Tissue-specific gene expression in chondrocytes grown on three-dimensional hyaluronic acid scaffolds

Biomaterials 24 (2003) 3265–3275

Tissue-specific gene expression in chondrocytes grown on three-dimensional hyaluronic acid scaffolds Davide Girottoa,*, Serena Urbanib, Paola Bruna, Davide Renierc, Rolando Barbuccid, Giovanni Abatangeloa a

Dipartimento di Istologia, Microbiologia e Biotecnologie Mediche, Facolta" di Medicina, Universita" di Padova, Viale G, Colombo 3 35121, Italy b U.O. Ematologia, Ospedale di Careggi, Firenze, Italy c Fidia Research Laboratories, via Ponte della Fabbrica 3/A, 35031 Abano Terme, Padova, Italy d CRISMA, University of Siena, Via Ettore Bastianini12, 53100 Siena, Italy Received 14 October 2002; accepted 9 March 2003

Abstract The re-differentiation capacities of human articular and chick embryo sternal chondrocytes were evaluated by culture on HYAFF-11 and its sulphate derivative, HYAFF-11-S, polymers derived from the benzyl esterification of hyaluronate. Initial results showed that the HYAFF-11-S material promoted the highest rate of chondrocyte proliferation. RNA isolated from human and chick embryo chondrocytes cultured in Petri dishes, HYAFF-11 or HYAFF-11-S were subjected to semi-quantitative RT-PCR analyses. Human collagen types I, II, X, human Sox9 and aggrecan, chick collagen types I, II, IX and X were analysed. Results showed that human collagen type II mRNA expression was upregulated on HYAFF-11 biomaterials. In particular, a high level of collagen type IIB expression was associated with three-dimensional culture conditions, and the HYAFF-11 material was the most supportive for human collagen type X mRNA expression. Human Sox9 mRNA levels were constantly maintained in monolayer cell culture conditions over a period of 21 days, while these were upregulated when chondrocytes were cultured on HYAFF-11 and HYAFF-11S. Furthermore, chick collagen type IIA and IIB mRNA expression was detected after only 7 days of HYAFF-11 culture. Chick collagen type IX mRNA expression decreased in scaffold cultures over time. Histochemical staining performed in engineered cartilage revealed the presence of a de novo synthesized glycosaminoglycan-rich extracellular matrix; immunohistochemistry confirmed the deposition of collagen type II. This study showed that the three-dimensional HYAFF-11 culture system is both an effective chondrocyte delivery system for the treatment of articular cartilage defects, and an excellent in vitro model for studying cartilage differentiation. r 2003 Elsevier Science Ltd. All rights reserved. Keywords: Hyaluronan; Tissue engineering; Collagen; RT-PCR; Extracellular matrix

1. Introduction Articular cartilage defects are a major problem in orthopedic surgery. Joint pain usually results from degeneration of the joint’s cartilage due to primary osteoarthritis or from trauma. Since cartilage shows little tendency for self-repair, injuries are maintained for years and can eventually lead to further degeneration [1]. Fibrocartilage, which is mechanically and chemically inferior to hyaline cartilage, is the predominant repair *Corresponding author. Tel.: +39-049-8276096; fax: +39-0498276079. E-mail address: [email protected] (D. Girotto).

tissue found in articular defects [2,3]. During the past decade, many investigations have pursued techniques to stimulate articular cartilage repair or regeneration [4,5]. Reports have described the replacement of cartilage defects with periosteum, perichondrium or cartilage grafts [6,7], induction of cartilage formation by local injection of chondrogenic factors such as transforming growth factor beta-1, insulin growth factor, or bone morphogenic proteins [8,9]. Another approach to cartilage repair is the delivery of autologous chondrocytes into the defect. The isolation and culture in monolayer system of metazoa cells is a well-known basic procedure in cell biology. Isolated cells in a two-dimensional, monolayer

0142-9612/03/$ - see front matter r 2003 Elsevier Science Ltd. All rights reserved. doi:10.1016/S0142-9612(03)00160-1

3266

D. Girotto et al. / Biomaterials 24 (2003) 3265–3275

culture system can only simulate a small part of the native tissue’s complexity. In particular, chondrocyte cells in monolayer undergo a process of de-differentiation that involves a loss of the pattern for chondrocytespecific gene expression. The extracellular matrix of cartilage tissue contains large amounts of aggrecan, decorin, biglycan, and fibromodulin, collagen types II, IX, XI, as well as several other key matrix components, including cartilage oligomeric matrix protein (COMP) [10]. Sox9, a general transcriptional regulator of cartilage-specific genes, including those for collagen types II, IX and XI and for aggrecan [11], is expressed during embryonic development in a pattern that closely parallels that of the gene for the a1 chain of collagen type II [12]. Sox9 RNA expression in micromass culture peaks between 20 and 65 h of culture, a phase of progressive transcript accumulation for the a1 chain of collagen type II [13]. After a few days in monolayer culture, human chondrocytes begin to transform into cells with a fibroblast-like morphology, and the typical formation of chondrons and pericellular matrix is not observed. Biochemical and molecular studies reveal a switch of collagen and proteoglycan synthesis, from collagen II to collagen I, and from aggrecans to lowmolecular-weight proteoglycans [14]. Conversely, cells re-acquire their chondrocyte-specific phenotype when transferred to a non-adherent, three-dimensional culture system, a phenomenon known as re-differentiation [15]. The emergent field of tissue engineering has extensively utilized degradable biomaterials for three-dimensional cell culture systems [14,16,17]. These biomaterials are also a useful support that facilitates cell carrying and surgical handling for implantation. The objective of this study was to evaluate the re-differentiation capacity of cultured chondrocytes on two bioresorbable non-woven biomaterials composed of hyaluronic acid benzyl esters: HYAFF-11, and its sulphated derivative, HYAFF-11S. We evaluated the effects of the two scaffolding materials on chondrocyte culture at the gene transcriptional and protein level.

2. Materials and methods 2.1. Biomaterials The biomaterials used are derived from the total esterification of hyaluronan with benzyl alcohol [18] and are referred to as HYAFF-11s. Sodium hyaluronate has an initial molecular weight of 200 kDa; the final product is a non-cross-linked linear polymer with an undetermined molecular weight and is insoluble in acqueous solutions. The polymer spontaneously hydrolyses with time, releasing benzylic alcohol and hyaluronan. The physical configuration of the biomaterial used was a non-woven mesh, a pad composed of a

random array of polymer fibres having a diameter of 40 mm. Two forms of these biomaterials were used: 1. HYAFF-11s: sodium hyaluronate benzyl ester [19]. 2. Sulphated HYAFF-11 (HYAFF-11-Ss): a sulphated HYAFF-11s derivative [20]. The biomaterial was sterilized by g-irradiation and provided in a 4
4 cm2 format by F.A.B. S.r.l. (FIDIA Advanced Biopolymers, Abano Terme, Italy). 2.2. Cell culture Primary culture of chick embryo chondrocytes was established as previously described with minor modifications [21]. Briefly, 16-day-old chick embryos were sacrificed and the sterna removed in aseptic conditions. Perichondrium was removed with a razor blade using a microdissection microscope. Sterna were then finely minced and digested with 1.5 mg/ml collagenase type I (Sigma Immunochemicals, St. Louis, MO) and 0.1% trypsin (GIBCO BRL, Gaithersburg, MD) in DMEM for 1 h at 37 C. Digested material was centrifuged at 1200 rpm for 5 min, and pellets were re-suspended in complete medium (DMEM supplemented with 10% fetal calf serum, 1% l-glutamine, 50 mg/ml l-ascorbic acid [Sigma], 1 ng/ml transforming growth factor-b1 (TGF-b1) [Calbiochem, CA], 1 ng/ml of insulin [Sigma], 1 ng/ml epidermal growth factor (EGF), [Sigma] and 10 ng/ml basic fibroblast growth factor (EGF) [Sigma]). Medium was changed every other day and cells were expanded on plastic for 1 week. The second passage of cells was used in the present experiment. Chick embryo chondrocytes were detached from the plastic flasks and biomaterials (1
1 cm) were hydrated with 30 ml of medium containing 105 cells. Cultures were then returned to the incubator, and after 1 h, 1.5 ml of complete medium was added to each capsule. Two preparations of chick embryo chondrocytes were used. Human articular chondrocytes were obtained from epiphyseal cartilage removed under sterile conditions from the femoral heads of three patients (80, 75 and 60 years old) with a history of trauma. To remove adherent fibrous tissues, the cartilage was incubated in Hank’s medium containing trypsin and collagenase type I (2 mg/ ml each) for 1 h at 37 C. The medium was discarded and the tissue fragments minced and digested overnight at 37 C in DMEM supplemented with 10% fetal calf serum, 1% l-glutamine and 0.5 mg/ml collagenase type I (Sigma Immunochemicals, St. Louis, MO). The released cells were filtered through a 70 mm nylon membrane. The cells were collected by centrifugation at 1200 rpm for 5 min and pellets were re-suspended in complete medium (see above). The medium was changed every other day and cells were expanded on plastic for 2 or 3 weeks. Again, the second passage of cells was used

D. Girotto et al. / Biomaterials 24 (2003) 3265–3275

in this experiment. The seeding of human cells on biomaterials was performed as described above for chick chondrocytes. 2.3. Proliferation test Cell proliferation rates were determined by the MTT (3-4,5-dimethylthiazol-2yl-2,5-diphenyltetrazolium bromide)-based cytotoxicity test using the Denizot and Lang method with minor modifications [22]. Briefly, supernatant was gently harvested from the multi-well tissue culture plate, and 1 ml of MTT solution (0.8 mg/ml in PBS) was added. Cultures were returned to the incubator and after 3 h, supernatant was again harvested. Each scaffold was then transferred to an Eppendorf microtube, and 1 ml of extraction solution (0.01 n of HCl in isopropanol) added. Eppendorf microtubes were vortexed vigorously for 5 min to allow total colour release from the scaffolds, centrifuged at 14,000 rpm for 5 min, and supernatants read at 534 nm. Three scaffolds for each patient at all experimental time points were used, while four scaffolds for each of two chick embryo sternal cells preparation at all experimental time points were used. 2.4. RT-PCR analysis Total RNA was isolated from chondrocytes under various culture conditions using the Trizol reagent (Gibco BRL, Rockville, MD, USA). Briefly, scaffolds were gently removed from multi-well culture plates and

3267

transferred to an Eppendorf microtube. Cells were lysed directly in the culture scaffold by addition of 1 ml of Trizol reagent and by passing a 18GX1 1/2 in 1.20
40 mm2 needle several times in the sample trough. RNA was subsequently isolated according to the manufacturer’s instructions. Complementary DNA (cDNA) was synthesized from different amounts of total RNA, depending on the sample, up to 500 ng, with a 50 min incubation at 37 C using M-MLV reverse transcriptase (Gibco BRL) and oligo-(dT) priming. Amplification was performed in a PTC-100TM thermocycler (MJ Research) using AmpliTaq Golds DNA polymerase (Applied Biosystems) with the primers shown in Table 1 using the following conditions: 95 C for 10 min followed by 95 C for 1 min (denaturation), 60 C for 1 min (annealing), 72 C for 1 min (extension) for a 23–34 cycle followed by one cycle of 72 C for 10 min. Some primers were designed by Primer3 software [23]. To perform a semi-quantitative analysis of samples, serial dilutions of cDNA were subjected to increasing PCR cycles in order to define the linear amplification range for each primer set. Twenty-five nanograms of each cDNA sample were then amplified at the optimal cycle number for each gene of interest: human Col1a1 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH): 23 cycles, human Sox9: 25 cycles, human Col10a1 and aggrecan: 31 cycles, human Col2a1: 34 cycles, chicken Col1a2 and Col2a1: 25 cycles, chicken Col10a1, Col9a1, and GAPDH: 23 cycles. RT-PCR products were resolved on a 1% agarose gel stained with ethidium bromide. Relative levels of PCR products were

Table 1 Primers utilized for RT-PCR amplification Gene

Primer sequence (50 -30 )

Expected product size

References

Human Col1a2

GGTGGTTATGACTTTGGTTAC CAGGCGTGATGGCTTATTTGT CTGCTCGTCGCCGCTGTCCTT AAGGGTCCCAGGTTCTCCATC AACTGGCAAGCAAGGAGACA AGTTTCAGGTCTCTGCAGGT GCCCAAGAGGTGCCCCTGGAATAC CCTGAGAAAGAGGAGTGGACATAC GGTTGTTGGAGCTTTCCTCA TAGCCTCCCTCACTCCAAGA AAACCACCTCTGCATTCCAC CCTCTGTCTCCTTGCAGGTC TGGTATCGTGGAAGGACTCATGAC ATGCCAGTGAGCTTCCCGTTCAGC TTACTCCTCGCGACTGTATGC GCTCACCAGGAACACCTTGAA CCATGCACGGCCGCCGCC GGGGCCAGGAGCACCCTT CAGCTGGCAGCCAGTCTTAGG CTCTGTCCAGCCTGCATTCGG AAGGGGCCACCACACTTTCTA TTCTCCAGGCTTCCCTATCCC AGAGGTGCTGCCCAGAACATCATC GTGGGGAGACAGAAGGGAACAGA

702

401

Johnstone et al., Exp Cell Res 1998;238:265–72 Johnstone et al., Exp Cell Res 1998;238:265–72 Bonaventure et al., Exp Cell Res 1994;212: 97–104 Johnstone et al., Exp Cell Res 1998;238:265–72 (Primer3)

501

(Primer3)

190

Blanco et al., J. Immunol 1995;154:4018–26 Nakata et al., FEBS 1992;299:278–82 Nakata et al., FEBS 1992;299:278–82 Nakata et al., FEBS 1992;299:278–82 Nakata et al., FEBS 1992;299:278–82 Yu et al., Development 2001;128:1005–13

Human Col2a1 (IIA, IIB form) Human Col2a1 Human Col10a1 Human Sox9 Human Aggrecan Human GAPDH Chicken Col1a2 Chicken Col2a1 Chicken Col9a1 Chicken Col10a1 Chicken GAPDH

432 (IIA) 225 (IIB) 621 703

480 245 (IIA) 210 (IIB) 413 552 220

3268

D. Girotto et al. / Biomaterials 24 (2003) 3265–3275

quantified by densitometric analysis using GelDoc software (BioRad). cDNA amplification for GAPDH was carried out to ensure that equal amounts of RNA were used in the RT-PCR reaction. Results were expressed as a percentage of the GAPDH signal. Two scaffolds for each of the two chick embryo sternal cell preparations were processed at all experimental time points for semi-quantitative RT-PCR analysis. Two scaffolds for each patient at all experimental time points were also processed. PCR amplification for each specimen was conducted in duplicate. 2.5. Immunohistochemical analyses Snap-frozen biomaterial scaffolds were sliced into sections of 5 mm, placed on gelatin-coated slides, and fixed with acetone for 10 min. Primary monoclonal antibodies against human collagen type II (1:100, Chemicon, California) and chicken collagen type II (1:100, Developmental Studies Hybridoma Bank, Iowa City, IA) were used. For human samples, sections were incubated with Tris-buffered saline (TBS: 10 mm Tris, 150 mm NaCl, pH7.4) containing 10% rabbit serum (Dako) for 30 min and anti-human collagen type II monoclonal antibody or anti-chick collagen type II monoclonal antibody in TBS for 1 h. Slides were then rinsed, incubated for 30 min in secondary rabbit antimouse antibody (Dako) diluted with TBS, rinsed again, treated with APAAP (Dako), and stained with Fast red (Sigma). Finally, samples were counterstained with hematoxylin. Negative control sections were obtained by omitting the primary antibody. 2.6. Statistical analysis Both MTT and semi-quantitative RT-PCR data were expressed as the mean7standard deviation. Student’s ttest was used to compare quantitative parameters. Differences with p value o0.05 were considered significant.

Fig. 1. Proliferation of human (A) and chicken (B) chondrocytes seeded onto HYAFF-11 and sulphated HYAFF-11 biomaterials. Data are expressed as mean optical density7standard deviation of one representative patient (A) and one representative chick embryo cell preparation (B).

o.d. values for human articular chondrocytes were comparable at 7 days, they were significantly different at 14 (po0:005) and 21 days (po0:005). With chick embryo sternal chondrocytes, this behaviour was confirmed at all time points. In particular, o.d. values relative to chondrocyte proliferation were significantly different even at 7 days when the absorbance ratio between sulphated and non-sulphated HYAFF-11 was 1.67 (po0:005). 3.2. mRNA expression

3. Results 3.1. Cell proliferation Similar patterns of human articular chondrocyte proliferation were obtained for all three patients. The results reported in Fig. 1A are relative to the 75-year old patient. Similar proliferation patterns were also obtained for the two preparations of chick embryo sternal chondrocytes. MTT readings associated with the biomaterials increased constantly with time, demonstrating that the cells continued to proliferate inside the interfibril spaces. Chondrocyte proliferation was highest when the sulphated HYAFF-11-S material was used. Although the

RNA isolated from human articular chondrocytes and chick embryo sternal chondrocytes cultured in Petri dishes, HYAFF-11 and sulphated HYAFF-11 biomaterials were subjected to semi-quantitative RT-PCR analysis. Figs. 2 and 3 illustrate significant agarose gel electrophoretic images of the RT-PCR products. For human articular chondrocytes, messenger RNA was isolated from monolayer culture at two time points: at the moment of the seeding of cells on biomaterials (adhesion 0 days) and at 21 days. Messenger RNA was also isolated after 21 days of three-dimensional culture on HYAFF-11 biomaterials. Fig. 4A illustrates that the collagen I gene showed a constant level of expression in

D. Girotto et al. / Biomaterials 24 (2003) 3265–3275

Fig. 2. mRNA expression as detected by RT-PCR in human chondrocytes cultured on HYAFF-11 and sulphated HYAFF-11 (HYAFF-11-S) for 3 weeks. RT-PCR analysis was performed also on monolayer culture at the moment of seeding on biomaterials (adhesion T0) and on monolayer culture at 21 days (adhesion). Representative results from one patient are visualized on a 1% agarose gel stained with ethidium bromide.

Fig. 3. mRNA expression as detected by RT-PCR in chick embryo chondrocytes cultured on HYAFF-11 and sulphated HYAFF-11 (HYAFF-11-S) at different experimental times. RT-PCR analysis was performed also on monolayer culture at the moment of seeding on biomaterials (adhesion T0) and on monolayer culture at 7, 14 and 21 days (adhesion). Representative results from one chick embryo cell preparation are visualized on a 1% agarose gel stained with ethidium bromide.

monolayer culture over a period of 21 days, while on HYAFF-11 biomaterials, collagen I was down-regulated. The collagen I gene signal in monolayer cultured

3269

cells at 21 days was 1.5-fold greater than the signal associated with sulphated HYAFF-11 (po0:005). In contrast, RT-PCR analysis of collagen type II expression (Fig. 4B) showed a down-regulation of collagen II in monolayer culture from 0 to 21 days, and an upregulation at 21 days post-seeding on HYAFF-11 and sulphated HYAFF-11 scaffolds. In particular, the analyses conducted with primers that allow the detection of the IIA and IIB variants (Table 1) showed that collagen IIB expression was associated with threedimensional culture conditions (Fig. 4C). Collagen type X gene expression was increased at 21 days both in monolayer cultured cells and HYAFF-11 cultured cells (Fig. 4D). The HYAFF-11 material was the most supportive for collagen type X induction, with a ratio between HYAFF-11 and monolayer culture greater than 1.5 (po0:005). Aggrecan gene expression was constantly maintained in three-dimensional cell culture and down-regulated in monolayer conditions (Fig. 4E). In particular, the associated signal after 21 days of monolayer culture was almost two-fold down-regulated with respect to the control (0 days of monolayer culture). Sox9 mRNA levels were constantly maintained in monolayer cultured cells over a period of 21 days and upregulated when chondrocytes were cultured on HYAFF-11 and HYAFF-11S (Fig. 4F). In order to study cartilage in vitro, gene modulation using a simple source of primary cells, chick embryo sternal chondrocytes were also utilized. Chick cartilage messenger RNA was isolated from monolayer and three-dimensional culture on biomaterials at several time points: at the moment of seeding the cells on biomaterials (adhesion 0 days) and at 7, 14 and 21 days of culture both in monolayer and three-dimensional conditions. Collagen type I expression increased from day 7 to 21 both in monolayer and three-dimensional culture (Fig. 5A). Collagen type II was detected in culture at the time of cell seeding on biomaterials (Fig. 5B). Collagen types IIA and IIB expression was present, with expression of type IIB collagen maintained for up to 21 days of monolayer culture, while type IIA expression was down-regulated after 14 days. Collagen type II expression was detected even after 7 days of both types of HYAFF-11 three-dimensional culture, where on the non-sulphated scaffold, the type IIA associated signal was 4.89 times higher than that associated with type IIB. At 14 days, the type IIA signal was absent, and at 21 days, the type IIB signal was maximally increased. In monolayer culture, collagen type IX expression was detected at 0 days and increased progressively up to 21 days (Fig. 5C). Although collagen type IX expression was already detectable at 7 days, it decreased in scaffold culture over time. Collagen type X, which was absent at the first time point (adhesion 0 days), was detected after as early as 7 days both in adhesion and scaffold culture. At 7 days, the associated signal of collagen type X was

3270

D. Girotto et al. / Biomaterials 24 (2003) 3265–3275

Fig. 4. Gene expression levels analysed by semi-quantitative RT-PCR in human chondrocytes cultured on HYAFF-11 and sulphated HYAFF-11 (HYAFF-11-S) biomaterials. Results are from three patients. Values are expressed as the mean7standard deviation.

almost 4 times higher than that associated with its nonsulphated counterpart. The results obtained from these semi-quantitative RT-PCR analyses are summarized in Table 2. 3.3. Histochemistry and immunohistochemistry Histochemical and immunohistochemical analysis for collagen type II, performed after 21 days of HYAFF-11 or sulphated HYAFF-11 chondrocyte culture, demonstrated no significant differences between these two types of scaffolding in either chick or human chondrocytes. Human chondrocyte-engineered cartilage had a white, glassy appearance (data not shown). As shown in Figs. 6A and B, chondrocytes adhered and organized around the biomaterial fibres. A large cluster of cells was visible at the top of the biomaterial, at the site of seeding, with smaller clusters visible at the periphery and at the base of the scaffold. These cells had a rounded appearance. Toluidine blue staining of sections showed that cell clusters were surrounded by abundant metachromatic extracellular matrix. A very intense and defined

staining with type II collagen monoclonal antibody was present around cells and non-woven fibres. Chick embryo sternal chondrocytes cultured on HYAFF-11 biomaterials seemed to be morphologically similar to human chondrocytes (Fig. 6C and D). Cells appeared rounded on these three-dimensional scaffolds, whereas chondrocytes cultured on plastic in monolayer appeared mostly polygonal (data not shown). Toluidine blue staining of sections showed that chondrocytes formed nodules where a glycosaminoglycan (GAG)rich, dense, positive, metachromatic substance was present. Collagen type II synthesis was confirmed with immunohistochemistry. An intense staining associated with nodules was observed. In particular, immunostaining seemed to be more intense at the periphery of the nodules.

4. Discussion In this study, HYAFF-11 and sulphated HYAFF-11 biomaterials were utilized as three-dimensional scaffolds

D. Girotto et al. / Biomaterials 24 (2003) 3265–3275

3271

Fig. 5. Gene expression levels analysed by semi-quantitative RT-PCR in chick embryo chondrocytes cultured on HYAFF-11 and sulphated HYAFF-11 (HYAFF-11-S) biomaterials. Results are from two primary cell preparations. Values are expressed as the mean7standard deviation. Table 2 Fold induction of gene expression as detected by RT-PCR analysis Inductiona HYAFF-11/Petri T0 Human gene Collagen type Collagen type Collagen type Collagen type Sox9 Collagen type Aggrecan Chicken gene Collagen type Collagen type Collagen type Collagen type Collagen type

I II IIA IIB X

I IIA IIB IX X

0.82 3.27 72.1 89.1 1.88 1.56 1.05

(p > 0:05) (po0:005) m (po0:005) m (po0:001) m (po0:005) m (po0:005) m (p > 0:05) -

2.2 (po0:01) m 0 (po0:001) k 0.9 (p > 0:05) 0.82 (p > 0:05) 24.0 (po0:05) m

Inductionb HYAFF-11S/Petri T0

Inductionc Petri T21/Petri T0

(po0:05) k (po0:005) m (po0:001) m (po0:001) m (po0:005) m (po0:001) m (po0:05) k

1.0 (p > 0:05) 0.34 (po0:005) k 1 (p > 0:05) 1 (p > 0:05) 1.0 (p > 0:05) 1.21 (po0:001) m 0.54 (po0:001) k

2.4 (po0:05) m 0.2 (po0:01) k 0.78 (p > 0:05) 0.95 (p > 0:05) 49.19 (po0:01) m

2.2 (po0:05) m 0 (po0:01) k 0.82 (p > 0:05) 2.7 (po0:005) m 8.43 (po0:01) m

0.67 2.92 42.8 82.6 1.69 1.22 0.84

-Absence of induction. mPositive induction. kNegative induction. a Induction is the ratio between the signal associated with HYAFF-11-chondrocyte constructs at 21 days of culture and the signal associated with chondrocyte monolayer culture at the moment of seeding on the biomaterial. b Induction is the ratio between signal associated with HYAFF-11-S-chondrocyte constructs at 21 days of culture and the signal associated with chondrocyte monolayer culture at the moment of seeding on the biomaterial. c Induction is the ratio between the signal associated with 21 days chondrocyte monolayer culture and the signal associated with chondrocyte monolayer culture at the moment of seeding on the biomaterial.

for the production of a functional cartilage construct. HYAFF-11 materials are biocompatible, biodegradable polymers derived from the benzyl esterification of

hyaluronate, the simplest of GAG, which is a component of the extracellular matrix and plays a part in a number of biological processes both in the embryo and

3272

D. Girotto et al. / Biomaterials 24 (2003) 3265–3275

Fig. 6. Histological characterization. (A,C) Immunolocalization of collagen type II (red colour) after 3 weeks of culture of human (A) (120X) and chick embryo (C) (120X) chondrocytes seeded onto HYAFF-11 non-woven meshes. Counterstaining with hematoxylin. (B,D) Cross-section of human (B) (120X) and chick embryo (D) (100X) chondrocytes grown onto HYAFF-11 non-woven biomaterials and stained with 1% toluidine blue after 3 weeks from seeding. Biomaterial fibres appear dark blue.

in adult organisms. Human articular chondrocytes from the cartilage of three patients of different ages (80, 75 and 60 years old) and chicken embryo sternal primary chondrocytes were isolated and cultured both on plastic in monolayers and on non-woven 20-mm-thick HYAFF fibre meshes. As shown by the MTT test, the biomaterials were a suitable culture environment for chondrocyte growth and proliferation, with constantly increasing MTT readings signifying that the cells continued to proliferate inside the interfibril spaces. Data showed that sulphated HYAFF-11 promoted the highest rate of chondrocyte proliferation. This was particularly evident with chick embryo sternal chondroblast cultures. In order to evaluate and compare gene expression in the in vitro culture systems, semi-quantitative RT-PCR analysis was performed on RNA isolated from the cells after several passages on plastic and following their transfer to hyaluronic acid-derived biomaterials at certain time points. When cultured on scaffolds, human cells up-regulated chondrocyte-specific genes such as collagen type II, collagen type X and Sox9. Collagen type I and aggrecan gene expression were constantly maintained for the entire period of three-dimensional culture. Conversely, human cells in monolayer culture for 21 days down-regulated collagen type II and aggrecan gene expression. It has been extensively demonstrated that when chondrocytes are grown in monolayer cultures, they proliferate but cease to express the specialized proteins of cartilage, becoming fibroblastic in appearance. In

particular, this de-differentiation process is characterized by a down-regulation of type II and activation of type I collagen synthesis. When transferred into suspension cultures, cells readily aggregate and cease synthesizing type I collagen while type II collagen secretion increases [24–27]. It is known that type II collagen is synthesized in two splice forms, types IIA and IIB. In humans, type IIA procollagen is an mRNA splice form that contains an additional 207 base pair exon (exon 2) that encodes the 69 amino acid cysteinerich domain of the NH2-propeptide [28,29]. Type IIA is synthesized by pre-cartilage and non-cartilaginous epithelial and mesenchymal cells [30,31], while type IIB collagen is synthesized by chondrocytes. In tissues undergoing chondrogenesis, the mRNA splice form switches from type IIA to IIB procollagen upon differentiation. In non-chondrogenic tissues, the synthesis of type IIA procollagen is transient. Zhu et al. demonstrated that during chondrogenesis in the limb, type IIA is synthesized as a procollagen retaining the cysteine-rich amino propeptide, and it is incorporated into fibrils and deposited into the extracellular matrix of pre-cartilaginous mesenchyme. They also demonstrated that the NH2-propeptide binds to TGF-b1 and BMP-2, hypothesizing that this interaction could potentially localize the factors capable of inducing chondrogenesis [32]. In this study, we demonstrated that the re-differentiation process that takes place on HYAFF-11 biomaterials involved the expression of the two splice variants:

D. Girotto et al. / Biomaterials 24 (2003) 3265–3275

collagen types IIA and IIB. From the analysis of human gene expression, a switch from type IIA to IIB was demonstrated in cultures on the sulphated Hyaff-11 biomaterial. It is of note that human chondrocytes in monolayer culture expressed collagen type X even at time 0 (baseline). Type X collagen is predominantly associated with hypertrophic cartilage and has often been seen as unique to that tissue. However, there have been an increasing number of reports of type X collagen as a component of normal articular cartilage. It was reported to be present in normal articular cartilage at the superficial zone [33] and was shown to be expressed by articular chondrocytes in culture [34–36]. In the present study, human Sox9 transcription factor gene expression was also found to be upregulated when cells were cultured in HYAFF three-dimensional cultures. In fact, the re-differentiation process with expression of typical marker genes and recovery of the chondrocytespecific phenotype has been shown to involve Sry-type high-mobility-group box (SOX) transcription factors [37]. Regulation of gene expression at the transcriptional level is a complex phenomenon. Some transcriptional factors are essential but not sufficient for the expression of specific genes. It is known that L-Sox5 and Sox6 cooperate with Sox9 in the activation of the enhancer for the a1 chain of collagen type II [38], and that Sox9 is also expressed in tissues other than cartilage and the relative condroprogenitor cells, including male gonads, neuronal tissues, heart and kidney [39–41]. A pattern of gene expression typical of re-differentiation was not observed in chick embryo sternal chondroblast cultures. Collagen type I increased in cartilagineous constructs and collagen type IX decreased in the same constructs. Conversely, type IX collagen mRNA increased in two-dimensional culture over time. Three- and two-dimensional cell cultures had a comparable level of type IIB expression at 21 days of culture. Collagen type X, which was absent at baseline, was detected even after only 7 days of culture. The instability of the chondrocyte phenotype remains a major problem that has resulted in inconsistencies among study findings. Despite this, in the present work, chondrocytes cultured on HYAFF-11 or sulphated HYAFF-11 biomaterials were found to sustain the expression of chicken cartilage genes including that for collagen types II, IX and X. At 21 days of culture, immunohistochemistry demonstrated an abundant production of collagen type II in human and chicken constructs at the protein level. Thus, the abovedescribed evidence for production of this collagen at the mRNA level was confirmed in tissues with this technique. In the past decade, numerous studies have been published on three-dimensional chondrocyte culture [37,42–47]. Nevertheless, the present study contributes to the understanding of in vitro chondrocyte phenotype

3273

modulation. In fact, a significant number of genes were monitored in three-dimensional culture for mRNA expression, including collagen types I, II, IX, X, aggrecan and Sox9. In contrast to previous reports, the present study evaluated the expression of collagen types IIA and IIB, then demonstrating the sustained expression of collagen type IIB in three-dimensional culture. Again, this is the first study in which the expression of Sox9 transcription factors was monitored in three-dimensional culture on hyaluronic acid-derived materials. In summary, these experiments have shown that HYAFF-11 and sulphated HYAFF-11 offer an excellent support for in vitro chondrocyte culture, generating a functional cartilage construct that expresses specific genes for collagen types II, IX, X and aggrecan. Expression of type II collagen, the primary cartilage marker, was confirmed at the protein level. As shown by the MTT test, sulphated HYAFF-11 promoted the highest rate of cell proliferation in both human and chicken cells. Chondrocytes grown in three-dimensional HYAFF-11 scaffolds demonstrated a gene expression characteristic of differentiation/re-differentiation, including an up-regulation of transcription factor Sox 9. This may prove to be an effective delivery system for chondrocyte cells for the treatment of articular cartilage defects, and an in vitro system for studying cartilage differentiation. Experiments are in progress to study human mesenchymal stem cell differentiation towards cartilage on these HYAFF-11 scaffolds.

Acknowledgements The authors would like to thank Fidia Advanced Biopolymers, who kindly provided the hyaluronic acid samples, and Dr. Karl McCullagh for critical readings of the manuscript. This work was supported by grants from the Italian National Research Council and Ministry of University and Scientific and Technological Research.

References [1] Buckwalter JA, Mankin HJ. Articular cartilage: degeneration and osteoarthritis, repair, regeneration, and transplantation. AAOS Instr Course Lect 1998;47:487–504 (Review). [2] Furukawa T, Eyre DR, Koide S, Glimcher MJ. Biochemical studies on repair cartilage resurfacing experimental defects in the rabbit knee. J Bone Jt Surg [Am] 1980;62-A:79–89. [3] Messner K, Gillquist J. Cartilage repair: a critical review. Acta Orthop Scand 1996;76:523–9. [4] Minas T, Nehrer S. Current concepts in the treatment of articular cartilage defects. Orthopedics 1997;20:525–38. [5] O’Driscoll SW. The healing and regeneration of articular cartilage. J Bone Jt Surg 1998;80A:1795:812.

3274

D. Girotto et al. / Biomaterials 24 (2003) 3265–3275

[6] Bentley G. Grafts and implants for cartilage repair and replacement. Crit Rev Biocompat 1989;5:245–67. [7] Homminga GN, Bulstra SK, Bouwmeester PM, Linden AJVD. Perichondrial grafting for cartilage lesions of the knee. J Bone Jt Surg 1990;72B:1003–7. [8] Otsuka Y, Mizuta H takagi K, Iyama K, Yoshitake Y, Nishikawa F, Hiraki Y. Requirement of fibroblast growth factor signaling for regeneration of epiphyseal morphology in rabbit full-thickness defects of articular cartilage. Dev Growth Differ 1997;39:143–56. [9] Sellers RS, Peluso D, Morris EA. The effect of recombinant human bone morphogenetic protein-2 (rhBMP-2) on the healing of full-thickness defects of articular cartilage. J Bone Jt Surg 1997;79A:1439–51. [10] Oldberg A, Antonsson P, Lindblom K, Heinegard D. COMP (cartilage oligomeric matrix protein) is structurally related to the thrombospondins. J Biol Chem 1992;267:22346–50. [11] de Crombrugghe B, Lefebvre V, Behringer RR, Bi W, Murakami S, Huang W. Transcriptional mechanisms of chondrocyte differentiation. Matrix Biol 2000;19:389–94 (Review). [12] Zhao Q, Eberspaecher H, Lefebvre V, De Crombrugghe B. Parallel expression of Sox9 and Col2a1 in cells undergoing chondrogenesis. Dev Dyn 1997;209:377–86. [13] Kulyk WM, Franklin JL, Hoffman L. Sox9 expression during chondrogenesis in micromass cultures of embryonic limb mesenchyme. Exp Cell Res 2000;255:327–32. [14] Vunjak-Novakovic G, Martin I, Obradovic B, Treppo S, Grodzinsky AJ, Langer R, Freed L. Bioreactor cultivation conditions modulate the composition and mechanical properties of tissue-engineered cartilage. J Orthop Res 1999;17:130–8. [15] Benya PD, Shaffer JD. Dedifferentiated chondrocytes reexpress the differentiated collagen phenotype when cultured in agarose gels. Cell 1982;30:215–24. [16] Sittinger M, Reitzel D, Dauner M, Hierlemann H, Hammer C, Kastenbauer E, Planck H, Burmester GR, Bujia J. Resorbable polyesters in cartilage engineering: affinity and biocompatibility of polymer fiber structures to chondrocytes. J Biomed Mater Res 1996;33:57–63. [17] Frenkel SR, Toolan B, Menche D, Pitman MI, Pachence JM. Chondrocyte transplantation using a collagen bilayer matrix for cartilage repair. J Bone Jt Surg Br 1997;79:831–6. [18] Rastrelli A, Beccaro M, Biviano F, Calderini G, Pastorello A. Clinical implant materials. In: Heimke G, Soltesz U, Lee AJC, editors. Advances in biomaterials, vol. 9. Amsterdam, The Netherlands: Elsevier, 1990. p. 199. [19] Rastrelli A, Beccaro M, Biviano F. Hyaluronic acid esters, a new class of semisynthetic biopolymers: chemical and physicochemical characterisation. Clin Implant Mater 1990;9:199–205. [20] Barbucci R, Magnani A, Casolaro M, Marchettini N, Rossi C, Bosco M. Modification of hyaluronic acid by sulphate groups insertion to obtain a heparin-like molecole. Part I. Characterisation and behaviour in acqueous solution towards H+ and Cu2+ ions. Gazz Chim Ital 1995;125:169–80. [21] Girotto D, Fabbro C, Braghetta P, Vitale P, Volpin D, Bressan GM. Analysis of transcription of the Col6a1 gene in a specific set of tissues suggests a new variant of enhancer region. J Biol Chem 2000;275:17381–90. [22] Denizot F, Lang R. Rapid colorimetric assay for cell growth and survival. Modifications to the tetrazolium dye procedure giving improved sensitivity and reliability. J Immunol Meth 1986;89: 271–7. [23] Rozen S, Skaletsky HJ. Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S, editors. Bioinformatics methods and protocols: methods in molecular biology. Totowa, NJ: Humana Press, 2000. p 365–86 (code available at http://www-genome.wi.mit.edu/genome software/ other/primer3.html.).

[24] Aulthouse AL, Beck M, Griffey E, Sanford J, Arden K, Machado MA, Horton WA. Expression of the human chondrocyte phenotype in vitro. In Vitro Cell Dev Biol 1989;25:659–68. [25] Archer CW, McDowell J, Bayliss MT, Stephens MD, Bentley G. Phenotypic modulation in sub-populations of human articular chondrocytes in vitro. J Cell Sci 1990;97:361–71. [26] Bonaventure J, Kadhom N, Cohen-Solal L, Ng KH, Bourguignon J, Lasselin C, Freisinger P. Reexpression of cartilage-specific genes by dedifferentiated human articular chondrocytes cultured in alginate beads. Exp Cell Res 1994;212: 97–104. [27] Castagnola P, Moro G, Descalzi-Cancedda F, Cancedda R. Type X collagen synthesis during in vitro development of chick embryo tibial chondrocytes. J Cell Biol 1986;102:2310–7. [28] Ryan MC, Sandell LJ. Differential expression of a cysteine-rich domain in the amino-terminal propeptide of type II (cartilage) procollagen by alternative splicing of mRNA. J Biol Chem 1990;265:10334–9. [29] Sandell LJ, Nalin AM, Reife RA. Alternative splice form of type II procollagen mRNA (IIA) is predominant in skeletal precursors and non-cartilaginous tissues during early mouse development. Dev Dyn 1994;199:129–40. [30] Sandell LJ, Morris N, Robbins JR, Goldring MB. Alternatively spliced type II procollagen mRNAs define distinct populations of cells during vertebral development: differential expression of the amino-propeptide. J Cell Biol 1991;114:1307–19. [31] Ng LJ, Tam PP, Cheah KS. Preferential expression of alternatively spliced mRNAs encoding type II procollagen with a cysteine-rich amino-propeptide in differentiating cartilage and nonchondrogenic tissues during early mouse development. Dev Biol 1993;159:403–17. [32] Zhu Y, Oganesian A, Keene DR, Sandell LJ. Type IIA procollagen containing the cysteine-rich amino propeptide is deposited in the extracellular matrix of prechondrogenic tissue and binds to TGF-beta1 and BMP-2. J Cell Biol 1999;144: 1069–80. [33] Rucklidge GJ, Milne G, Robins SP. Collagen type X: a component of the surface of normal human, pig, and rat articular cartilage. Biochem Biophys Res Commun 1996;224: 297–302. [34] Oettinger HF, Pacifici M. Type X collagen gene expression is transiently up-regulated by retinoic acid treatment in chick chondrocyte cultures. Exp Cell Res 1990;191:292–8. [35] Pacifici M, Golden EB, Iwamoto M, Adams SL. Retinoic acid treatment induces type X collagen gene expression in cultured chick chondrocytes. Exp Cell Res 1991;195:38–46. [36] Sanchez M, Gionti E, Pontarelli G, Arcella A, De Lorenzo F. Expression of type X collagen is transiently stimulated in redifferentiating chondrocytes pretreated with retinoic acid. Biochem J 1991;276:183–7. [37] Stokes DG, Liu G, Dharmavaram R, Hawkins D, PieraVelazquez S, Jimenez SA. Regulation of type-II collagen gene expression during human chondrocyte de-differentiation and recovery of chondrocyte-specific phenotype in culture involves Sry-type high-mobility-group box (SOX) transcription factors. Biochem J 2001;360:461–70. [38] Bi W, Deng JM, Zhang Z, Behringer RR, de Crombrugghe B. Sox9 is required for cartilage formation. Nat Genet 1999;22: 85–9. [39] Wright E, Hargrave MR, Christiansen J, Cooper L, Kun J, Evans T, Gangadharan U, Greenfield A, Koopman P. The Sry-related gene Sox9 is expressed during chondrogenesis in mouse embryos. Nat Genet 1995;9:15–20. [40] Ng LJ, Wheatley S, Muscat GE, Conway-Campbell J, Bowles J, Wright E, Bell DM, Tam PP, Cheah KS, Koopman P. SOX9 binds DNA, activates transcription, and coexpresses with type II

D. Girotto et al. / Biomaterials 24 (2003) 3265–3275

[41]

[42]

[43]

[44]

collagen during chondrogenesis in the mouse. Dev Biol 1997;183:108–21. Zhao Q, Eberspaecher H, Lefebvre V, De Crombrugghe B. Parallel expression of Sox9 and Col2a1 in cells undergoing chondrogenesis. Dev Dyn 1997;209:377–86. Quarto R, Dozin B, Bonaldo P, Cancedda R, Colombatti A. VI collagen expression is upregulated in the early events of chondrocyte differentiation. Development 1993;117:245–51. Kolettas E, Buluwela L, Bayliss M, Muir H. Expression of cartilage-specific molecules is retained on long-term culture of human articular chondrocytes. J Cell Sci 1995;108:1991–9. Saldanha V, Grande D. Extracellular matrix protein gene expression of bovine chondrocytes cultured on resorbable scaffolds. Biomaterials 2000;21:2427–31.

3275

[45] Roche S, Ronzi"ere M, Herbage D, Freyri A. Native and DPPA cross-linked collagen sponges seeded with fetal bovine epiphyseal chondrocytes used for cartilage tissue engineering. Biomaterials 2001;22:9–18. [46] Grigolo B, Lisignoli G, Piacentini A, Fiorini M, Pietro G, Giovanni M, Duca M, Alessandra P, Facchini A. Evidence for redifferentiation of human chondrocytes grown on hyaluronicbased biomaterial (HYAFF-11): molecular, immunohistochemical and ultrastructural analysis. Biomaterials 2002;23: 1187–95. [47] Ronziere MC, Roche S, Gouttenoire J, Demarteau O, Herbage D, Freyria AM. Ascorbate modulation of bovine chondrocyte growth, matrix protein gene expression and synthesis in threedimensional collagen sponges. Biomaterial 2003;24:851–61.