CSIRO PUBLISHING
www.publish.csiro.au/journals/is
Invertebrate Systematics, 2004, 18, 215–225
The systematics of freshwater crayfish of the genus Cherax Erichson (Decapoda:Parastacidae) in eastern Australia re-examined using nucleotide sequences from 12S rRNA and 16S rRNA genes D. H. N. MunasingheA,B, C. P. BurridgeA and C. M. AustinA,C A
School of Ecology and Environment, Deakin University, Warrnambool, Vic. 3280, Australia. B Department of Zoology, University of Ruhuna, Matara, Sri Lanka. C To whom correspondence should be addressed. Email:
[email protected]
Abstract. Nucleotide sequence data were used to re-examine systematic relationships and species boundaries within the genus Cherax from eastern Australia. Partial sequences were amplified from the 12S (~365 bp) and 16S (~545 bp) rRNA mitochondrial gene regions. Levels of intra- and inter-specific divergence for Cherax species were very similar between the two gene regions and similar to that reported for other freshwater crayfish for 16S rRNA. Phylogenetic analyses using the combined data provided strong support for a monophyletic group containing 11 eastern Australian species and comprising three well-defined species-groups: the ‘C. destructor’ group containing three species, the ‘C. cairnsensis’ group containing four species and the ‘C. cuspidatus’ group containing two species. Cherax dispar and C. robustus are distinct from all other species and each other. In addition, two northern Australian and a New Guinean species were placed in the ‘Astaconephrops’ group, which is the sistergroup to the eastern Australian Cherax lineage. Several relationships were clarified, including: the status of northern and southern C. cuspidatus as separate species; a close relationship between C. cairnsensis and C. depressus; the validity of C. rotundus and C. setosus as separate species and their close affinities with C. destructor; and the distinctiveness of the northern forms of Cherax. The analysis of the 12S rRNA and 16S rRNA data is highly concordant with the results of previous allozyme studies. Introduction The southern hemisphere freshwater crayfish, family Parastacidae, reach their highest diversity in Australia (Riek 1969; Crandall et al. 1999). An important component of this fauna is the species of Cherax, which are found widely throughout Australia and southern New Guinea. This genus has two centres of diversity at geographic extremes of the Australian continent: a group of six species is restricted to the south-west (Austin and Knott 1996; Austin and Ryan 2002); and a group of at least ten species occurs in eastern Australia (Austin 1996), with the highest diversity in southeastern Queensland. Cherax species also occur widely across northern Australia, with a moderate centre of diversity in the northern part of the Cape York, where three species occur (Riek 1969; Austin 1996). The last formal taxonomic review of Australian Cherax was by Riek (1969). Using allozyme and morphological data, Austin (1996) and Austin and Knott (1996) challenged many of the taxonomic conclusions of Riek (1969) and earlier taxonomists. Out of a total of 24 putative species of Cherax examined, Austin (1996) and Austin and Knott (1996) considered only 13 deserved recognition. They found © CSIRO 2004
morphological variation was high and often a poor guide to taxonomic relationships. Riek (1969) divided Cherax into several species-groups and indicated phylogenetic relationships within and between groups (Riek 1969: 875). Although Riek (1969) did not give formal taxonomic recognition to these groups, Holthuis (1996) has used one of them, ‘Astaconephrops’, as a subgenus for New Guinean species. Austin (1995) undertook a phylogenetic analysis of several Cherax species from throughout Australia, using both allozyme and morphological data. Although the level of homoplasy in both datasets was high and there were inconsistencies between the two sets of data, the analyses did suggest a major phylogenetic split between the eastern and western species of Cherax, which was at odds with the species-groups established by Riek (1969). All sources and kinds of data, be they morphological, behavioural or molecular, have their strengths and weaknesses in systematics (Hillis et al. 1996). Finding congruence among different kinds of data greatly increases the reliability of systematic conclusions. A source of data that is finding increasing application in systematic studies of a 10.1071/IS03012
1445-5226/04/020215
216
Invertebrate Systematics
wide variety of organisms, including freshwater crayfish, is the direct sequencing of mitochondrial DNA. The sequencing of the mitochondrial 16S gene region in particular has been extensively used in freshwater crayfish systematics, with utility at a range of taxonomic levels (Crandall 1996; Crandall and Fitzpatrick 1996; Versteegen and Lawler 1996; Crandall et al. 1999; Munasinghe et al. 2003). Of particular note are the results of a recent study of mitochondrial DNA variation in western Australian species of Cherax, which showed a close correspondence to those derived from allozyme data (Munasinghe et al. 2003), and a recent study of C. destructor using 16S sequences (Austin et al. 2003), which has helped to clarify taxonomic relationships that have not been satisfactorily resolved using allozyme and morphological data (Sokol 1988; Campbell et al. 1994; Austin 1996). Thus, the objective of this study is to extend the studies of Munasinghe et al. (2003) on the molecular systematics of Cherax in south-western Australian to species in eastern Australia. Specifically, this study uses sequences from the 12S rRNA (12S) and 16S rRNA (16S) mitochondrial gene regions to re-examine species boundaries and species-group definitions within Cherax from throughout eastern Australia within a phylogenetic framework. Systematic history Riek (1969) recognised 27 Australian species of Cherax, of which 17 were from northern and eastern Australia. The taxonomic history of eastern Australian Cherax has been dealt with in detail by Austin (1986, 1996). Austin (1996) reevaluated Riek’s (1969) classification of eastern and northern Cherax and considered that only eight out of 15 species deserved recognition. Relatively recently, three additional species, which were not examined by Austin (1996), have been described from northern Australia: C. nucifraga (Short 1991), C. cartalacoolah (Short 1993) and C. parvus (Short and Davie 1993). Much attention has been given to the taxonomic status of members of the C. destructor complex, which has been variously defined (Zeidler 1982; Sokol 1988; Campbell et al. 1994; Austin and Knott 1996; Austin et al. 2003). Riek (1969) considered the C. destructor complex to comprise four species: C. destructor, C. albidus, C. davisi and C. esculus. However, subsequent studies failed to support the recognition of C. davisi and C. esculus and the status of C. albidus remains unclear. Sokol (1988), using morphological and morphometric information, considered that C. albidus deserved recognition at the specific level, whereas Campbell et al. (1994) and Austin (1996), basing their views on genetic evidence, considered the species should be placed as a subspecies of C. destructor. Very recently, Austin et al. (2003) questioned the validity of recognising C. albidus at all. Riek (1969) divided Australian Cherax into five speciesgroups and provided a diagram (Riek 1969: 875) indicating relationships within and between groups based on a largely
D. H. N. Munasinghe et al.
intuitive assessment of morphological similarities, mostly related to the development of the rostral carinae, post-orbital ridges and spines on the carpus. Three of these groups are found in eastern Australia. Austin (1995) attempted to extend Riek’s (1969) efforts through numerical cladistic analyses of both morphological and allozyme data. Although there were several inconsistencies between Riek’s (1969) treatment and Austin’s (1995) analyses with respect to relationships among species, there was considerable homoplasy within both of Austin’s datasets. Nevertheless, the studies by Austin provide alternative hypotheses that can be evaluated in this study (see Munasinghe 2003 for further details). Crandall et al. (1999) provided evidence that Cherax is monophyletic using 16S data. However, the relationships among Cherax species in the study of Crandall et al. (1999) were generally unstable and varied depending on the method of phylogenetic analysis. Materials and methods Sample collection and DNA extraction Sampling methods for freshwater crayfish were the same as given in Austin and Knott (1996). Upon capture, whole crayfish were frozen in liquid N2 or on dry ice and subsequently stored at –20°C, or a tissue sample was taken by removing a leg or ~1 g of abdominal tissue and preserved in 95% alcohol. Voucher specimens were preserved in 75% alcohol and are held within the Deakin University decapod crustacean collection, Warrnambool. Where possible, samples were taken from locations sampled by Austin (1996) and at least two individuals were sequenced from each collecting site. Cherax parvus and C. punctatus samples were obtained from the National Museum of Queensland, Brisbane. Cherax rhynchotus sequences were obtained from specimens collected by Austin (1996). Sequences for the three outgroup samples, C. quinquecarinatus (Gray, 1845), C. cainii Austin, 2002 and C. preissii Erichson, 1846, were previously obtained by Munasinghe et al. (2003). GenBank accession numbers for three outgroup samples are AF492773, AF492781 and AF459037 for 12S and AF492803, AF492810 and AF492808 for 16S, for C. quinquecarinatus, C. cainii and C. preissii respectively. The use of Western Australian species as outgroups is justifiable on the basis of the results of Munasinghe et al. (2003, 2004). Sample localities and details are given in Table 1 and Fig. 1. PCR amplification and sequencing Total DNA was extracted using the protocol described by Crandall et al. (1999). A fragment of 16S mitochondrial gene was amplified using primer 1471 and 1472 (Invitrogen Australia, Pty Ltd, Melbourne, Australia) (Crandall et al. 1995). A fragment of the 12S gene was amplified using either L1085 and H1471 (Invitrogen Australia) (Kitaura et al. 1998) or 12DEF (5′GTGCCAGCAGTCGCGGTTAGA3)’ and 12DER (5′CCAGTACA CCTACTACT ATGTTACG3′) primers. The 12DEF and 12DER primers were designed by aligning 12S sequences obtained by T. T. T. Nguyen (unpublished) from C. destructor collected from western Victoria (Dwyers Creek) with 12S sequences of Penaeus monodon Fabricius, 1798 on GenBank (NC002184). PCR reaction volumes and thermalcycler parameters were the same as those employed by Munasinghe et al. (2003), except when using 12DEF and DER primers, where a 42°C annealing temperature was employed. PCR products were purified using a QIAGEN QIAquick PCR purification kit (Qiagen, Hilden, Germany). The samples were sent to Australian Genome Research Facility, Brisbane, Queensland or the Institute of Medical and Veterinary Science, Adelaide for sequencing. Sequencing
Molecular systematics of Cherax
Invertebrate Systematics
reactions followed the protocol for ABI dye terminator reactions (www.appliedbiosystems.com, accessed March 2004). For the majority of specimens, sequencing was conducted using both forward and reverse primers. Sequence analyses and phylogenetic reconstruction Sequence chromatograms were viewed using EditView (Perkin Elmer, Foster City, CA, USA) and edited using SeqPup (Gilbert 1997). Sequence alignments were performed using CLUSTAL X (Thompson et al. 1997), with multiple alignment parameters of fixed gap penalty equal to 10, gap extension equal to 6, pairwise parameter of gap penalty equal to 5 and k-tuple equal to 2, followed by slight modifications by eye. The alignment of hyper-variable regions was made with reference to the 12S rRNA secondary structure of Drosophila virillis (Page 2000) and 16S rRNA secondary structures of Daphnia pulex (Crease 1999). Deoxyribonucleic acid sequences have been deposited in GenBank (accession numbers for 12S, AY191720–AY191747 and for 16S, AY191748–AY191775). Systematic analyses were carried out using PAUP*4.0b4a (Swofford 2000). The suitability of pooling sequence data from the two
Table 1.
gene regions for phylogenetic reconstruction was assessed by the incongruence length difference test (ILD) (Farris et al. 1994). The phylogenetic information content of the datasets was evaluated by the skewness statistics (g1) from 1000 randomly generated tree length distributions (g1 < 0.01) (Hillis and Huelsenbeck 1992). Three different tree construction methods, minimum evolution (ME), maximum likelihood (ML) and maximum parsimony (MP), were used. For ME and ML analyses, the most appropriate model of nucleotide substitution sequence evolution was determined using Modeltest 3.04 (Posada and Crandall 1998). Maximum likelihood analyses were carried out using the heuristic search option. Maximum parsimony analyses were carried out using full heuristic search with 10 replicates of random stepwise sequence addition and the tree–bisection–reconnection algorithm, with gaps treated as missing data. To evaluate the consistency of nodes, 1000 bootstrap replicates were used in MP and ME analyses and 100 replicates for the ML analysis. Species boundaries In this study, species are delimited within a phylogenetic framework, which is consistent with the view that species are lineages (Shaw
Sample codes and collecting localities for ingroup and outgroup taxa using the classification supported by this study (see Fig. 1).
Species
Code
Locality
C. cairnsensis
GLA GRE MTC STO BAL CAM KEM LAH1 LAH2 POM BEL CAL GAP DWY FIN MUT NOK BEL GAP CAL MAR OXL OLE MOT FLI HOW JAR BRI BAR KAR UFF NEG
South-west of Gladstone, Queensland North of Proserpine, Queensland North-east of Mt. Charlton, Queensland South-west of Rockhampton, Queensland South-west of Ballina, New South Wales North of Camden Haven River, New South Wales West of Kempsey, New South Wales West of Lake Haiwatha, New South Wales 5 km north-east of LAH1 North of Port Macquarie, New South Wales North-west of Brisbane, Queensland South of Caloundra, Queensland West of Brisbane, Queensland North of Dunkeld, Victoria Finke River, Northern Territory Muttaburra, Queensland North of Kilcoy, Queensland North-west of Brisbane, Queensland West of Brisbane, Queensland South of Caloundra, Queensland North-west of Maryborough, Queensland Oxley Creek, Queensland O’leary Creek, north-east Queensland Mount Mothar, Queensland Flinders River, Queensland Howard River, Northern Territory Jardine River, Queensland Bribie Island, Queensland Barmah Forest, Victoria North of Karuah, New South Wales Uffington State Forest, New South Wales Southern New Guinea
C. cuspidatus
Cherax sp. nov.
C. destructor albidus C. d. destructor
C. depressus C. dispar
C. parvus C. punctatus C. quadricarinatus C. rhynchotus C. robustus C. rotundus C. setosus Cherax sp. Outgroup taxa: C. preissii C. quinquecarinatus C. cainii
217
Kalgan River, Western Australia Canning River, Western Australia Scott River, Western Australia
218
Invertebrate Systematics
2001). Specifically, we adopt the protocol of Wiens and Penkrot (2002) for delimiting species using phylogenetic analysis (see Fig. 1).
Results Partial 12S and 16S gene regions sequences ~365 and 545 bp in length, respectively, were assembled from 14 Australasian crayfish species sampled from 31 locations (Table 1). The amplified regions were correspondent with the nucleotide positions of 14319–14559 for the 12S gene region and 13353–12848 for the 16S gene region of the Drosophila yakkuba genome (GenBank accession no: NC001322). The characteristics of the two datasets are summarised in Table 2. Matrices of pairwise sequence divergence between all species for each gene region are given in Munasinghe (2003) and are available as Accessory Material on the Invertebrate Systematics website. Divergence levels estimated from the two gene levels were very similar and inter-specific levels of divergence were approximately five times greater than intra-specific divergence levels (Table 2). Individual datasets indicated significant phylogenetic signal with and without the outgroup taxa (Table 2), as did the combined dataset (g1 = 0.66 and 0.88 with and without outgroup taxa respectively). The ILD test failed to reject congruence between the 12S and 16S datasets (P = 0.06). Although the ILD test has been
D. H. N. Munasinghe et al.
criticised in recent studies as being overly conservative (Darlu and Lecointre 2002; Baker and Lutzoni 2002), we feel the combination of data from 12S and 16S genes is further justified because the two genes are functionally the same and all genes in the mitochondrial genome are linked and therefore share the same phylogenetic history (Wiens 1998). The combined dataset comprised 913 bp of which 257 were parsimony informative. Modelltest identified HKY+I+G (Hasegawa–Kishino–Yano + proportion of invariable sites + gamma distribution) as the optimum model of sequence evolution for the combined dataset (A = 0.3244, C = 0.0977, G = 0.2056, t = 0.3724, gamma shape parameter = 0.77, proportion of invariable sites = 0.45, Tr/Ts = 3.7002). The tree topologies derived from ME, MP and ML tree construction methods were completely consistent with respect to the recognition of 13 Australian species and four species-groups identified as the ‘C. cuspidatus’, ‘C. cairnsensis’, ‘C. destructor’ and ‘Astaconephrops’ species-groups, which received high bootstrap support (Fig. 2). Most of the conflict among trees, or lack of resolution within trees, derived from the three construction methods is with respect to deeper-level relationships. The only deeperlevel relationship that received strong support was the monophyly of the ‘eastern’ Cherax, which forms the sisterclade to the ‘northern’ Cherax species (the ‘Astaconephrops’ group). The relationship among each of the other three species-groups and the C. dispar and C. robustus lineages could not be established with any confidence, with topoTable 2. Summary of sequence characteristics of from two mitochondrial gene regions estimated from 14 species of Cherax from northern and eastern Australia and New Guinea and three outgroup taxa Characters
Fig. 1. Sample collecting sites for Cherax in eastern Australia. Species represented by samples collected north of the line labelled ‘A’ are referred to as ‘northern’ Cherax and those from south of this line are referred to as ‘eastern’ Cherax.
Number of base pairs % Variable sites All samples Ingroup samples A+T% Transition/transversion Intra-specific level Inter-specific level % Average divergence Intra-specific level Inter-specific level Skewness All samples Ingroup samples Parsimony informative sites All samples Ingroup samples Model of evolution
12S rRNA
16S rRNA
368
545
32.61 30.16 73.48
37.61 33.58 67.07
4.05 3.76
2.64 1.89
1.77 9.74
1.57 10.19
–0.61 –0.65
–0.59 –0.65
91 89 GTR+G
166 152 K81uf+I+G
GTR, General time reversible; G, gamma distribution; K81uf, Kimura 1981 unequal base frequencies; I, proportion of invariable sites.
Molecular systematics of Cherax
logies differing among analyses and clades receiving less than 50% bootstrap support. The level of divergence within and between species and between species-groups was very similar for the two gene regions (Table 2). Uncorrected divergence within species ranged up to 3.39% for 12S and 3.57% for 16S sequence, and divergence among Cherax species ranged up to 16.21% for 12S and 15.83% for 16S sequences. The relationships within each species-group are examined in more detailed below. ‘Cherax cuspidatus’ species-group Two well-defined lineages are apparent within the C. cuspidatus species-group (Fig. 2). A southern one, comprising the New South Wales samples (LAH, CAM, POM, CAM, BAL), is referred to as C. cuspidatus and a northern one, comprising the samples from south-east
Invertebrate Systematics
219
Queensland (CAL, GAP, BEL), represents an undescribed species (Cherax sp. nov.). The maximum likelihood analysis placed C. robustus within the C. cuspidatus species-group clade, but this arrangement received only limited bootstrap support (31%). ‘Cherax cairnsensis’ species-group This group contains four well-defined species: C. cairnsensis, C. depressus, C. parvus and C. punctatus (Fig. 2). Cherax depressus and C. cairnsensis showed the highest level of inter-specific similarity between pairs of sequences in this study. The four samples of C. cairnsensis showed a relatively high level of genetic similarity and are grouped together on the basis of geography. Cherax parvus, with a restricted distribution near Tully in northern Queensland, is the most divergent species of this group.
Fig. 2. The minimum evolution tree derived from the combined dataset, estimated using a HKY+I+G model of evolution. The bootstrap values (> 50%) in bold are for the ME analysis. Bootstrap values for maximum parsimony (MP) and maximum likelihood (ML) analyses are given in parentheses (MP/ML).
220
Invertebrate Systematics
D. H. N. Munasinghe et al.
‘Cherax destructor’ species-group The samples within the C. destructor-group form four distinct lineages: C. rotundus (BAR), C. setosus (UFF, KAR), C. d. destructor (NOK, FIN, MUT) and C. d. albidus (DWY). Despite their wide geographic range, the samples of the C. d. destructor lineage show very limited divergence. The two most closely related species in this group are C. rotundus and C. setosus, which are geographically separated by the Great Dividing Range. ‘Astaconephrops’ species-group The three species in this group, C. quadricarinatus, C. rhynchotus and Cherax. sp. (New Guinea), form a wellsupported monophyletic group. The two C. quadricarinatus samples show minimal divergence, although sampled from over 2000 km apart and considered by Riek (1969) to be separate species. Discussion Species delineation Using a lineage-based approach to the identification of species (Shaw 2001; Wiens and Penkrot 2002), the phyloTable 3.
genetic analyses of 12S and 16S sequences is consistent with the recognition of 11 species within the genus Cherax in eastern Australia, as summarised in Table 3. The samples of each of these taxa either form monophyletic groups supported by high bootstrap values or, if represented by a single sample, a high level of divergence and a sister-group relationship with a clade containing one or more distinct species. The degree of divergence at the 12S and 16S gene regions, is similar to that found in other decapod crustaceans, including freshwater crayfish. As an example for 16S, Machado et al. (1993) determined nucleotide sequence divergence between two species of Penaeus to be 11.1%, Saver et al. (1998) found an average value of 7.3% between three species of Panulirus and Grandjean et al. (2000) and Crandall (1996) found from 4–7% divergence in European and northern American freshwater crayfish. Palumbi and Benzie (1991) found a similar level of divergence (9.6%) between Penaeus species for 12S sequences. Despite being distributed over a much larger geographic area, the nucleotide divergence levels among the southerly distributed eastern species of Cherax are in general similar to those observed among the south-western species of Cherax studied by Munasinghe et al. (2003) for both gene
Classifications of the eastern and northern Australian species of Cherax largely after Riek (1969) and Austin (1996) and a classification supported by this study
After Riek (1969) *Subsequently described
After Austin (1996)
Present study
Geographic region (sample codes)
C. albidus Clark, 1936 C. barretti Clark, 1941A C. bicarinatus Gray, 1845 C. cairnsensis Riek, 1969 *C. cartalacoolah Short & Davie, 1993A C. cuspidatus Riek, 1969 C. davisi Clark, 1941B C. destructor Clark, 1936 C. gladstonensis Riek, 1969 C. depressus Riek, 1951 C. dispar Riek, 1951 C. esculus Riek, 1956B C. neopunctatus Riek, 1969 *C. nucifraga Short, 1991A *C. parvus Short & Davie, 1993 C. punctatus Clark, 1936C C. punctatus Clark, 1936C C. quadricarinatus (von Martens, 1868) C. robustus Riek, 1951 C. rhynchotus Riek, 1951 C. rotundus Clark, 1941 C. rotundus setosus Riek, 1951D C. urospinosus Riek, 1969E C. wasselli Riek, 1969A
C. d. albidus – C. quadricarinatus C. cairnsensis – C. cuspidatus C. d. destructor C. d. destructor C. cairnsensis C. depressus C. dispar C. d. destructor C. cuspidatus – – C. punctatus C. cuspidatus C. quadricarinatus C. robustus C. rhynchotus – C. destructor rotundus – C. wasselli
C. d. albidus – C. quadricarinatus C. cairnsensis – C. cuspidatus C. d. destructor C. d. destructor C. cairnsensis C. depressus C. dispar C. d. destructor C. cuspidatus – C. parvus C. punctatus Cherax sp. nov. C. quadricarinatus C. robustus C. rhynchotus C. rotundus C. setosus – –
Eastern (DWY) Northern Northern (HOW) Eastern (GLA, GRE, MTC, STO) Northern Eastern (KEM, POM, CAM) Eastern Eastern (FIN, MUT, NOK) Eastern (STO, GLA) Eastern (BEL, GAP) Eastern (CAL, MAR, OXL) Eastern Eastern (BAL, LAH1, LAH2) Northern Eastern (OLE) Eastern (MOT) Eastern (CAL, GAP, BEL) Northern (FLI) Eastern (BRI) Northern (JAR) Eastern (BAR) Eastern (KAR, UFF) Eastern Northern
ATaxon not sampled in this study, BTaxon not sampled but see Sokol (1988) and Austin et al. (2003), CRiek applied the name C. punctatus to a different taxon to that described by Clark (1936). DRiek originally described a species from the Newcastle region as C. rotundus setosus (Riek, 1951), but later (Riek 1969) synonymised this species with C. rotundus Clark, 1941. ETaxon known only from type locality in inner suburb of Brisbane and now extinct at this location.
Molecular systematics of Cherax
regions. The genetic distances between the northern and the eastern species and between the outgroup species from Western Australia are much greater and range up to values that are typical of inter-generic comparisons of northern hemisphere freshwater crayfish (Crandall and Fitzpatrick 1996) and other decapods (Murphy and Austin 2002). The most closely related taxa identified in this study are C. d. destructor and C. d. albidus, which differ by 3.68% and 2.20% for 12S and 16S, respectively, and C. depressus and C. cairnsensis, which differ by 3.95% and 1.88% for 12S and 16S respectively. These 16S values fall within the range observed for subspecies of other freshwater crayfish and decapod crustaceans (Saver et al. 1998; Grandjean et al. 2000). The magnitude of nucleotide sequence divergence can and has been used to assist in the determination of taxonomic standing in freshwater crayfish (Crandall et al. 2000; Grandjean et al. 2000) and other organisms (Avise 1994). However, there is no accepted amount of sequence divergence for these mtDNA sequences that equates to different levels of taxonomic rank and, because discrepancies can exist between gene trees and organismal trees derived from mitochondrial DNA, it is important to make comparisons with other kinds of data for the same species (Grandjean et al. 2000). The results of this study can be compared with the results of allozyme and morphological studies conducted by Austin (1996) on Cherax from northern and eastern Australia. The delineation of species and comparison of the results of the current study with that of Austin (1996) are discussed below according to species-groups. ‘Cherax cuspidatus’ species-group The samples of the C. cuspidatus-group, as defined in the present study, represent a distinct and well-defined lineage comprising two well supported sister-clades of three northern samples from southern Queensland v. the southern samples from northern New South Wales (Fig. 2). The degree of divergence between the two clades (4.80%–6.78% for 12S and 8.13%–9.82% for 16S) falls within the range seen for inter-specific comparisons in this and other studies of decapod crustaceans including freshwater crayfish (Crandall 1996; Grandjean et al. 2000; Munasinghe et al. 2003). Recognition of these two clades at the species level is therefore consistent with these studies. This position is also consistent with allozyme and morphological data (Austin 1996) and previous taxonomic treatments. Riek (1969) identified the freshwater crayfish species from southern Queensland that correspond to the northern lineage (samples: CAL, GAP and BEL) as C. punctatus. However, the name C. punctatus applies to an entirely different species as confirmed in this study (see also Austin 1996). Thus, these samples represent a ‘new’, yet to be named species and the species-group has been re-named ‘C. cuspidatus’ rather than ‘C. punctatus’.
Invertebrate Systematics
221
Cherax from coastal New South Wales were placed into three species by Riek (1969): C. rotundus, C. cuspidatus and C. neopunctatus (Riek 1969). The status of C. rotundus is discussed within the context of the C. destructor-group below. The six samples collected from within the distributional range of C. cuspidatus (KEM, POM, CAM) and C. neopunctatus (LAH1, LAH2, KEM) in this study all appear to belong to a single species based on the relatively low levels of nucleotide divergence (Fig. 2). These observed levels of divergence are low (1.33–2.54% for 12S and 0.94–3.20% for 16S) compared to that seen for comparison between species (3.70–16.20% for 12S and 2.20–14.50% for 16S). Other than the samples obtained from near Ballina, a location from which Riek (1969) recorded C. neopunctatus being somewhat distinctive, there is no evidence to support the occurrence of more than a single species of Cherax in north-eastern New South Wales. Evidence for two species within the C. cuspidatus-group, and the failure to distinguish between C. neopunctatus and C. cuspidatus, is also entirely consistent with morphology, allozyme data and biogeography (Austin 1996). In relation to biogeography, it is noteworthy that the distributions of Cherax sp. nov. (C. punctatus of Riek (1969)) in southern Queensland and C. cuspidatus in northern New South Wales are separated by the McPherson Range, which extends to the coast and is a well established biogeographic barrier to coastal species (James and Moritz 2000). Allozyme analyses also identified significant genetic differences between samples of Cherax sp. nov. and C. cuspidatus (Austin 1996), although the extent of these differences were intermediate between those normally seen for intra- and inter-specific comparisons (Thorpe 1982). ‘Cherax cairnsensis’ species-group The C. cairnsensis-group as defined in this study consists of four species: C. cairnsensis, C. depressus, C. punctatus and C. parvus. This is the first study to confirm that C. punctatus as described by Clark (1941) is a distinct species based on molecular data. The species referred to by Riek (1969) as C. punctatus is shown to be an unrelated species that has yet to be named within the C. cuspidatus species-group (see above). The degree of divergence of the single sample of C. punctatus available to this study relative to the other members of this group (5.22%–11.62% for 12S and 5.34–10.76% for 16S) falls within the range of inter-specific nucleotide divergence levels seen in Cherax and other decapod crustaceans. These results are consistent with the morphological analyses of Austin (1996), who found this species to be highly distinct. Cherax parvus, the smallest species of Cherax so far recorded and known from only a limited geographic area (Short and Davie 1993), is the most divergent species within this group (and within the eastern Cherax more generally).
222
Invertebrate Systematics
In contrast to the genetic distinctiveness of C. parvus and C. punctatus, the samples of C. cairnsensis and C. depressus, which form well-supported monophyletic groups, show a high level of genetic similarity. The divergence levels between the two species for 16S falls with in the range usually associated with the more divergent conspecific populations (1.51%–2.83%) and the values for 12S fall within the range seen for the most closely related species of Cherax in this study (3.38%–4.51%). Cherax cairnsensis and C. depressus are morphologically similar (Riek 1969; Austin 1996) and allopatric, so synonymising C. depressus with C. cairnsensis could be justified. However, Austin (1996) found that the two species showed fixed differences at several allozyme loci, which occurred abruptly between the species in south-eastern Queensland (Austin 1996: fig. 3). Riek (1969) also recognised an additional species within the C. cairnsensis group, C. gladstonensis, which is represented in this study by two samples from near Gladstone in south-east Queensland (GLA) and Struck Oil creek (STO) to the north. These samples are not highly distinctive, an outcome entirely consistent with allozyme and morphological data (Austin 1996). Cherax dispar The three samples of C. dispar analysed in this study form a strongly supported monophyletic group, which is quite divergent from all other eastern species of Cherax. This finding is consistent with the taxonomic treatments of Riek (1951, 1969) and entirely congruent with the results of Austin (1996), who found the species to be electrophoretically and morphologically distinct. Riek (1951) also divided C. dispar into three subspecies, an arrangement that is not supported by either the nucleotide or allozyme data (Austin 1996). However, both the present study and Austin’s (1996) study indicate that the most northerly sample (MAR) is differentiated from the southern samples, which together show few differences in either allozyme frequencies or nucleotide divergence. The degree of divergence between MAR and the southern samples is similar to that between the subspecies C. d. destructor and C. d. albidus. Thus, an additional fine-scale study of genetic and morphological relationships among C. dispar populations is warranted. The relationship of Cherax dispar to other eastern Cherax is uncertain based on the analyses presented in Fig. 2. However, consistent with allozyme data (Austin 1995, 1996), it is apparent that C. dispar is not closely related to C. cuspidatus nor does it show affinities with western Australian Cherax species, as suggested by Riek (1969).
D. H. N. Munasinghe et al.
C. esculus and C. davisi do not deserve recognition at the species level and that C. destructor and C. albidus are separate taxa (Sokol 1988; Campbell et al. 1994; Austin 1996). However, there is disagreement concerning at what level the latter two taxa should be recognised (Sokol 1988; Campbell et al. 1994; Austin 1996) and even if they should be distinguished at all (Austin et al. 2003). Further, Austin et al. (2003) recommended that C. setosus (formally referred to as C. rotundus setosus by Riek (1951), C. rotundus by Riek (1969) and C. destructor rotundus by Austin (1996)) should be recognised at the species level and that C. rotundus is a distinct species presently only recorded from a restricted region of Victoria. The addition of 12S sequences, and the analysis of samples from these species within the larger systematic context of Cherax diversity in eastern Australia, supports these designations and indicates that these three species form a taxonomically well-defined monophyletic group. As a consequence of the close similarity of these three species, it is appropriate to include C. setosus and C. rotundus within the ‘C. destructor’ species-group. The nucleotide divergence levels among these three taxa are relatively low (6.47%–7.30% for 12S and 5.01%–6.41% for 16S), but are greater than the highest intra-specific levels of divergence in this study and consistent with inter-specific levels observed among other closely related freshwater crayfish species (Crandall et al. 1999; Grandjean et al. 2000; Fetzner and Crandall 2001). Allozyme data support both the close relationships among C. destructor, C. setosus and C. rotundus and their status as distinct taxa. Austin (1996) found C. setosus and C. destructor to be distinct at five out of 32 allozyme loci and recent studies (C. M. Austin unpublished data) have shown that C. rotundus and C. destructor display fixed allozyme differences in sympatry. Cherax destructor is the most widespread species of Cherax, so the limited degree of intra-specific nucleotide divergence is somewhat surprising, but consistent with allozyme data. Cherax robustus On the basis of the extent of nucleotide divergence (7.62%–9.92% for12S and 9.38%–10.96% for 16S), C. robustus appears to be a valid species. This species was not included by Austin (1996) in his allozyme study but can be readily identified taxonomically by its propodal setation (Riek 1969; Austin 1996). Although this species is otherwise not particularly distinct morphologically, it is ecologically distinctive, being restricted to sandy, coastal aquatic habitats, mostly lakes and swamps that are often influenced by humic acids.
‘Cherax destructor’ species-group
‘Astaconephrops’ species-group
Originally, Riek (1969) identified four species within the ‘C. destructor’ species-group: C. destructor, C. albidus, C. esculus and C. davisi. The consensus of opinion is that
Samples of two species of Cherax from northern Australia, C. quadricarinatus and C. rhynchotus, and an undescribed species from New Guinea, are all distinct from each other
Molecular systematics of Cherax
(Fig. 2) and form a well-supported monophyletic lineage, which is sister to all samples of Cherax that occur to the south. The finding that C. quadricarinatus and C. rhynchotus represent distinct sister-species is consistent with phenetic and cladistic analyses of allozyme and morphological data (Austin 1995, 1996). In addition, finding that the northern species of Australian Cherax are well differentiated from the more southerly distributed species, as defined by line ‘A’ on Fig. 1, is consistent with phenetic analyses of allozyme data (Austin 1995, 1996). Taxonomic congruence and the value of multiple datasets Congruence between different kinds of data greatly strengthens the basis for taxonomic and phylogenetic inference. It also allows an assessment of the relative value or utility of data derived from different sources and the veracity of analyses using different methods (Bull et al. 1993; Cunningham 1997). The present study, together with that of Munasinghe et al. (2003), on the molecular systematics of Cherax from the south-west of Western Australia enables comparisons with systematic studies based on allozyme and morphological analyses (Austin 1996; Austin and Knott 1996) and traditional morphological studies (Riek 1967, 1969). Such comparisons are important because (1) the value or interpretation of different kinds of data often come into question and (2) both morphological and molecular data have potential limitations and therefore complete reliance on one type of data can lead to erroneous taxonomic conclusions. For example, the relative value of allozyme and morphological data has been challenged with respect to the systematics of freshwater crayfish in northern America and Australia (Fetzner 1996) and specifically in relation to the delineation of Cherax species (Sokol 1988; Lawrence et al. 2002). A very high level of agreement was seen between the allozyme and mitochondrial DNA data with respect to the delineation of almost all species common to the present study and the studies of Austin (1996) and Austin and Knott (1996). This indicates both kinds of data are providing useful systematic information and that a high degree of confidence can be placed in the systematic conclusions derived from the two kinds of data. This is important given the reliance being placed on the use of allozyme and, to a lesser extent, nucleotide data for determining or testing species boundaries in freshwater crayfish (Horwitz 1990; Zeidler and Adams 1990; Grandjean et al. 2000; Hansen et al. 2001; Austin and Ryan 2002). Conclusion The nucleotide sequences from the 16S and 12S mtDNA for eastern species of Cherax have confirmed the majority of the taxonomic conclusions derived from allozyme data and, in some cases, clarified the status of taxa where it has been uncertain. All extant putative species recorded from eastern
Invertebrate Systematics
223
Australia have now been examined using mtDNA and 11 species can be confidently identified, including one that has yet to be formally described. This and other recent nucleotide studies (Austin et al. 2003; Munasinghe et al. 2003), together with allozyme and morphologically based studies (Austin 1996; Austin and Knott 1996) confirm the utility of mtDNA and allozyme data for systematic studies of freshwater crayfish. These studies now need to be extended to clarify taxonomic relationships of the ~20 putative species of Cherax that have been described from northern Australia and southern New Guinea. Acknowledgments D. H. N. Munasinghe was supported by Deakin University Research Scholarships for International Students (DURSIS). We would like to thank Natalie Baker, Bob Collins, Lachlan Farrington, Paul Jones, Chris Lukhaup, Nick Murphy and Thuy Nguyen for assistance in obtaining samples for this study. Funding for this study was provided by a Deakin University internal grant to CMA. Comments and suggestions by three anonymous reviewers were appreciated and helped improve the final manuscript. References Austin, C. M. (1986). ‘Electrophoretic and Morphological Systematic studies of the genus Cherax (Decapoda: Parastacidae) in Australia.’ PhD Thesis. (Department of Zoology, University of Western Australia: Perth, Australia.) Austin, C. M. (1995). Evolution in the genus Cherax (Decapoda: Parastacidae) in Australia: a numerical cladistic analyses of allozyme and morphological data. Freshwater Crayfish 8, 32–50. Austin, C. M. (1996). Systematics of the freshwater crayfish genus Cherax Erichson (Decapoda: Parastacidae) in northern and eastern Australia: electrophoretic and morphological variation. Australian Journal of Zoology 44, 259–296. Austin, C. M., and Knott, B. (1996). Systematics of the freshwater crayfish genus Cherax (Decapoda: Parastacidae) in south western Australia: electrophoretic, morphological and habitat variation. Australian Journal of Zoology 44, 223–258. Austin, C. M., and Ryan, S. G. (2002). Allozyme evidence for a new species of freshwater crayfish of the genus Cherax Erichson (Decapoda: Parastacidae) from the south-west of Western Australia. Invertebrate Systematics 16, 357–367. doi:10.1071/IT01010 Austin, C. M., Nguyen, T. T. T., Meewan, M. M., and Jerry, D. (2003). The taxonomy and evolution of the Cherax destructor complex (Decapoda: Parastacidae) re-examined using mitochondrial 16S sequences. Australian Journal of Zoology 51, 99–110. doi:10.1071/ZO02054 Avise, J. C. (1994). ‘Molecular Markers, Natural History and Evolution.’ (Chapman and Hall: New York, USA) Baker, E. K., and Lutzoni, F. M. (2002). The utility of the incongruence length difference test. Systematic Biology 51, 625–637. doi:10.1080/10635150290102302 Bull, J. J., Huelsenbeck, J. P., Cunningham, C. W., Swofford, D. L., and Waddell, P. J. (1993). Partitioning and combining data in phylogenetic analysis. Systematic Biology 42, 384–397. Campbell, N., Geddes, J. H. M., and Adams, M. (1994). Genetic variation in yabbies, Cherax destructor and C. albidus (Crustacea: Decapoda: Parastacidae), indicates the presence of a single, highly sub-structured species. Australian Journal of Zoology 42, 745–760.
224
Invertebrate Systematics
Clark, E. (1936). The freshwater crayfishes of Australia. Memoirs of the National Museum of Victoria. 10, 5–58. Clark, E. (1941). New species of Australian freshwater and land crayfishes (Family Parastacidae). Memoirs of the National Museum of Victoria. 12, 31–40. Crandall, K. A. (1996). Genetic variation within and among crayfish species. Freshwater Crayfish 11, 135–145. Crandall, K. A., and Fitzpatrick, J. F. J. (1996). Crayfish molecular systematics: using a combination of procedures to estimate phylogeny. Systematic Biology 45, 1–26. Crandall, K. A., Lawler, S. H., and Austin, C. M. (1995). A preliminary examination of the molecular phylogenetic relationships of some crayfish genera from Australia (Decapoda: Parastacidae). Freshwater Crayfish 10, 18–30. Crandall, K. A., Fetzner, J. W., Lawler, S. H., Kinnersley, M., and Austin, C. M. (1999). Phylogenetic relationships among the Australian and New Zealand genera of freshwater crayfishes (Decapoda: Parastacidae). Australian Journal of Zoology 47, 199–214. Crandall, K. A., Fetzner, J. W., Jara, C. G., and Buckup, L. (2000). On the phylogenetic position of the South American freshwater crayfish genera (Decapoda: Parastacidae). Journal of Crustacean Biology 20, 530–540. Crease, T. J. (1999). The complete sequence of the mitochondrial genome of Daphnia pulex (Cladocera: Crustacea). Gene 233, 89–99. doi:10.1016/S0378-1119(99)00151-1 Cunningham, C. W. (1997). Is congruence between data partitions a reliable predictor of phylogenetic accuracy? Empirically testing an iterative procedure for choosing among phylogenetic methods. Systematic Biology 46, 464–478. Darlu, P., and Lecointre, G. (2002). When does incongruence length difference test fail? Molecular Biology and Evolution 19, 432–437. Erichson, W. F. (1846). Uebersicht der Arten der Gattung Astacus. Archiv fur Naturgeschichte 12, 86–103. Farris, J. S., Kallersoj, M., Kluge, A. G., and Bult, C. (1994). Testing significance of incongruence. Cladistics 10, 315–319. doi:10.1006/CLAD.1994.1021 Fetzner, J. W. (1996). Biochemical systematics and evolution of the crayfish genus Orconectes (Decapoda: Cambaridae). Journal of Crustacean Biology 16, 111–141. Fetzner, J. W. J., and Crandall, K. A. (2001). Genetic variation. In ‘Biology and Freshwater Crayfish’. (Ed D. M. Holdich.) pp. 291–326. (Blackwell Science: Oxford, UK.) Gilbert, D. G. (1997). ‘SeqPup Software.’ (Indiana University: Bloomington, IN, USA.) Available from http://www.rfcgr.mrc.ac.uk/ Registered/Help/seqpup/ [Accessed March 2004] Grandjean, F. D., Harris, D. J., Souty-Grosset, C., and Crandall, K. A. (2000). Systematics of the European, endangered crayfish species Austropotamobius pallipes (Decapoda: Astacidae). Journal of Crustacean Biology 20, 522–529. Gray, J. E. (1845). Description of some new Australian animals. In ‘Journals of Expeditions of Discovery into Central Australia and Overland from Adelaide to King George’s Sound in the year 1840–1841’. Vol 1. (Ed. J. Eyre.) pp. 405–411. (T. W. Boone: London, UK.) Hansen, B., Adams, M., Krasnicki, T., and Richardson, A. M. M. (2001). Substantial allozyme diversity in the freshwater crayfish Parastacoides tasmanicus supports extensive cryptic speciation. Invertebrate Taxonomy 15, 667–679. doi:10.1071/IT00052 Hillis, D. M., and Huelsenbeck, J. P. (1992). Signal, noise and reliability in molecular phylogenetic analysis. The Journal of Heredity 83, 189–195. Hillis, D. M., Moritz, C., and Mabel, B. K. (1996). ‘Molecular Systematics.’ (Sinauer Associates: Sunderland, MA, USA.)
D. H. N. Munasinghe et al.
Holthuis, L. B. (1996). Cherax (Astaconephrops) minor new species, a parastacid from the mountains of Irian Jaya (W. New Guinea), Indonesia (Crustacea: Decapoda: Parastacidae). Zoologische Mededelingen (Leiden) 70, 361–366. Horwitz, P. (1990). A taxonomic revision of species in the freshwater crayfish genus Engaeus Erichson (Decapoda: Parastacidae). Invertebrate Taxonomy 4, 427–614. James, C. H., and Moritz, C. (2000). Intraspecific phylogeography in the sedge frog Litoria fallax (Hylidae) indicates pre-Pleistocene vicariance of an open forest species from eastern Australia. Molecular Ecology 9, 349–358. doi:10.1046/J.1365-294X.2000.00885.X Kitaura, J., Wada, K., and Nishida, M. (1998). Molecular phylogeny and evolution of unique mud-using territorial behaviour in ocypodid crabs (Crustacea: Brachyura: Ocypodidae). Molecular Biology and Evolution 15, 626–637. Lawrence, C. S., Morrissy, N. M., Vercoe, P. E., and Williams, I. H. (2002). Cherax of southeastern and central Australia. Part 1: A review of taxonomy and distribution. Freshwater Crayfish 13, 555–569. Machado, E. G., Dennebouy, N., Suarez, M. O., Mounolou, J. C., and Monnerot, M. (1993). Mitochondrial 16S rRNA gene of two species of shrimps: sequence variability and secondary structure. Crustaceana 65, 279–286. Munasinghe, D. H. N. (2003). ‘Molecular Systematics of Freshwater Crayfish of the Genus Cherax (Decapoda: Parastacidae).’ PhD Thesis. (University of Deakin: Warrnambool, Australia.) Munasinghe, D. H. N., Murphy, N. P., and Austin, C. M. (2003). Utility of mitochondrial DNA sequences from four gene regions for systematic studies of Australian freshwater crayfish of the genus Cherax (Decapoda: Parastacidae). Journal of Crustacean Biology 23, 402–417. Munasinghe, D. H. N., Burridge, C. P., and Austin, C. M. (2004). Molecular phylogeny and zoogeography of the Australian freshwater crayfish genus Cherax Erichson (Parastacidae: Decapoda). Biological Journal of the Linnean Society 81, in press. Murphy, N. P., and Austin, C. M. (2002). A preliminary study of 16S rRNA sequence variation in Australian Macrobrachium shrimps (Palaemonidae: Decapoda) reveals inconsistence in their current classification. Invertebrate Systematics 16, 697–701. doi:10.1071/ IT01031 Page R. D. (2000). Comparative analysis of secondary structure of insect mitochondrial small subunit ribosomal RNA using maximum weighted matching. Nucleic Acids Research 28, 3839–3845. Palumbi, S. R., and Benzie, J. (1991). Large mitochondrial DNA differences between morphologically similar penaeid shrimp. Molecular Marine Biology and Biotechnology 1, 27–34. Posada, D., and Crandall, K. A. (1998). MODELTEST: testing the model of DNA substitution. Bioinformatics (Oxford, England) 14, 817–818. doi:10.1093/BIOINFORMATICS/14.9.817 Riek, E. F. (1951). The freshwater crayfish (Family: Parastacidae) of Queensland. With an appendix describing other Australian species. Records of the Australian Museum 22, 368–388. Riek, E. F. (1956). Additions to the Australian freshwater crayfish. Records of the Australian Museum 24, 1–6. Riek, E. F. (1967). The freshwater crayfish of South America. Proceedings. Biological Society of Washington 84, 129–136. Riek, E. F. (1969). The Australian freshwater crayfish (Crustacea: Decapoda: Parstacidae), with the descriptions of new species. Australian Journal of Zoology 17, 855–918. Saver, S. K., Silberman, J. D., and Walsh, P. J. (1998). Mitochondrial DNA sequence evidence supporting the recognition of two subspecies or species of the Florida spiny lobster Panulirus argus. Journal of Crustacean Biology 18, 177–186.
Molecular systematics of Cherax
Invertebrate Systematics
Shaw, K. L. (2001). The genealogical view of speciation. Journal of Evolutionary Biology 14, 880–882. doi:10.1046/J.14209101.2001.00337.X Short, J. W. (1991). Cherax nucifraga, a new species of freshwater crayfish (Crustacea: Decapoda: Parastacidae) from the Northern Territory, Australia. The Beagle, Records of the Northern Territory Museum of Arts and Science 8, 115–120. Short, J. W. (1993). Cherax cartalacoolah, a new species of freshwater crayfish (Decapoda: Parastacidae) from northeast Australia. Memoirs of the Queensland Museum 33, 55–59. Short, J. W., and Davie, P. J. F. (1993). Two species of freshwater crayfish (Crustacea: Decapoda: Parastacidae) from the northeastern Queensland rainforest. Memoirs of the Queensland Museum 33, 69–80. Sokol, A. (1988). Morphological variation in relation to the taxonomy of the destructor group of the genus Cherax. Invertebrate Taxonomy 2, 55–79. Swofford, D. L. (2000) ‘PAUP* Phylogenetic Analysis using Parsimony (*and Other Methods).’ (Sinauer Associates: Sunderland, MA, USA.) Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F., and Higgins, D. G. (1997). The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25, 4876–4882. doi:10.1093/NAR/25.24.4876 Thorpe, J. P. (1982). The molecular clock hypothesis: biochemical evolution, genetic differentiation and systematics. Annual Review of Ecology and Systematics 13, 139–168. doi:10.1146/ANNUREV. ES.13.110182.001035
225
Versteegen, M., and Lawler, S. (1996). Population genetics of the Murray River crayfish Euastacus armatus. Freshwater Crayfish 24, 4876–4882. von Martens, E. (1868). Überblick der neuhollandischer Flusskrebse. Monatsbericht Akademie der Wissenschaften zur Berlin 1868, 615–619. Wiens, J. J. (1998). Combining data sets with different phylogenetic histories. Systematic Biology 47, 568–581. doi:10.1080/ 106351598260581 Wiens, J. J., and Penkrot, T. A. (2002). Delimiting species using DNA and morphological variation and discordant species limits in spiny lizards (Sceloporus). Systematic Biology 51, 69–91. doi:10.1080/106351502753475880 Zeidler, W. (1982). South Australian freshwater crayfish. South Australian Naturalist 56, 36–43. Zeidler, W., and Adams, M. (1990). Revision of the Australian crustacean genus of freshwater crayfish Gramastacus Riek (Decapoda: Parastacidae). Invertebrate Taxonomy 3, 913–924.
Manuscript received 28 March 2003; revised and accepted 27 February 2004.
http://www.publish.csiro.au/journals/is
