The defensin peptide of the malaria vector mosquito Anopheles gambiae: antimicrobial activities and expression in adult mosquitoes

Insect Biochemistry and Molecular Biology 31 (2001) 241–248 www.elsevier.com/locate/ibmb

The defensin peptide of the malaria vector mosquito Anopheles gambiae: antimicrobial activities and expression in adult mosquitoes Jacopo Vizioli a, Adam M. Richman b, Sandrine Uttenweiler-Joseph c, Claudia Blass c, Philippe Bulet a,* a

UPR CNRS 9022, Institut de Biologie Mole´culaire et Cellulaire, 15, rue Rene´ Descartes, 67084 Strasbourg Cedex, France b Department of Entomology, University of Maryland, College Park, MD 20742, USA c European Molecular Biology Laboratory, Meyerhofstrasse 1, 69117 Heidelberg, Germany Accepted 15 August 2000

Abstract A recombinant Anopheles gambiae defensin peptide was used to define the antimicrobial activity spectrum against bacteria, filamentous fungi and yeast. Results showed that most of the Gram-positive bacterial species tested were sensitive to the recombinant peptide in a range of concentrations from 0.1 to 0.75 µM. No activity was detected against Gram-negative bacteria, with the exception of some E. coli strains. Growth inhibitory activity was detected against some species of filamentous fungi. Defensin was not active against yeast. The kinetics of bactericidal and fungicidal effects were determined for Micrococcus luteus and Neurospora crassa, respectively. Differential mass spectrometry analysis was used to demonstrate induction of defensin in the hemolymph of bacteria-infected adult female mosquitoes. Native peptide levels were quantitated in both hemolymph and midgut tissues. The polytene chromosome position of the defensin locus was mapped by in situ hybridization.  2001 Elsevier Science Ltd. All rights reserved. Keywords: Anopheles immunity; Insect defensin; Antimicrobial peptides

1. Introduction Antimicrobial peptides are important mediators of the innate immune response to infection. Their significance is highlighted by their evolutionary antiquity: analogous classes of antibacterial and antifungal proteins have been identified in vertebrates, invertebrates, and plants (Hwang and Vogel, 1998). Studies of innate immunity in insects have led to the identification of numerous antimicrobial peptides (see for review Bulet et al., 1999). Some of these peptides have, in turn, proven very useful as molecular markers in the elucidation of the complex pathways regulating the insect defense response, especially in the fruit fly Drosophila melanogaster (Lemaitre et al., 1995, 1996). More recently efforts have

* Corresponding author. Tel.: +33 388 41 70 62 fax: +33 388 60 69 22. E-mail address: [email protected] (P. Bulet).

been made to analyze the innate immune capabilities of some insect vectors of human disease, notably the mosquito Anopheles gambiae, the major African vector of the malaria parasite, Plasmodium falciparum. Two A. gambiae antimicrobial peptides, defensin and cecropin, have been identified and characterized (Richman et al., 1996; Vizioli et al., 2000). Insect defensins are the most frequently observed cysteine-rich antimicrobial peptides expressed during the insect immune response, and have been identified in many different taxa (for review see Dimarcq et al., 1998). They are active against numerous species of Gram-positive bacteria, a few Gram-negative bacteria, and some filamentous fungi (see Hetru et al., 1998 for review). All insect defensins have a well-conserved structure featuring six cysteine residues engaged in three disulfide bridges, and characterized by the Cysteine-Stabilized αβ (CSαβ) motif (Cornet et al., 1995). The A. gambiae mature defensin, initially purified from larval mosquitoes, is very similar in sequence to other insect peptides of this family (Richman et al., 1996).

0965-1748/01/$ - see front matter  2001 Elsevier Science Ltd. All rights reserved. PII: S 0 9 6 5 - 1 7 4 8 ( 0 0 ) 0 0 1 4 3 - 0

242

J. Vizioli et al. / Insect Biochemistry and Molecular Biology 31 (2001) 241–248

Following bacterial infection, the levels of A. gambiae defensin RNA are rapidly upregulated in larvae and adults. In Diptera, defensins are known to be expressed in fat body cells and in some hemocytes (Dimarcq et al., 1990). Defensin gene expression was reported in the midguts of A. gambiae and Aedes aegypti mosquitoes (Richman et al., 1997; Lowenberger et al., 1999a) as well as the stable fly Stomoxys calcitrans (Lehane et al., 1997). Defensin RNA was also detected in the salivary glands of A. gambiae (Dimopoulos et al., 1998). While defensin RNA has been detected in different mosquito tissues and organs, the mature peptide has so far been isolated only from Ae. aegypti adult hemolymph (Chalk et al., 1994; Lowenberger et al., 1995; Lowenberger et al., 1999b) and A. gambiae larvae (Richman et al., 1996). Here we describe the analysis of defensin peptide expression in adult A. gambiae hemolymph and midgut by mass spectrometry and reversed-phase chromatography. In addition, the antimicrobial activity spectrum of A. gambiae defensin was determined using a recombinant peptide expressed in Saccharomyces cerevisiae. A genomic clone containing the defensin locus was isolated from a bacterial artificial chromosome (BAC) library, and used to determine the cytogenetic location of the gene on A. gambiae polytene chromosomes.

2. Materials and methods 2.1. Expression and large scale purification of recombinant defensin The A. gambiae defensin peptide was expressed in the yeast Saccharomyces cerevisiae strain TGY 48-1 as described by Michaut et al. (1996). The sequence corresponding to the mature defensin peptide was PCR-amplified from the full-length cDNA template (Richman et al., 1996) using the primers Anodef-start: 59CCGGAAGC TTGGATAAAAGAGCGACCTGCGATCTGGCCAGC39 and Anodef-stop: 59GGCCGTCGACTTAGTTGCGGC AAACACACACCGC39, designed for in-frame cloning in the Mfα1 promoter/preproregion expression system (Michaut et al., 1996). Cloning procedures and yeast cell transfection were performed as previously described (Lamberty et al., 1999). Large scale production and reversed-phase HPLC (RP-HPLC) purification of recombinant defensin were performed essentially as described by Lamberty et al. (1999), with a linear gradient adapted to the Anopheles defensin purification. 2.2. Mosquito immunization and hemolymph collection A. gambiae (G3 strain) female mosquitoes (4–10 days old) were reared and infected with bacteria as described by Dimopoulos et al. (1997). After pricking, mosquitoes were allowed to recover over 16 h at 25°C. Hemolymph

collection and RP-HPLC purification were performed following the procedures previously described for the analysis of Drosophila hemolymph (Uttenweiler-Joseph et al., 1998). 2.3. Purification of native defensin from midgut tissue Midguts were dissected from 1300 A. gambiae female mosquitoes (3–10 days old), homogenized in PBS and sonicated in an ice-cold water bath. Peptide extraction was performed in 0.1% trifluoracetic acid (TFA), at 4°C, for 60 min. The acidic extract was prepurified by solidphase extraction on a Sep-Pak light C18 cartridge (Waters). Peptides eluted with 80% acetonitrile (ACN) in acidified water (0.05% TFA) were separated by RPHPLC on an Aquapore RP-300 C18 column (220×4.6 mm; Brownlee) using a linear gradient of 2–60% ACN in acidified water over 120 min, at a flow rate of 0.8 ml/min (Waters model 626 HPLC system). Putative defensin-containing fractions were identified by comparative RP-HPLC analysis using the recombinant peptide as reference. Selected fractions were analyzed by RP-HPLC on a microbore Aquapore RP 300 C8 column (0.1×10 cm; Brownlee) with a linear biphasic gradient of ACN in acidified water from 2% to 20% over 10 min, and from 20% to 30% over 50 min, at a flow rate of 0.08 ml/min, at 35°C. HPLC eluates were monitored by UV absorption at 225 nm for the first purification and at 214 nm for the final purification. 2.4. Detection and quantification of defensin by ELISA Uncoupled Anopheles recombinant defensin was used to raise rabbit polyclonal antibodies. Binding of antibodies to recombinant and native peptide was assessed by the ELISA procedure as described by Tuaillon et al. (1992) Specificity of the defensin antiserum was tested by performing ELISA on RP-HPLC fractions obtained from an acidic extract of infected mosquitoes. Amounts of native defensin were quantitatively determined by comparison with a standard curve produced using the recombinant peptide. 2.5. Matrix-Assisted Laser Desorption/Ionization-Time of Flight-Mass Spectrometry (MALDI-TOF-MS) MALDI-TOF-MS analysis was performed on a Bruker BIFLEX (Bremen, Germany) mass spectrometer in a positive linear mode. Samples were analyzed as previously described (Uttenweiler-Joseph et al., 1998) with nitrocellulose and thin layer preparations of mosquito hemolymph and RP-HPLC fractions, respectively, using α-cyano-4-hydroxycinnamic acid (Sigma) as matrix.

J. Vizioli et al. / Insect Biochemistry and Molecular Biology 31 (2001) 241–248

2.6. Capillary Zone Electrophoresis (CZE) and microsequence analysis Purity analysis and quantification of native and recombinant defensins were performed by CZE on a 270A-HT capillary electrophoresis system (PE Applied Biosystems) as previously described (Lowenberger et al., 1995). Briefly, 1 nl of 10 µM recombinant defensin was injected under vacuum. Electrophoretic mobility was achieved from anode to cathode at 20 kV in 20 mM citrate buffer (pH 2.5), during 15 min. Detection was performed at 200 nm and 30°C. The surface of the defensin peak was calculated with the ABI Data Reprocessing program. The same procedure was used to analyze the RP-HPLC fractions (3 nl) containing the native defensin isolated from midgut and hemolymph (see Section 3). To quantify the defensin present in the RP-HPLC fractions, the surface of the peak eluted at the same retention time as the recombinant peptide was calculated and normalized to a known amount of standard defensin. Peptides were sequenced by Edman degradation on a Procise capillary liquid chromatography sequencer (PE Applied Biosystems, model 492 cLC). 2.7. Antimicrobial assays The antimicrobial activity spectrum of defensin was determined using liquid growth-inhibition assays against bacteria, filamentous fungi and yeast strains as previously described (Hetru and Bulet, 1997; Vizioli et al., 2000) except that Luria-Bertani broth was used as culture medium in antibacterial assays. Recombinant defensin from the fleshfly Phormia terranovae (Lambert et al., 1989) was used as reference. Antibacterial activities of midgut RP-HPLC fractions were determined by plate growth-inhibition assays (Bulet et al., 1992) against Micrococcus luteus, depositing 2 µl of sample directly on the agar surface. Antibacterial activity of hemolymph RP-HPLC fractions was established by liquid growth-inhibition assays against the Gram-positive bacteria Aerococcus viridans. Comparative bactericidal effects of defensins on M. luteus and fungicidal effects on Neurospora crassa were performed as previously described (Ehret-Sabatier et al., 1996). Briefly, bacteria or fungal spores were incubated for different time periods in a final defensin concentration of 1 µM (antibacterial assay) or 25 µM (antifungal assay). Fungal growth was examined by microscopical observation and expressed by optical density absorbance at 595 nm. 2.8. In situ hybridization to polytene chromosomes A genomic clone of the defensin locus was isolated from a bacterial artificial chromosome (BAC) library

243

(details of the library and screening protocol to be published elsewhere). Hybridization of the BAC clone to polytene chromosomes of A. gambiae (Suakoko strain) was performed essentially as described (Kumar et al., 1997).

3. Results 3.1. Expression of recombinant defensin in yeast Recombinant A. gambiae defensin was produced both to facilitate quantitative analysis of native peptide expression and to determine the defensin antimicrobial activity spectrum. Recombinant peptide was purified from the supernatant of a 48-h transformed S. cerevisiae culture. The overall yield was 1–1.6 mg of active peptide per liter of culture. The molecular mass of the purified recombinant peptide (4136.8 MH+), measured by MALDI-TOF-MS, was in agreement with that of native defensin isolated from mosquito tissues (4138.7 MH+ see below). Those molecular masses are consistent with the calculated mass of the mature defensin (4141.8 Da) deduced from the cDNA sequence (Richman et al., 1996) and including the six cysteine residues engaged in the three internal disulfide bridges. The identity of the recombinant peptide was confirmed by partial N-terminal sequencing, CZE and RP-HPLC. 3.2. Antimicrobial assays The antimicrobial (growth-inhibitory) activity spectrum of A. gambiae defensin was analyzed using the recombinant peptide in bioassays with Gram-positive and Gram-negative bacteria, filamentous fungi and yeast (Table 1). The activity of the A. gambiae defensin was compared with that of the previously-described defensin of the fleshfly Phormia terranovae (Lambert et al., 1989). Minimal Inhibitory Concentration (MIC) values were expressed according to Casteels et al. (1993). Both peptides were active against most of the Gram-positive bacteria tested, Bacillus cereus and Lactobacillus sp. being the exceptions. Anopheles defensin was active below 0.75 µM, except against Enterococcus faecalis (MIC.25 µM) and B. thuringiensis (MIC 50–100 µM). Both defensins were generally ineffective against Gramnegative bacteria, apart from some E. coli strains (D22, D31 and SBS363) where the MIC were ranging from 0.75–1.5 µM to 12.5–25 µM. Following the MIC determination, aliquots of the culture (over the MIC values) were plated on LB agar for colony forming unit counting. No colonies were obtained for any of the strain tested, establishing a bactericidal effect of Anopheles defensin. Against fungi, both defensins had the same activity spectrum in terms of strains affected and were generally active between 1.5 µM and 6 µM, with the

244

J. Vizioli et al. / Insect Biochemistry and Molecular Biology 31 (2001) 241–248

Table 1 Antimicrobial activity spectrum of recombinant defensins from Anopheles gambiae and Phormia terranovae. Minimal Inhibitory Concentration (MIC) values are expressed in µM as a final concentration. Asterisks indicate the lack of activity at the highest concentration tested (100 µM) Microorganisms

Gram-positive bacteria Aerococcus viridans Bacillus cereus Bacillus megaterium Bacillus subtilis Bacillus thuringiensis Enterococcus faecalis Lactobacillus sp. Listeria monocytogenes Micrococcus luteus Pediococcus acidolactici Staphylococcus aureus Staphylococcus epidermidis Staphylococcus haemolyticus Staphylococcus saprophyticus Streptococcus pyogenes Gram-negative bacteria Alcaligenes faecalis Escherichia coli 1106 Escherichia coli D22 Escherichia coli D31 Escherichia coli SBS363 Erwinia carotovora carotovora Enterobacter cloacae β12 Pseudomonas aeruginosa Salmonella thyphimurium Serratia marcescens Dbll Xhantomonas campestris pv orizae Fungi Aspergillus fumigatus Beauveria bassiana Botrytis cinerea Fusarium culmorum Fusarium oxysporum Neurospora crassa Yeasts Candida albicans Candida glabrata Cryptococcus neoformans

MIC (µM) Anopheles defensin

Phormia defensin

0.012–0.025 * 0.05–0.1 0.1–0.2 50–100 .25 * 0.4–0.75 0.2–0.4 0.4–0.75 0.4–0.75 0.4–0.75 0.4–0.75 0.4–0.75 0.4–0.75

0.05–0.1 * 0.05–0.1 0.4–0.75 25–50 12.5–25 * 3–6 0.4–0.75 1.5–3 1.5–3 1.5–3 1.5–3 3–6 1.5–3

* * 0.75–1.5 6–12.5 12.5–25 * * * * * *

* * 1.5–3 6–12.5 25–50 * * * * * *

* * 12.5–25 3–6 1.5–3 3–6

* * 25–50 1.5–3 3–6 3–6

* * *

* * *

exception of Botrytis cinerea (MIC 12.5–50 µM). No inhibitory effects were detected against yeast in the range of concentrations tested. In most bioassays the Anopheles defensin was more active than that of Phormia.

was examined for growth. None was observed after 12– 28 h of exposure to the peptide, indicating that Anopheles defensin is fungicidal (Table 3).

3.3. Bactericidal and fungicidal effect

In order to demonstrate infection-inducible synthesis and secretion of defensin in adult mosquitoes, a differential MALDI-TOF-MS analysis was performed on hemolymph samples collected from individual naı¨ve (control) and bacteria-infected females (Fig. 1). This method detected several immune-induced molecules in the size range of 2–10 kDa, one of which displays a molecular mass (4138.7 MH+) similar to that calculated for mature

At 1 µM, Anopheles defensin exhibited a strong bactericidal effect on M. luteus, killing almost all bacteria within 60 s (Table 2). A fungicidal effect was monitored by incubating spores of N. crassa in 25 µM defensin for various time intervals. Spores were then incubated in fresh medium (lacking peptide) and 48 h later the culture

3.4. Native defensin purification and quantification

J. Vizioli et al. / Insect Biochemistry and Molecular Biology 31 (2001) 241–248

Table 2 Bactericidal effect of Anopheles defensin on M. luteus. Recombinant defensin (1 µM final concentration) or water (Control) were added to an exponential growth phase culture of M. luteus. Aliquots were removed at different time points and the number of colony forming units (cfu) determined after overnight incubation at 37°C Time (min)

0 0.5 1 10 30 60 120

cfu/ml (1×103) Control

Defensin

2600 2400 2400 2600 3400 4900 9700

2500 5 1 0 0 0 0

Table 3 Fungicidal effect of Anopheles defensin on N. crassa. Recombinant defensin (25 µM final concentration) or water (Control) were added to fungal spores. The peptide was removed at different time points and replaced by fresh medium. Fungal growth was examined by absorbance at 595 nm after 48 h of incubation at 30°C Time (h)

0 4 8 12 28

Absorbance (595 nm) Control

Defensin

0.181 0.192 0.258 0.161 0.222

0.299 0.139 0.296 0.275 0

defensin (4136.7 MH+). To further characterize this molecule, hemolymph was collected from 25 naı¨ve (control) and 22 infected mosquitoes and fractionated by RPHPLC. An aliquot of each fraction (normalized to 20 mosquito-equivalents) was tested for activity against the Gram-positive bacteria Aerococcus viridans (selected on the basis of high sensitivity to recombinant defensin; see Table 1). No activity was detected in the control samples. By contrast, one positive fraction was obtained from the hemolymph of infected mosquitoes, with a retention time corresponding to that of recombinant defensin (data not shown). MALDI-TOF-MS analysis of this fraction revealed a product with molecular mass 4137.5 MH+, and no molecules of similar mass were detected in the equivalent fraction from control hemolymph. Limiting quantities of protein precluded sequence determination. CZE analysis of the active fraction, however, revealed a molecule with the same retention time as recombinant defensin (data not shown). CZE was also used to quantify the amount of defensin present in the hemolymph of infection-challenged mosquitoes according to procedures established for the quantitation of Drosophila antimicrobial peptides (P. Bulet,

245

unpublished). A calibrated standard solution of recombinant peptide was used to quantify amounts of the partially purified native defensin. Analyzed by this technique, the hemolymph of a single immune-challenged female mosquito contains approximately 4 ng of mature defensin. Hemolymph defensin was also quantified by ELISA (Tuaillon et al., 1992), utilizing the defensin-specific rabbit antiserum. Hemolymph from control and infected females was collected by perfusion, acidified and fractionated by RP-HPLC. An aliquot (normalized to 6 mosquito-equivalents) of each fraction was used for ELISA. Only one fraction, obtained from infected mosquitoes, developed a positive reaction. MALDI-TOF-MS confirmed the presence of a putative defensin molecule (4137.2 MH+) in this fraction (data not shown). No reactions were observed in the control sample. By comparison to a standard curve generated with the recombinant peptide, the amount of defensin in the hemolymph of a single mosquito was again estimated at 4 ng. Previous studies of A. gambiae defensin gene expression demonstrated constitutive and inducible defensin RNA in the midguts of female mosquitoes (Dimopoulos et al., 1997). To isolate and characterize the midgut defensin peptide, an acidic extract of 1300 female midguts was analyzed by RP-HPLC. An aliquot of each collected fraction was monitored for activity against the Gram-positive bacteria M. luteus. One active fraction was detected, with a RP-HPLC retention time identical to that of recombinant defensin. MALDI-TOFMS analysis of this fraction revealed a molecule with a molecular mass at 4137.1 MH+. The putative midgut defensin peptide was further purified to homogeneity by RP-HPLC and partially sequenced by Edman degradation. The first 23 residues obtained corresponded to the N-terminal sequence of the mature defensin peptide originally isolated from immunized A. gambiae larvae (Richman et al., 1996). The amount of defensin expressed in the midgut was analyzed by ELISA, as described above. The results indicated that a single mosquito midgut contains approximately 0.55 ng of mature peptide. 3.5. Cytogenetic localization of the defensin gene The cytogenetic location of the defensin gene was determined by in situ hybridization of a genomic clone to ovarian polytene chromosome preparations. A specific signal was detected on the left arm of chromosome 3 (3L), division 41 (data not shown).

4. Discussion A combination of MALDI-TOF-MS and RP-HPLC analysis was used to demonstrate that the defensin peptide is upregulated in the hemolymph following bacterial

246

J. Vizioli et al. / Insect Biochemistry and Molecular Biology 31 (2001) 241–248

Fig. 1. MALDI-TOF-MS analysis of hemolymph collected from naı¨ve (control) vs bacteria-infected A. gambiae females. Molecular masses surrounding the putative defensin peak (4138.7 MH+) are indicated.

infection of adult A. gambiae mosquitoes, and is also synthesized constitutively in the midgut. Mosquito defensin was previously reported in Aedes aegypti hemolymph (Chalk et al., 1994; Lowenberger et al., 1995) and A. gambiae larvae (Richman et al., 1996), but this is the first report of a mature defensin peptide isolated from A. gambiae adults. Only one defensin isoform was detected in A. gambiae, in contrast to Ae. aegypti where three isoforms were purified from hemolymph by RP-HPLC (Lowenberger et al., 1995). Defensin peptide levels in the hemolymph of an individual adult mosquito after bacterial infection were determined to be 4 ng. Assuming a hemolymph volume of 0.34 µl, as reported for A. stephensi (Mack et al., 1979), defensin peptide is present at a concentration of 3 µM in the hemolymph of infected adult female mosquitoes. This concentration is similar to that found in D. melanogaster (1–2 µM; P. Bulet, unpublished data), but is significantly lower than the infection-induced defensin concentration of 45 µM reported for Ae. aegypti (Lowenberger et al., 1999b). Conceivably, the observed difference in magnitude of induced protein expression between the two mosquito species may reflect divergent evolution of innate immune strategies, with the A. gambiae peptide expressed at lower levels but possessing generally higher specific activity (see below). A. gambiae defensin was produced in S. cerevisiae in

order to establish the antimicrobial activity spectrum of this peptide. The identity of the recombinant molecule was confirmed by mass spectrometry, reversed-phase chromatography, and sequence analysis. A. gambiae defensin was active against most of Gram-positive bacteria tested, at relatively low concentrations (MIC 0.1– 0.75 µM). Insect defensins are, in general, considered to be antibacterial factors though activity against fungi has been reported (Rees et al., 1997; Lamberty et al., 1999). Notably, the values reported here for antifungal activities of A. gambiae defensin (MIC 1.5–6 µM) represent the first observation of antifungal activity for a dipteran defensin at a physiologically-relevant concentration. Except for some E. coli strains, no inhibitory effects were observed on Gram-negative bacteria or on yeast growth (Table 1). The E. coli strains tested are K12 derivatives, characterized by different membrane modifications that increase their sensitivity to antimicrobial agents. This may explain the variability to A. gambiae defensin observed among these E. coli strains. Similar differences in membrane composition or structure could explain the variable susceptibility to defensin of the different Bacillus species tested. Alternatively, different species may secrete proteases or metabolites which modify the structure and activity of defensin. In summary, Anopheles and Phormia defensins displayed activity spectra similar to that of other insect

J. Vizioli et al. / Insect Biochemistry and Molecular Biology 31 (2001) 241–248

defensins as previously reported (Bulet et al., 1992; Cociancich et al., 1994). Against most of the bacterial strains tested, however, the Anopheles peptide was more active than that of Phormia, Aedes (Lowenberger et al., 1995) or Pyrrhocoris (Cociancich et al., 1994). Significant differences were observed in the timecourse of defensin bactericidal versus fungicidal effects (Tables 2 and 3). While Gram-positive bacteria are killed within 1 min of exposure to relatively low concentrations of peptide, irreversible inhibition of fungal spore germination required 12–28 h of exposure to high concentrations of defensin. A similar fungicidal effect against Neurospora crassa was observed after 48 h of incubation with the antifungal peptides drosomycin (Fehlbaum et al., 1994), thanatin (Fehlbaum et al., 1996) and heliomicin (Lamberty et al., 1999). While the bactericidal effects of defensin are believed to be the result of voltage-dependent channel formation in the plasma membrane of the Gram-positive bacteria M. luteus (Cociancich et al., 1993) the mechanism of fungal growth inhibition has not yet been elucidated. The demonstration of active defensin peptide isolated by RP-HPLC from the midgut of A. gambiae suggests that midgut cells may represent a “barrier epithelium” and carry out protective functions analogous to the Paneth cells of the mammalian small intestine, which secrete locally high concentrations of antimicrobial proteins into the crypt lumen (Selsted et al., 1992). Although secretion of A. gambiae defensin into the gut lumen has not been demonstrated, it is interesting to speculate that defensin may normally play a role in controlling the natural flora of Gram-positive bacteria in the gut. Pumpuni et al. (1996) reported that many bacteria isolated from midguts of laboratory-reared A. gambiae were Gram-negative species, some of which (i.e. Salmonella spp, Pseudomonas spp, Serratia spp) are insensitive to high defensin concentrations (see Table 1). These data suggest that defensin is not involved in the immune response against Gram-negative midgut bacteria. Conceivably, these bacteria are controlled by cecropin (Vizioli et al., 2000) or other yet unidentified peptides. The midgut is the initial point of invasion of the mosquito by Plasmodium, the protozoan parasite of malaria. Earlier studies showed that invasion is associated with defensin RNA up-regulation in A. gambiae midgut tissue (Richman et al., 1997; Dimopoulos et al., 1997, 1998). Possibly, localized expression of defensin (and perhaps additional immune effector molecules, i.e. cecropin) acts within the gut environment to limit Plasmodium parasite infectivity. Interestingly, the defensin locus has been mapped cytogenetically to the left arm of chromosome 3 at division 41, in the vicinity of a genetic interval implicated in the humoral encapsulation of midgut-stage Plasmodium parasites (Zheng et al., 1997). In vitro assays of A. gambiae defensin activity against Plasmod-

247

ium may help to clarify the potential role of this immune peptide in limiting parasite infectivity.

Acknowledgements The authors thank Professors Fotis C. Kafatos and Jules A. Hoffmann for critical comments on the manuscript. This work was funded by a European Union Training and Mobility of Researchers (TMR) Network on Insect–Parasite Interactions, the Centre National de la Recherche Scientifique, and the University Louis Pasteur of Strasbourg (France). J.V. was supported by a postdoctoral fellowship from the Fondazione Pasteur-Cenci Bolognetti.

References Bulet, P., Cociancich, S., Reuland, M., Sauber, F., Bischoff, R., Hegy, G., Van Dorsselaer, A., Hetru, C., Hoffmann, J.A., 1992. A novel insect defensin mediates the inducible antibacterial activity in larvae of the dragonfly Aeschna cyanea (Paleoptera, Odonata). Eur. J. Biochem. 209, 977–984. Bulet, P., Hetru, C., Dimarcq, J.L., Hoffmann, D., 1999. Antimicrobial peptides in insects; structure and function. Developmental and Comparative Immunology 23, 329–344. Casteels, P., Ampe, C., Jacobs, F., Tempst, P., 1993. Functional and chemical characterization of hymenoptaecin, an antibacterial polypeptide that is infection-inducible in the honeybee (Apis mellifera). J. Biol. Chem. 268, 7044–7054. Chalk, R., Townson, H., Natori, S., Desmond, H., Ham, P.J., 1994. Purification of an insect defensin from the mosquito, Aedes aegypti. Insect Biochem. Mol. Biol. 24, 403–410. Cociancich, S., Ghazi, A., Hetru, C., Hoffmann, J.A., Letellier, L., 1993. Insect defensin, an inducible antibacterial peptide, forms voltage-dependent channels in Micrococcus luteus. J. Biol. Chem. 268, 19239–19245. Cociancich, S., Dupont, A., Hegy, G., Lanot, R., Holder, F., Hetru, C., Hoffmann, J.A., Bulet, P., 1994. Novel inducible antibacterial peptides from a hemipteran insect, the sap-sucking bug Pyrrhocoris apterus. Biochem. J. 300, 567–575. Cornet, B., Bonmatin, J.M., Hetru, C., Hoffmann, J.A., Ptak, M., Vovelle, F., 1995. Refined three-dimensional solution structure of insect defensin A. Structure 3, 435–448. Dimarcq, J.L., Zachary, D., Hoffmann, J.A., Hoffmann, D., Reichhart, J.M., 1990. Insect immunity: expression of two major inducible antibacterial peptides, defensin and diptericin, in Phormia terranovae. EMBO J. 9, 2507–2515. Dimarcq, J.L., Bulet, P., Hetru, C., Hoffmann, J.A., 1998. Cysteinerich antimicrobial peptides in invertebrates. In: Andreu, D. (Ed.), Peptide Science. Antimicrobial Peptides, vol. 47. Wiley, New York, pp. 465–477. Dimopoulos, G., Richman, A., Mu¨ller, H.M., Kafatos, F.C., 1997. Molecular immune responses of the mosquito Anopheles gambiae to bacteria and malaria parasites. Proc. Natl. Acad. Sci. USA 94, 11508–11513. Dimopoulos, G., Seeley, D., Wolf, A., Kafatos, F.C., 1998. Malaria infection of the mosquito Anopheles gambiae activates immuneresponsive genes during critical stages of the parasite life cycle. EMBO J. 17, 6115–6123. Ehret-Sabatier, L., Loew, D., Goyffon, M., Fehlbaum, P., Hoffmann, J.A., Van Dorsselaer, A., Bulet, P., 1996. Characterization of novel

248

J. Vizioli et al. / Insect Biochemistry and Molecular Biology 31 (2001) 241–248

cysteine-rich antimicrobial peptides from scorpion blood. J. Biol. Chem. 271, 29537–29544. Fehlbaum, P., Bulet, P., Michaut, L., Lagueux, M., Brokaert, W.F., Hetru, C., Hoffmann, J.A., 1994. Septic injury of Drosophila induces the synthesis of a potent antifungal peptide with sequence homology to plant antifungal peptides. J. Biol. Chem. 269, 33159–33163. Fehlbaum, P., Bulet, P., Chernysh, S., Briand, J.P., Roussel, J.P., Letellier, L., Hetru, C., Hoffmann, J.A., 1996. Structure–activity analysis of thanatin, a 21-residue inducible insect defense peptide with sequence homology to frog skin antimicrobial peptides. Proc. Natl. Acad. Sci. USA 93, 1221–1225. Hetru, C., Bulet, P., 1997. Strategies for the isolation and characterization of antimicrobial peptides of invertebrates. In: Methods in Molecular Biology, Vol. 78: Antibacterial Peptide Protocols. Humana Press, Totowa, NJ, pp. 35–49. Hetru, C., Hoffmann, D., Bulet, P., 1998. Antimicrobial peptides from insects. In: Brey, P.T., Hultmark, D. (Eds.), Molecular Mechanisms of Immune Responses in Insects. Chapman & Hall, London, pp. 40–66. Hwang, P.M., Vogel, H.J., 1998. Structure–function relationships of antimicrobial peptides. Biochem. Cell Biol. 76, 235–246. Kumar, V., Cornel, A.J., Mukabayire, O., 1997. In situ hybridization to Anopheles polytene chromosomes. In: Crampton, J.M., Beard, C.B., Louis, C. (Eds.), The Molecular Biology of Insect Disease Vectors. Chapman & Hall, London, pp. 337–345. Lambert, J., Keppi, E., Dimarcq, J.L., Wicker, C., Reichhart, J.M., Dunbar, B., Lepage, P., Van Dorsselaer, A., Hoffmann, J.A., Fothergill, J., Hoffmann, D., 1989. Insect immunity: isolation from immune blood of the dipteran Phormia terranovae of two insect antibacterial peptides with sequence homology to rabbit lung macrophage bactericidal peptides. Proc. Natl. Acad. Sci. USA 86, 262–266. Lamberty, M., Ades, S., Uttenweiler-Joseph, S., Brookhart, G., Bushey, D., Hoffmann, J.A., Bulet, P., 1999. Isolation from the lepidopteran Heliotis virescens of a novel insect defensin with potent antifungal activity. J. Biol. Chem. 274, 9320–9326. Lehane, M.J., Wu, D., Lehane, S.M., 1997. Midgut-specific immune molecules are produced by the blood-sucking insect Stomoxys calcitrans. Proc. Natl. Acad. Sci. USA 94, 11502–11507. Lemaitre, B., Kromer Metzger, E., Michaut, L., Nicolas, E., Meister, M., Georgel, P., Reichhart, J.M., Hoffmann, J.A., 1995. A recessive mutation, immune deficiency (imd), defines two distinct control pathways in the Drosophila host defense. Proc. Natl. Acad. Sci. USA 92, 9465–9469. Lemaitre, B., Nicolas, E., Michaut, L., Reichhart, J.M., Hoffmann, J.A., 1996. The dorsoventral regulatory gene cassette spa¨tzle/Toll/cactus controls the potent antifungal response in Drosophila adults. Cell 86, 973–983. Lowenberger, C., Bulet, P., Charlet, M., Hetru, C., Hodgeman, B., Christensen, B.M., Hoffmann, J.A., 1995. Insect immunity: isolation of three novel inducible antibacterial defensins from the vec-

tor mosquito, Aedes aegypti. Insect Biochem. Mol. Biol. 25, 867–873. Lowenberger, C.A., Kamal, S., Chiles, J., Paskewitz, S., Bulet, P., Hoffmann, J.A., Christensen, B.M., 1999a. Mosquito–Plasmodium interactions in response to immune activation of the vector. Exp. Parasitol. 91, 59–69. Lowenberger, C.A., Smartt, C.T., Bulet, P., Ferdig, M.T., Severson, D.W., Hoffmann, J.A., Christensen, B.M., 1999b. Insect immunity: molecular cloning, expression, and characterization of cDNAs and genomic DNA encoding three isoforms of insect defensin in Aedes aegypti. Insect Mol. Biol. 8, 107–118. Mack, S.R., Foley, D.A., Vanderberg, J.P., 1979. Hemolymph volume of noninfected and Plasmodium berghei-infected Anopheles stephensi. J. Invert. Pathol. 34, 105–109. Michaut, L., Fehlbaum, P., Moniatte, M., Van Dorsselaer, A., Reichhart, J.M., Bulet, P., 1996. Determination of the disulfide array of the first inducible antifungal peptide from insects: drosomycin from Drosophila melanogaster. FEBS Lett. 395, 6–10. Pumpuni, C.B., Demaio, J., Kent, M., Davis, J.R., Beier, J.C., 1996. Bacterial population dynamics in three anopheline species: the impact on Plasmodium sporogonic development. Am. J. Trop. Med. Hyg. 54, 214–218. Rees, J.A., Moniatte, M., Bulet, P., 1997. Novel antibacterial peptides isolated from a european bumblee, Bombus pascuorum (Hymenoptera, Apoidea). Insect Biochem. Mol. Biol. 27, 413–422. Richman, A.M., Bulet, P., Hetru, C., Barillas-Mury, C., Hoffmann, J.A., Kafatos, F.C., 1996. Inducible immune factors of the vector mosquito Anopheles gambiae: biochemical purification of a defensin antibacterial peptide and molecular cloning of preprodefensin cDNA. Insect Mol. Biol. 5, 203–210. Richman, A., Dimopoulos, G., Seeley, D., Kafatos, F.C., 1997. Plasmodium activates the innate immune response of Anopheles gambiae mosquitoes. EMBO J. 16, 6114–6119. Selsted, M.E., Miller, S.I., Henschen, A.H., Ouellette, A.J., 1992. Enteric defensins: antibiotic peptide components of intestinal host defense. J. Cell. Biol. 118, 929–936. Tuaillon, N., Andre, C., Briand, J.P., Penner, E., Muller, S., 1992. A lipol synthetic octadecapeptide of dihydrolipoamide acetyltransferase specifically recognized by anti-M2 autoantibodies in primary biliary cirrhosis. J. Immunol. 148, 445–450. Uttenweiler-Joseph, S., Moniatte, M., Lagueux, M., Van Dorsselaer, A., Hoffmann, J.A., Bulet, P., 1998. Differential display of peptides induced during the immune response of Drosophila: a matrixassisted laser desorption ionization time-of-flight mass spectrometry study. Proc. Natl. Acad. Sci. USA 95, 11342–11347. Vizioli, J., Bulet, P., Charlet, M., Lowenberger, C., Blass, C., Mu¨ller, H.M., Dimopoulos, G., Hoffmann, J.A., Kafatos, F.C., Richman, A., 2000. Cloning and analysis of a cecropin gene from the malaria vector mosquito. Anopheles gambiae. Insect Mol. Biol. 9, 75–84. Zheng, L., Cornel, A., Wang, R., Erfle, H., Voss, H., Ansorge, W., Kafatos, F.C., Collins, F.H., 1997. Quantitative trait loci for refractoriness of Anopheles gambiae to Plasmodium cynomolgi B. Science 276, 425–428.