm.org/ on November 19, 2015 by guest

Transcription complexes that assemble on tRNA genes in a crude Saccharomyces cerevisiae cell extract extend over the entire transcription unit and approximately 40 base pairs of contiguous 5'-flanking DNA. We show here that the interaction with 5'-flanking DNA is due to a protein that copurifies with transcription factor TFIIIB through several steps of purification and shares characteristic properties that are normally ascribed to TFIIIB: dependence on prior binding of TFIIIC and great stability once the TFIIIC-TFIIIB-DNA complex is formed. SUP4 gene (tRNATyr) DNA that was cut within the 5'-flanking sequence (either 31 or 28 base pairs upstream of the transcriptional start site) was no longer able to stably incorporate TFIIIB into a transcription complex. The TFIIIB-dependent 5'-flanking DNA protein interaction was predominantly not sequence specific. The extension of the transcription complex into this DNA segment does suggest two possible explanations for highly diverse effects of flanking-sequence substitutions on tRNA gene transcription: either (i) proteins that are capable of binding to these upstream DNA segments are also potentially capable of stimulating or interfering with the incorporation of TFIIIB into transcription complexes or (ii) 5'-flanking sequence influences the rate of assembly of TFIIIB into stable transcription complexes.

2552

KASSAVETIS ET AL.

8.0-0.1 mM trisodium EDTA to which 10 p.1 of a buffered 95%Y formamide-dye solution was added before being dried down to 10 ,ul in a vacuum concentrator (to ensure complete resuspension of the sample). The samples were boiled and analyzed on 10% polyacrylamide gels (40:1, acrylamidebisacrylamide) containing 8 M urea. For quantitation, autoradiograms were made without screens and scanned on a densitometer (LKB model XL). Integrated film density corresponding to protected segments was determined relative to that of unprotected adjacent segments of the same sample (i.e., in the same lane; R,,). The same was done for reference samples containing no protein (RO). Results are presented either as percent protection (i.e., 100 [RO -

R,,J/RO) or as femtomoles of probe bound, assuming that 100% protection from DNase I corresponds to 100% occupancy by protein. Transcription. Transcription proteins were incubated with 50 to 100 fmol of pTZ1 in 20 .I1 of the buffer described above for DNase I protection except that NaCl was at 100 mM, polyvinyl alcohol was absent, and 100 to 400 ng of pKD1 was used as the nonspecific carrier DNA for assaying the early stages of protein purification. TFIIIB was assayed by using a DEAE-Sephadex-0.5 M NaCl step fraction containing TFIIIC and Pol III (37) or affinity-purified TFIIIC (see below) and purified Pol III (28). Multiple-round transcription assays (in which Pol III is free to undergo several rounds of initiation, elongation, and termination) were started by adding S [l of a solution providing 200 p.M ATP, 100 p.M CTP, 100 p.M UTP, and 25 p.M [oP_32P]GTP (10,000 cpm/pmol; Dupont NEN). Transcription was allowed to proceed for 15 min at 20°C (under these conditions, the transit time for elongation through the gene was 20 to 30 s; data not shown) and was terminated and processed for electrophoresis as described above. Single-round transcription: counting active molecules of transcription factors. Assays in which RNA polymerase is limited to one round of transcription were initiated by adding 5 p.l of a solution providing 200 p.M ATP, 100 p.M CTP, and 100 p.M UTP (ultrapure; Pharmacia, Inc., Piscataway, N.J.) to the mixture of SUP4 DNA and transcription components assembled as described above. In the absence of GTP, a stable ternary transcription complex paused 17 nucleotides (nt) downstream of the transcription initiation site (see below). After 1 to 3 min, transcription elongation was allowed to resume for 1 to 3 min and terminate at the end of the gene by addition of S plI of a solution providing 25 p.M [oP-32P]GTP (20,000 to 50,000 cpm/pmol) and 300 pLg of heparin per ml (which allows elongation but prevents reinitiation and posttranscriptional processing; data not shown). Transcription reactions were terminated and processed for gel electrophoresis as described for DNase I protection assays except that two sequential ethanol precipitations in the presence of 2 M ammonium acetate were done to remove unincorporated ribonucleotides. Gel slices containing elongated and terminated transcripts were excised, dried, and quantified by scintillation counting. The number of transcripts synthesized was calculated from the known specific activity of GTP, the number of GMP residues in the SUP4 transcript, and the overall efficiency of counting radioactivity in the gel, which ranged from 40 to 60% (determined with a known amount of a labeled DNA restriction fragment of similar size in the same gel). The number of completed transcripts was taken to represent the number of active transcription complexes formed in the preincubation of transcription proteins with the template DNA, which in turn corresponds to the quantity of the limiting transcription

Downloaded from http://mcb.asm.org/ on November 19, 2015 by guest

orientation. pPC5 and pPC6 (2,982 bp) contain a tRNA'Gln gene on a 302-bp RsaI-AliI fragment from pGT23 (66) inserted into the HinclI site of pUC12 in both orientations. pSUP6 (3,628 bp) contains the SUP6 tRNA'Y'- gene on a 750-bp BarnHI fragment from pYSUP6 (32) inserted into the BamHI site of pGEM1. To make pPC1, a 343-bp RsaI-MspI fragment from YEp13 (13) containing a tRNA' Cu-3 gene was blunt ended and inserted into the Hindc!l site of pUC12. The 270-bp BarnHI fragments carrying SUP4 promoter-up and -down mutant genes of pGE33 and pAG56 (from R. Baker and B. D. Hall; 6) were inserted into the BatnHI site of pGEM1 to give pTZ1 and pLNG56, respectively. pLN4435 (3,033 bp) and pLN4132 (3,030 bp) contain the SUP4 tRNA gene deleted in the natural upstream sequence. pTZ1 was cleaved with AcI in the multiple cloning site of pGEM1 and 27 bp upstream of the first nucleotide of the mature tRNA, filled in with Klenow fragment DNA polymerase I, and recircularized (21) to give pLN4435; pTZ1 was cleaved with HincIl in the multiple cloning site and then by Acc I, treated with mung bean nuclease to blunt the AccI site, and recircularized to give pLN4132. Sequences were confirmed (57). The two pairs of numbers following the pLN designation reflect the upstream locations of the HindlIl and PstI sites relative to the base pair coding for the 5' end of mature tRNA, designated +1. pKD1 (3,787 bp), used as a nonspecific carrier or competitor DNA, is the phage T4 clone pLA4-zAH1 (34) deleted between the Hindlll and Pvull sites of pBR322. For transcription experiments, plasmid DNA was purified by standard methods (22), including two isopycnic centrifugations in ethidium bromide-CsCl. DNase I protection. To make DNA probes, pPC1, pPC2, pPC5 and pPC6 were cleaved with BainHI, PstI, and SacI. The BamHI site was filled in with Escherichia coli DNA polymerase I Klenow fragment, dGTP, dCTP, dTTP, and [kx-32P]dATP (5,000 Ci/mmol; Dupont, NEN Research Products, Boston, Mass.). The BamHI-PstI fragment containing the tRNA gene insert was excised from a 4% polyacrylamide gel, passively eluted into 10 mM Tris chloride (pH 8.0)-0.2 mM trisodium EDTA-0.1% sodium dodecyl sulfate-i M LiCl, precipitated with ethanol, suspended in 10 mM Tris chloride (pH 8.0)-0.1 mM trisodium EDTA, and purified on benzoylated naphthoylated DEAE-cellulose (35). pTZ1, pTZ2, pSUP6, and pLN4132 were cleaved with EcoRI and PvullI, and the EcoRI site was labeled by filling in with [at-32P]dATP and passed over a 1-ml Sepharose CL-2B column to remove the small labeled EcoRI-Pi,II fragment. In some cases, pTZ1 and pTZ2 were cleaved with XbaI, labeled by filling in with [x-32PJdATP, and then cleaved with Pi'wII and HindIll. (The labeled 23-bp XbalI-HindIII fragment was not removed from this XbaI-Pv all probe.) Transcription factors TFIIIC and TFIIIB were incubated with 2 fmol of 3'-end-labeled DNA probe and 50 ng of EcoRI-cleaved pGEM1 (as a nonspecific carrier DNA) in 20 p.1 of 40 mM Tris chloride (pH 8.0)-7 mM MgCl,-80 mM NaCl-3 mM dithiothreitol (DTT)-0.5% polyvinyl alcohol-5 to 10% glycerol at 21°C for 30 min unless otherwise noted in the figure legends. A 2-,ul amount of DNase I (RNase free; Bethesda Research Laboratories, Inc., Gaithersburg, Md.) diluted to 3 to 6 ng/ltl in 40 mM Tris chloride (pH 8.0)-7 mM MgCl,-100 mM NaCl-0.1 mM DTT-100 jig of bovine serum albumin (BSA) per ml-5% glycerol-5 mM CaCl, was added, and nuclease digestion was terminated 30 s later with 180 ,ul of 10 mM Tris chloride (pH 8.0)-3 mM trisodium EDTA0.2% sodium dodecyl sulfate. Reaction mixtures were extracted once or twice with phenol-CHCl3, precipitated with ethanol, and suspended in 25 ,ul of 10 mM Tris chloride (pH

MOL. CELL. BIOL.

VOL. 9, 1989 + -

4

heparin

b

c

-

4

heparin 2 1

d e f g h i j

2

5

Chase (min) UP4

7

-

mer

k I

FIG. 1. Comparison of single-round and multiple-round tranon a SUP4 tRNAl r gene template (pTZ1). A BioRex 70-500 mM KCI step fraction (BRox) was incubated with pTZ1i and transcription was initiated in the absence of GTP as described in Materials and Methods (lanes a and g). RNA chains were then allowed to elongate in the presence of GTP with (lanes b to f) or without (lanes h to 1) 300 ,ug of heparin per ml for the times indicated above the lanes.

scription

component. (This assay yields underestimated values to the extent that losses occur during the processing of reaction mixtures for electrophoresis.) Active molecules of TFIIIB were assayed in the presence of excess TFIIIC and Pol III. Active molecules of affinity-purified TFIIIC were assayed with excess TFIIIB (fraction HAP; see below) and purified Pol III. A comparison of single- and multiple-round transcription of the SUP4 gene (pTZ1) is shown in Fig. 1. For this experiment, the procedure described above was modified so that the 17-mer synthesized in the absence of GTP could be examined (Fig. 1, lanes a and g): [U_-32P]UTP (60,000 cpm/ pmol) was present at 25 ,uM in the three-nucleoside triphosphate initiation reaction; the chase was performed with 100 p.M GTP with (lanes b to f) and without (lanes h to 1) 300 ,ug of heparin per ml, and samples were taken at specified times. The appearance and subsequent disappearance of paused transcription complexes when heparin was present in the chase should be noted in lanes b to f. In the reaction without heparin, a steady-state level of the same paused species quickly appeared, but the pattern was complicated by the subsequent accumulation of processed and partially processed transcripts. The samples taken 2 and 5 min after the chase with heparin contained 6.9 fmol of the SUP4 gene primary transcript (lanes e and f). The sample taken 5 min after the chase without heparin (lane 1) contained 21 fmol of complete, unprocessed primary transcript and 0.96 times as much UTP (20 fmol-equivalents) incorporated into various processed and incomplete transcripts. Thus, at least six (approximately seven to eight) transcripts had been gener-

2553

ated during this 5-min interval from each active promoter complex. Buffers. Buffer B was 20 mM sodium N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES) (pH 7.8)-i mM trisodium EDTA-l0% glycerol-0.5 mM phenylmethylsulfonyl fluoride-0.5 mM DTT or 10 mM 2-mercaptoethanol. Buffer C was buffer B with 20% glycerol. Buffer D was buffer B plus 5 mM MgCl, and 40 mM potassium HEPES (pH 7.8) in place of sodium HEPES. Buffer E was buffer B plus 10 mM MgCl, and 20 mM Tris chloride (pH 8.0) in place of sodium HEPES. Buffer F consisted of 20 mM Tris chloride (pH 8.0), 0.2 mM trisodium EDTA, 0.5 mM DTT, 20% glycerol. 0.5 mM phenylmethylsulfonyl fluoride, 1 ,ug of leupeptin per ml, and 1 [ig of pepstatin per ml. Buffer G was buffer F plus 7 mM MgCl, and 50% instead of 20% glycerol. Buffer H was buffer F plus 7 mM MgCl.,, 250 ,ug of BSA (nuclease free, Boehringer Mannheim Biochemicals, Indianapolis, Ind.) per ml, 0.01% Lubrol PX (Pierce Chemical Co., Rockford, Ill.). and no glycerol. Buffer K consisted of specified concentrations of K P04 (pH 7.8), 0.5 mM DTT, 0.5 mM phenylmethylsulfonyl fluoride, 1 pg of leupeptin per ml, 1 ,ug of pepstatin per ml, and 20% glycerol. Buffer L was 20 mM Tris chloride (pH 8.0)-i mM trisodium EDTA-10% glycerol-0.1 mM phenylmethylsulfonyl fluoride-10 mM 2mercaptoethanol-5 mM MgCl,. Buffer M was buffer L without MgCl, and with 0.5 ,ug of leupeptin, 1 1Lg of pepstatin, and 0.5 mg of Nonidet P-40 per ml. Partial purification of S. cerevisiae TFIIIB. An S100 cell extract (17.9 g of protein) was prepared from 480 g of S. cerevisiae BJ926 as described by Klekamp and Weil (37) except that solid (NH4)SO4 was added to 0.5 M after lysis. In recovering the S100 supernatant fluid, care was taken not to collect the dense, cloudy material between the clear supernatant and the pellet. The latter material generates an inactive extract, and the inactivation is not fully reversed at subsequent purification steps. Partial reversal was obtained by removing a 35%-saturated (NH4),S04 (0°C) cut of the S100 fluid, and this step was therefore included in the protocol to remove trace amounts of the inhibitor. After precipitation in 70%-saturated (NH4)2SO4, the pellet was dissolved in buffer B and dialyzed into buffer C plus 50 mM KCl. The dialysate was made 5 mM in MgCl., adjusted to the conductivity of buffer D plus 100 mM KCl with buffer D, loaded onto a BioRex 70 column (65; 1.7 ml/g of cells), and step eluted with buffer D plus 250, 500, and 650 mM KCl. The 500 mM step fraction (BRot) contained 70.8 pmol of active TFIIIB (as assayed by single-round transcription) and 1,430 mg of protein (determined by the method of Lowry et al. [45] after precipitation with Cl3CCOOH). This corresponds to only approximately 11 molecules of active TFIIIB recovered per cell when volume losses by the lysis procedure and S100 steps are taken into account. Fraction BRot was dialyzed into buffer E plus 100 mM NaCl and passed through a DEAE-Sephadex A-25 column (1 ml/mg of protein; 37). The material flowing through was precipitated in 70%-saturated (NH4)2S04, resuspended, and dialyzed into buffer F plus 50 mM NaCl. This fraction (DEAE I; Fig. 2, lane b) contained 42 pmol of TFIIIB and 900 mg of protein. Fraction DEAE I was loaded onto a second DEAESephadex A-25 column (200 ml; flow rate, 5 ml/cm2 per min) and developed with an 800-ml 50 to 300 mM NaCl linear gradient in buffer F. Peak TFIIIB activity eluted at 140 mM NaCl. Recovery of TFIIIB on this column was low. This fraction (DEAE II; Fig. 2, lane c) contained 5.3 pmol of TFIIIB and 96 mg of protein. Part of the apparent loss was

Downloaded from http://mcb.asm.org/ on November 19, 2015 by guest

< a

>~ ~ 1

- 1 2 5

no

DNA INTERACTIONS ON tRNA GENES

2554

MOL. CELL. BIOL.

KASSAVETIS ET AL. a

b

c

d

e

f

g

h

BSA-_

due to an inhibitor of transcription (defined by mixing experiments) in the higher-salt portion of the TFIIIB peak. It should also be noted that the salt optimum for transcription decreased from 120 to 150 mM NaCI (37) to 80 mM NaCl when DEAE II TFIIIB or further purified TFIIIB was used in the transcription system and that little or no specific transcription occurred at 150 mM NaCl. Addition of the flowthrough fraction of the second DEAE-Sephadex A-25 column (containing no detectable TFIIIB activity) restored the ability to transcribe, with nearly full activity at 150 mM NaCl (data not shown). Fraction DEAE II TFIIIB was loaded onto a hydroxyapatite column (type HTP; 40 ml; 2.5 by 8.2 cm, flow rate, 8 ml/cm2 per h; Bio-Rad Laboratories, Richmond, Calif.), washed with buffer K with 75 mM K. P04, and developed

with a 200-ml 75 to 300 mM K P04 gradient. Peak TFIIIB activity eluted at 165 mM K P04 (see Fig. 4). TFIIIB-

containing fractions were dialyzed individually into buffer C plus 100 mM NaCl, pooled, adjusted to 7 mM MgCl., centrifugally concentrated (Centricon 30; Amicon Corp., Lexington, Mass.), and made 50% (vol/vol) in glycerol. (Desalting and concentration of TFIIIB resulted in a ca. twofold loss in activity.) This fraction, HAP, contained 8,040 fmol of TFIIIB and 14 mg of protein (Fig. 2, lane d). The greater than 100% recovery at this step resulted from removal of the inhibitor in the DEAE II TFIIIB fraction described above. Cibacron Blue F3GA-Sepharose CL-4B was prepared (11), with the degree of coupling varied by using different

TTGAGGAATCGAACCCTCGAC CCTTAGCTTGGGAGCTGAACT. A 50-,ug amount of DNA was coupled per ml of CNBractivated Sepharose CL-4B (33). TFIIIC-containing fractions were bound to 0.1 volume of DNA (box B)-Sepharose at 12°C for 30 min and then washed with the same buffer containing 70 mM NaCl. TFIIIC was eluted with the same buffer containing 400 mM NaCl (Fig. 2, lane h). Another preparation of TFIIIC was affinity purified on Sepharose coupled to an (average) 20-unit repeat of the synthetic box B+ 29-mer GTTAGGGGAATCGAACCCCGGCCTCCTAG GGATCCAATCCCCTTAGCTTGGGGCCGGA,

which is an extension of a consensus yeast tRNA gene box B TFIIIC-binding sequence (1, 5). For this preparation, the TFIIIC-containing fraction from DEAE-Sephadex was concentrated by adsorption to and elution from BioRex 70. Adsorption to the affinity purification DNA column was at 0°C in buffer M plus 75 mM NaCl. After a wash with buffer M plus 100 mM NaCl, TFIIIC was eluted in buffer M plus 1 M NaCl. After being desalted into buffer M plus 100 mM NaCl, this material was applied to a second affinity purification DNA column, washed with buffer M plus 100 mM NaCl and then buffer M plus 200 mM NaCl, and eluted into buffer M plus 1 M NaCl (Fig. 2, lane g). The protein contents of both TFIIIC preparations were too low to be determined with any degree of accuracy (Fig. 2). The preparation shown in lane h contained less than 10 ,ug of protein, 3.3 pmol of TFIIIC transcription activity and 6 pmol of box B-binding activity per ml. The preparation shown in lane g (protein discernible in the lane resulted from use of BSA as a stabilizing agent) contained not more than roughly 60 to 70 ,ug of protein, 27 pmol of TFIIIC transcription activity, and 40 pmol of box B-binding activity per ml. If TFIIIC is a protein of molecular weight 300,000 to 600,000, then the percentage of transcriptionally active TFIIIC in these preparations was in the range of 10 to 27% or higher, and the TFIIIC capable of binding to DNA was 20 to 40% of the total protein or higher.

Downloaded from http://mcb.asm.org/ on November 19, 2015 by guest

FIG. 2. Electrophoretic analysis of the partial purification of TFIIIB. Protein fractions were analyzed on a sodium dodecyl sulfate-8% polyacrylamide gel (42) stained with silver (49). Transcriptionally active S. cerei'siae TFIIIB (2 fmol) was analyzed from the following purification steps: DEAE I (lane b; 44 ,ug of protein). DEAE 11 (lane c; 40 ,ug of protein), fraction HAP (lane d; 3.6 ,ug of protein), and fraction Cibacron Blue (lane e; 0.3 ,ug of protein). Other lanes: f, 2 fmol of partially purified TFIIIA (see text): g and h, two different preparations of TFIIIC. The major band in lane g is BSA used as a stabilizing agent. Lane a contains E. coli RNA polymerase and BSA as size standards, with mobilities corresponding to 165 (f3'), 155 ([). 86 (a), 66 (BSA). and 39 (at) kDa.

concentrations of the dye. Each batch was tested for binding and elution of TFIIIB under nondenaturing conditions. Fraction HAP of TFIIIB was loaded onto Cibacron Blue-Sepharose (0.12 ,umol of dye per ml of Sepharose; 10 ml; flow rate, 5 ml/cm2 per h) and washed with buffer G plus 150 mM NaCl, and TFIIIB was eluted with buffer G plus 700 mM NaCl (approximately 10%5 of the TFIIIB flowed through this column). The 700 mM NaCl step fractions were individually desalted by 2.3-fold dilution in buffer H and two- to fourfold centrifugal concentration. This fraction, Cibacron Blue, contained 1,350 fmol of TFIIIB and approximately 200 [Lg of protein (Fig. 2, lane c). It represents a ca. 135-fold purification of TFIIIB activity from the BRot fraction by activity and a 7,000-fold reduction in total protein. Affinity purification of TFIIIC. Fraction BRot (490 mg of protein) was dialyzed into buffer E plus 100 mM KCl and adsorbed to DEAE-Sephadex A-25 (1). TFIIIC was step eluted with buffer E plus 250 mM KCl (88 mg of protein). This fraction was dialyzed into buffer L plus 100 mM NaCl and bound batchwise to coupled DNA (box B)-Sepharose. The coupled DNA consisted of an (average) seven-unit repeat of the synthetic 21-mer,

VOL. 9. 1989

DNA INTERACTIONS ON tRNA GENES

RESULTS

IN b

a

c

-6

Start -F A

1.

g

I p

V.-.

B

'I'

I *W&

FIG. 3. DNase I protection analysis of a complete, crude cell transcription extract bound to SUP4 tDNATYr. A 2-fmol amount of EcoRI-cut pTZ1 probe (3' end labeled in the nontranscribed strand) and 250 ng of nonspecific DNA (pKD1) were incubated with the crude transcription fraction BRot (lanes a and b, containing 5 fmol of active TFIIIB as the limiting component). Transcription was initi-

ated and arrested 17 nt downstream with a nucleotide mixture lacking GTP (as in the single-round transcription assay; see Materials and Methods) in the sample shown in lane b. Digestions were with 4 ng (lane c; no-protein control) or 16 ng (lanes a and b) of DNase 1. A 1.4-fmol amount of active transcription complexes was formed in a single-round transcription assay with 2 fmol of pTZ1 DNA template under reaction conditions identical to those used for the sample shown in lane b. Location of the start site of transcription, the box A and box B internal promoter elements, and the region of upstream protection (U) are shown on the left.

fmol of DNA protection) may reflect the different specific template concentrations of the two assays (50 versus 2 fmol of pTZ1). Reducing the amount of template from 50 to 2 fmol in the single-round transcription assay generally decreased the formation of active transcription complexes two- to

Downloaded from http://mcb.asm.org/ on November 19, 2015 by guest

We have developed a single-round transcription assay for specific transcription by S. cerevisiae Pol III in order to provide a more precise quantitation of active transcription complexes. This information was initially used to monitor the assembly of active transcription complexes on tRNA and 5S rRNA genes with concentrations of crude transcription extracts (37) sufficient to nearly saturate the template for DNase I protection analysis. One feature of those experiments was that they provided evidence of protection extending 40 to 45 bp upstream of the site of transcription initiation on a 5S rRNA gene (B. R. Braun, D. L. Riggs, and E. P. Geiduschek, Proc. Natl. Acad. Sci. USA, in press) and on tRNA genes (Fig. 3). For the footprints shown in lanes a and b, a single-round transcription assay run in parallel indicated that not less than 70% of the DNA was in potentially active transcription complexes (Fig. 3, legend). That active transcription complexes were being examined here was additionally demonstrated by advancing RNA polymerase in the presence of ATP, UTP, and CTP to nt 17 and showing that the footprint changed in a characteristic way (Fig. 3, lane b). By analogy to E. coli RNA polymerase promoter binding, we thought, a priori, that the protein binding to DNA upstream of the site of transcriptional initiation might be Pol III. However, at the initial step of fractionation of the cell extract on DEAE-Sephadex (see Materials and Methods and reference 37), the upstream binding activity flowed through with TFIIIB and separated from Pol III and TFIIIC (data not shown); we therefore determined to identify it. TFIIIB was further purified 135-fold according to specific activity and 7,100-fold according to protein content, with successive gradient elutions from DEAE and hydroxyapatite, followed by purification on Cibacron Blue. The protein composition of 2 fmol of transcriptionally active TFIIIB at each step of the purification is shown in Fig. 2 (lanes b to e). If all of the TFIIIB protein in these fractions is transcriptionally active under our assay conditions, it should not be detectable by staining. Also shown is 2 fmol of transcriptionally active TFIIIC (lanes g and h represent two preparations; see Materials and Methods). The elution profile of the upstream binding activity from hydroxyapatite was correlated with the protein and TFIIIB activity elution profiles shown in Fig. 4. The upstream binding activity coeluted precisely with TFIIIB transcription activity in a peak that was skewed because of trailing of active protein, as is best seen by examining the borders of the _TFIIIB peak, where the DNase I protection assay approximated a linear response. For example, equal portions of fractions 54 and 66, containing approximately 10% TFIIIB activity relative to the peak fraction 58, both gave rise to ca. 50% protection of the upstream binding region. (The quantitative difference, i.e., 10 versus 50%, partly reflected the different amounts of protein generating saturation in the two assays. Footprints tend to be done near DNA probe saturation because only then are they visually discernible.) This correlation between TFIIIB transcription and upstream binding activities continued through the final step of the TFIIIB purification on Cibacron Blue-Sepharose. Since TFIIIB was stepped off this column, the cochromatography can best be shown by comparing the ratio of TFIIIB to upstream binding activity for the HAP and Cibacron Blue fractions (Fig. SB); no significant difference was observed. The lack of a precise quantitative equivalence of the transcription and footprinting activities in Fig. SB (for example, 2 fmol of transcriptionally active TFIIIB generated 0.8 to 0.9

2555

2556

KASSAVETIS ET AL.

MOL CELL . B IOL

2.8 -

2.4-

- 300

-100 aN

2.0 -

- 250

la 0

1.6

-

-

80

P_. 0

- 200 X

0

0

4 1.2-

- 60

--0

-40 N

0.8 -

-100

-4-I In

0.4 -

24

-

32

40

48

56

64

72

80

20 1

- 50

88

Fraction number FIG. 4. Cochromatography of an upstream binding activity with TFIIIB on hydroxyapatite. TFIIIB activity, measured by multiple rounds of transcription, was quantitated by densitometric scans of autoradiograms exposed without intensifying screens and plotted relative to the peak fraction 58 (A). Binding and DNase I reactions with 4.5 fmol of active TFIIIC and 9 .1l of hydroxyapatite fractions were performed as described in Materials and Methods except that 50 mNM K P04 (pH 7.8) replaced NaCl in a final reaction volume of 40 pLl containing 2 fmol of EcoRI-cut pTZ1 probe (SUP4 tRNA"Sr' [G62-C]: 3' end latbeled in the nontranscribed strand). Upstream binding activity was quantitated by densitometric scans, film density in the region that is subject to protection was determined relaltive to the density in an unprotected adjacent region. The same ratio was determined for ai no-protection control. The ratio of these ratios is plotted (U).

fourfold (data not shown); this may reflect the presence of inactive TFIIIC or Pol III that is nevertheless capable of binding DNA. Cibacron Blue-purified TFIIIB generated upstream protection for four tRNA genes (Fig. 6A). Lanes a to c show the nontranscribed strand of SUP4 tRNATYr and generally exemplify the pattern observed on the nontranscribed strands of the other templates. Affinity-purified TFIIIC strongly protected the bor B region and provided weaker protection in the box A region, enhancement at the start site of transcription, and enhancement upstream. Addition of TFIIIB resulted in increased protection in the box A region, lack of protection at the start site of transcription, and upstream protection, the extent of which is shown in Fig. 6B. The same pattern was observed for the nontranscribed strands of tRNA'-u-3 (lanes k to m), tRNA 'In (lanes n to p), and SUP6 tRNATYr (lanes t to v) genes, with template-specific differences in the degree of box A-region protection and enhancement observed with TFIIIC alone. On the transcribed strand of the SUP4 tRNATYr (lanes e to g), tRNALcL