JOURNAL OF BACTERIOLOGY, Oct. 1997, p. 6035–6040 0021-9193/97/$04.0010 Copyright © 1997, American Society for Microbiology
Vol. 179, No. 19
The bla Gene of the Cephamycin Cluster of Streptomyces clavuligerus Encodes a Class A b-Lactamase of Low Enzymatic Activity ´ REZ-LLARENA,1 JUAN F. MARTI´N,1 MORENO GALLENI,2 JUAN JOSE ´ R. COQUE,1 FRANCISCO PE 1 2 1 ` JUAN L. FUENTE, JEAN-MARIE FRERE, AND PALOMA LIRAS * Area of Microbiology, Faculty of Biology, Department of Ecology, Genetics and Microbiology, University of Leo ´n, 24071 Leo ´n, Spain,1 and Laboratory of Enzymology and Centre for Protein Engineering, University of Lie`ge, Sart Tilman, B-4000 Lie`ge 1, Belgium2 Received 20 May 1997/Accepted 24 July 1997
A gene (bla) encoding a b-lactamase is present in the cephamycin gene cluster of Streptomyces clavuligerus, the strain producing clavulanic acid and a b-lactamase inhibitory protein. The bla gene is located 5.1 kb downstream from and in the opposite orientation to cefE, encoding the deacetoxycephalosporin C synthase. The bla gene encodes a 332-residue protein (Mr, 35,218), similar to other class A b-lactamases produced by actinomycetes. Modification (to SDG) of the SDN conserved motif of class A b-lactamases as well as of amino acids in otherwise conserved regions in the molecule may explain the low penicillinase and cephalosporinase activities of the protein. The b-lactamase has been purified to homogeneity and found to bind [3H]benzylpenicillin, a result reflecting a rate-limiting deacylation step. Nucleotide sequences homologous to bla were found in all tested cephamycin producers, but several other Streptomyces species which produce a b-lactamase do not contain genes for b-lactam antibiotic biosynthesis. contains a b-lactamase gene associated with the cephamycin biosynthesis genes and whether this b-lactamase is sensitive to clavulanic acid and BLIP, which are known to be produced by the same strain. Modulation of the b-lactamase activity by clavulanic acid and BLIP might be an interesting mechanism for the control of the in vivo activity of this enzyme in blactam-producing microorganisms. In this report, we show that S. clavuligerus contains a blactamase gene close to the cluster of cephamycin C biosynthesis genes and that a similar gene is found in other b-lactamproducing strains. The properties of the b-lactamase were studied, and attempts were made to correlate its low activity with structural features. A role in cell wall synthesis and the morphology is suggested for b-lactamases encoded by the blactam clusters.
b-Lactamase-encoding genes occur in microorganisms isolated before the widespread use of b-lactam antibiotics (25). We have described genes for a b-lactamase (bla) and a penicillin-binding protein (pbp) in the Nocardia lactamdurans cephamycin biosynthesis cluster (5). The similarity of the blactamase encoded by the bla gene of N. lactamdurans to class A b-lactamases of gram-negative and gram-positive bacteria (19) strongly supports the hypothesis of Benveniste and Davies (3), who proposed that antibiotic resistance genes derive from antibiotic-producing organisms, in which they play a protective role to avoid suicide (7). Class A b-lactamases contain an active-site serine residue and are irreversibly inhibited by clavulanic acid (2, 10). Most b-lactamases from actinomycetes are chromosomally encoded enzymes, which are constitutively secreted into the culture medium (9). It is important to know if the b-lactamase genes which have been found in strains such as Streptomyces badius, Streptomyces fradiae, Streptomyces cacaoi (15), or Streptomyces lavendulae (30) are associated with cephamycin biosynthesis genes and if the different actinomycetes and b-lactam antibiotic-producing bacteria (1) always contain a b-lactamase gene associated with the cluster of antibiotic biosynthesis genes. Streptomyces clavuligerus, a cephamycin C producer, synthesizes two distinct b-lactamase inhibitors: clavulanic acid (an oxazolidinic b-lactam compound produced industrially from this strain [4]) and a 17-kDa extracellular b-lactamase-inhibiting protein (BLIP) (8, 32). In addition, S. clavuligerus contains at least five different penicillin-binding proteins (26). The genes for cephamycin C and clavulanic acid biosynthesis are adjacent in the genome of S. clavuligerus, Streptomyces katsurahamanus, and Streptomyces jumonjinesis (34) as a supercluster for the production of b-lactam antibiotics. It was therefore of great interest to know if S. clavuligerus
MATERIALS AND METHODS Biologicals. S. clavuligerus ATCC 27064 was used as the DNA source for cloning of the bla gene. Streptomyces lividans JI1326 was the host for Streptomyces DNA cloning and b-lactamase expression experiments. The b-lactamase producers S. cacaoi DSM 40057, S. fradiae DSM 40063, S. badius DSM 40139, and S. lavendulae DSM 2014 and the b-lactam antibiotic producers Streptomyces cattleya NRRL 8057, Streptomyces griseus NRRL 3851, N. lactamdurans NRRL 3802, and Flavobacterium sp. were used in hybridization experiments. Escherichia coli DH5a was used for subcloning purposes, and E. coli WK6 and the M13K07 phage were used to obtain single-stranded DNA. E. coli LE392 was used to propagate the l-GEM12 phage (Promega), and E. coli NM539 was used to select recombinant phages; pBluescript KS(1) was used for DNA sequencing. The Streptomyces plasmid pIJTipA, containing the thiostrepton-induced protein (TIP) promoter (33), was used to overexpress the b-lactamase gene. Cultures and protoplast fractionation. S. clavuligerus was grown in tryptone soy broth medium (containing 17 g of casein peptone, 3 g of soya peptone, 5 g of NaCl, 2.5 g of K2HPO4, and 2.5 g of glucose per liter) or GSPG medium (28). Resting cell systems (limited in the carbon and nitrogen sources) were prepared from 24- or 48-h cultures; the cells were washed twice in 0.9% NaCl and suspended in 50 mM phosphate buffer (pH 7.0). Both submerged cultures and the resting-cell systems were incubated at 28°C and 250 rpm in an orbital shaker. Cultures of S. lividans[pULFL2] were grown for 48 h at 28°C in YEME medium (13) supplemented with sucrose (10.3%), glycine (0.5%) (to release the b-lactamase protein that is strongly attached to the cell wall), and kanamycin (50 mg/ml). The cultures were centrifuged at 10,500 3 g for 10 min at 4°C, and the supernatant was stored at 4°C. The cells were washed three times with sucrose
* Corresponding author. Mailing address: University of Leo ´n, Faculty of Biology, Area of Microbiology, 24071 Leo ´n, Spain. Phone: (34-87) 291505. Fax: (34-87) 291506. E-mail:
[email protected]. 6035
6036
´ REZ-LLARENA ET AL. PE
(10.3%) and resuspended in P buffer (13) containing lysozyme (0.2 mg/ml). After 60 min of incubation at 30°C, the protoplasts were filtered through sterile cotton and collected by centrifugation at 6,000 3 g for 10 min. The supernatant containing the periplasmic fraction (Sp) was stored, and the protoplasts were lysed in 50 mM phosphate buffer (pH 7.0). After lysis, the protoplast fraction was centrifuged at 16,000 3 g for 20 min to remove cell debris and then at 150,000 3 g for 30 min to obtain the cell membrane fraction. The membranes were washed twice with 50 mM phosphate buffer (pH 7.0) and resuspended in 1 ml of the same buffer. b-Lactamase assays. The enzyme activity was measured by using the chromogenic substrate nitrocefin (24). The assay mixture contained 25 mg of nitrocefin, 50 mg of bovine serum albumin, 10% glycerol, and enzyme (0.2 to 1 mg of protein) in a total volume of 450 ml of 50 mM phosphate buffer (pH 7.0). Hydrolysis was monitored spectrophotometrically at 30°C and 482 nm. Enzyme activity (units) is expressed as micromoles of nitrocefin hydrolyzed per minute, using a molar extinction coefficient variation of 15,000 M21 cm21. The hydrolysis of cefoxitin, cephamycin C, or cephalosporin C was monitored spectrophotometrically at 260 nm, and the hydrolysis of penicillin G was monitored at 235 nm. b-Lactamase purification. The Sp fraction (160 ml) obtained from a 2-liter culture of S. lividans[pULFL2] was diluted fourfold with 20 mM phosphate buffer (pH 7.0) and applied batchwise to 60 ml of carboxymethyl (CM)-Sepharose; the mixture was shaken gently overnight and poured into a 16- by 320-mm column, and the b-lactamase activity was eluted with a linear NaCl gradient (0 to 1.0 M). The active fractions (45 ml) were pooled and diluted threefold with phosphate buffer as described above, and 10 ml was applied to a cation-exchange MonoS HR5/5 column equilibrated with the same buffer. The b-lactamase was eluted with a 0.15 to 0.3 M NaCl gradient (1 ml/min). SDS-PAGE. Samples (5 to 10 mg of protein) were submitted to sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) in SDS–12% polyacrylamide gels as described by Laemmli (20) and stained with Coomassie blue. Penicillin-binding assay. Pure b-lactamase (1 mg of protein) and 1 to 2.5 ml (1.5 mM) of [3H]benzylpenicillin (20 Ci/mmol; Amersham) were incubated for 10 min at 30°C in a total volume of 15 ml, and then 2 ml of 100 mM nonradioactive benzylpenicillin was added. The proteins were precipitated with an equal volume of cold acetone, suspended in SDS-PAGE loading buffer, and applied to an SDS–10% polyacrylamide gel. After electrophoresis, the gel was stained with Coomassie blue, washed successively with distilled water for 30 min and with 40% ethanol containing 16% salicylic acid for an additional 30 min, and dried. The autoradiograph was exposed for 5 days to X-ray Hyper-film MP (Amersham). DNA manipulation. Isolation of DNA from Streptomyces and protoplast transformation were as described by Hopwood et al. (13). Other standard DNA techniques were as described by Sambrook et al. (29). Sequence analysis was done with the GENEPLOT program (DNAStar), and amino acid sequence analysis was done with the Clustal V program (DNAStar). In Southern hybridizations, the filters were prehybridized at 42°C for 4 to 14 h in prehybridization solution containing 30% formamide, 63 SSC (13 SSC is 0.15 M NaCl plus 0.015 M sodium citrate), 13 Denhardt’s solution (10 mg of Ficoll, 10 mg of polyvinylpyrrolidone, 10 mg of bovine serum albumin, 50 ml of H2O), and 0.1% SDS and then hybridized with the radioactive probe for 16 to 24 h under the same conditions. The filters were washed twice with 23 SSC containing 0.1% SDS first at room temperature, then at 42°C, and then at 55°C and finally with 0.13 SSC–0.1% SDS at 60 to 65°C if required (29). Numbering of the protein residues. The ABL numbering system of class A b-lactamases (2) was used in the sequence comparisons. Nucleotide sequence accession number. The sequence of the bla gene of S. clavuligerus has been deposited in the EMBL database under accession no. Z54190.
RESULTS Identification of a b-lactamase-encoding gene in the S. clavuligerus cephamycin C gene cluster. To locate the cephamycin C gene cluster, a genomic library of S. clavuligerus, constructed in l-GEM12 phage, was probed with (i) a 4-kb EcoRI-HindIII DNA fragment known to contain the lat gene and part of the pcbAB gene (35) and (ii) a 3.3-kb BamHI-BglII heterologous DNA probe containing the cefD-cefE genes of N. lactamdurans (5). Six phages that gave positive hybridization with the first or the second probe were mapped with restriction endonucleases. The six phages covered a total DNA region of 35 kb around the lat gene of S. clavuligerus. To establish if a b-lactamase gene was present in the cluster, DNAs from the six phages were digested with BamHI, blotted, and hybridized with a 0.7-kb NotI DNA fragment internal to the bla gene of N. lactamdurans (5). A clear positive hybridization signal was found in a 1.8-kb BamHI DNA fragment of the lEMBL-C9 phage. This
J. BACTERIOL.
phage also contained the cefE and cefD genes of S. clavuligerus (18) and a 12-kb DNA fragment downstream from cefE but not the lat-cefD region (Fig. 1A). The 1.8-kb BamHI DNA fragment giving a positive hybridization signal was located downstream from the cefE gene. The bla gene encodes a class A b-lactamase. The 1.8-kb BamHI DNA fragment was sequenced. Analysis of the sequence revealed an open reading frame (996 nucleotides) that is located 5.1 kb downstream from cefE in the cephamycin C gene cluster and in an orientation opposite that of the cefDcefE (Fig. 1A). The open reading frame with a G1C content of 76% was preceded by a GGAGG sequence identical to those conserved in Streptomyces ribosome binding sites (Fig. 1B). A palindromic sequence AGGGGCCGGGGCGCCTCGCCAC CCCGGCCCCT (nucleotides 1073 to 1108) was found in the region which encodes the last 11 amino acids of the gene. The sequenced open reading frame encoded a 332-residue protein (Mr, 35218) that exhibited a high percentage of identical amino acids with the b-lactamases of N. lactamdurans (49.0%), S. lavendulae (46.7%), S. badius (45.4%), Actinomadura strain R39 (44.4%), S. cacaoi CADSM (42.9%), S. cellulosae (41.4%), S. fradiae (40.6%), and S. cacaoi CAKCC (38.9%). All of these are class A b-lactamases. A high degree of identity was also found with the Bacillus licheniformis blactamase. Residues 30 to 285 in the ABL numbering system were chosen by Joris et al. (16) to compare class A b-lactamases in order to eliminate the influence of the variable N- and C-terminal parts of the proteins which have little influence on the catalytic properties. Between these residues, the sequences of the B. licheniformis and S. clavuligerus enzymes could be aligned without gap or insertion, with 43% identity. In the S. clavuligerus enzyme, several amino acids reported as important for b-lactamase stability (Gly45, Gly143, Gly144, Gly156, Pro107, Pro174, Pro226, and Pro252) (6) were conserved, as well as the four characteristic consensus sequences common to all class A b-lactamases (Fig. 1B): 70STFK73, 130SDG132, 166 EPELN170, and 234KTG236. The second consensus sequence (normally SDN in all other b-lactamases) was SDG in the S. clavuligerus protein. The asparagine residue of this sequence is usually conserved in class C b-lactamases and in DD-carboxypeptidases (16). Phylogenetic analysis: a cluster of actinomycete b-lactamase proteins. Amino acid sequences of 19 class A b-lactamases were analyzed. Two groups of phylogenetically separated Streptomyces b-lactamases have been described (16, 23). The b-lactamases of S. clavuligerus and of N. lactamdurans are clustered with the homologous proteins of S. badius, Actinomadura strain R39, S. cacaoi CAKCC, and S. cacaoi CADSM (Fig. 2). Presence of b-lactamase genes in b-lactam-producing microorganisms. To establish if the presence of b-lactamase genes is general in b-lactam-producing organisms, total DNA of cephamycin C (S. cattleya and N. lactamdurans), cephamycins A and B (S. griseus), or monobactam (Flavobacterium sp.) producers was digested with MluI and hybridized under very stringent conditions with a 0.6-kb SacII fragment internal to S. clavuligerus bla gene. Hybridizations gave a strong positive signal with S. cattleya, S. griseus, and N. lactamdurans DNAs (Fig. 3), indicating that the cephamycin producers appear to contain a bla gene. The bla gene of N. lactamdurans has been cloned previously (5). In parallel, DNAs of the b-lactam-nonproducers S. cacaoi CADSM, S. badius, S. fradiae, and S. lavendulae, as well as of Agrobacterium sp. and Xanthomonas sp., known to secrete blactamases, were digested with MluI and hybridized with a HindII 570-bp DNA fragment internal to the pcbC gene of N.
VOL. 179, 1997
b-LACTAMASE GENE OF S. CLAVULIGERUS
6037
FIG. 1. (A) Location of the bla gene in the cephamycin C gene cluster of S. clavuligerus. Most cephamycin genes are upstream of cefD in a DNA fragment not included in phage lEMBL-C9. B, BamHI; K, KpnI. (B) Nucleotide and amino acid sequences of a 1,110-nucleotide fragment containing the bla gene of S. clavuligerus. A putative Shine-Dalgarno sequence is boxed; the inverted repeat at the end of the gene is overlined with convergent arrows. Four sequences involved in the active site and conserved in nearly all class A b-lactamases are shadowed, and their first residues (S70, S130, E166, and K234 in the ABL numbering system) are marked by asterisks.
lactamdurans, which encodes the isopenicillin N synthase in the cephamycin C biosynthetic pathway. None of the strains gave positive hybridization under stringent conditions where S. clavuligerus and N. lactamdurans gave a clear hybridization. This result suggests that genes for cephamycin biosynthesis do not occur in these strains in spite of the great similarity between the bla gene of S. clavuligerus and those of S. cacaoi CADSM and S. badius. S. clavuligerus lacks significant b-lactamase activity in vivo. Since S. clavuligerus produces two b-lactamase inhibitory substances, it is of great interest to know if b-lactamase activity is detected in S. clavuligerus cultures. No significant b-lactamase activity could be detected in either growing or resting cells of S. clavuligerus in different media in samples taken at 12-h intervals, and the addition of benzylpenicillin (50 mg/ml) failed to induce the synthesis of the enzyme. Benzylpenicillin remained undegraded and active in the culture supernatant, with no apparent effect on the culture. These results suggest that the b-lactamase of S. clavuligerus is not active in vivo probably due to the simultaneous production of clavulanic acid and BLIP by S. clavuligerus. The b-lactamase shows penicillin-binding activity. To purify the enzyme, the bla gene was overexpressed in S. lividans with the help of the tipA expression system (Fig. 4A). Addition of
thiostrepton induced bla expression resulting in a twofold increase of b-lactamase activity. After incubation with [3H]benzylpenicillin, the acyl enzyme intermediate could be visualized by fluorography (Fig. 4B). A single penicillin-binding protein with a molecular mass of about 33 kDa (agreeing with that of the purified b-lactamase protein; see below) was observed in the autoradiograph, indicating that the pure S. clavuligerus b-lactamase binds penicillin. Purification of the b-lactamase. The enzyme was purified to electrophoretic homogeneity from the periplasmic (Sp) fraction as indicated in Materials and Methods (Fig. 5, lane 4); this resulted in 30-fold increase in the b-lactamase activity with a recovery of 6.2% (Table 1). Two close bands of apparent Mrs of 33,000 and 34,000 were observed in the purified preparation (Fig. 5, lane 4). That the protein bands corresponded to the S. clavuligerus b-lactamase was suggested by the fact that both gave a weak reaction with antibodies raised against the B. licheniformis and Streptomyces albus b-lactamases. The N-terminal sequence of the larger protein could not be determined due to a probable blocking, but that of the smaller protein was RARVADLAAL. Processing at position 53 thus yields a 279residue polypeptide with a calculated Mr of 30,107. The occurrence of ragged N termini has been observed before with exocellular b-lactamases (22).
6038
´ REZ-LLARENA ET AL. PE
FIG. 2. Phylogenetic tree of 15 class A b-lactamases. CDIV, Citrobacter diversus; SHV-1, Klebsiella pneumoniae; TEM-1, Salmonella paratyphi B; CARB-3, Pseudomonas aeruginosa Cilote; STAAU, Staphylococcus aureus; BCE5B, Bacillus cereus 5/B; BADIUS, Streptomyces badius DSM 40139; CAKCC, Streptomyces cacaoi KCC-0352; CADSM, Streptomyces cacaoi DSM 40057; CELLU, Streptomyces cellulosae; FRAD, Streptomyces fradiae DSM 40063; LAVEN, Streptomyces lavendulae DSM 2014; NLAC, Nocardia lactamdurans; SCLA, Streptomyces clavuligerus; BLICH, Bacillus licheniformis 749/C. The S. clavuligerus enzyme is shadowed.
Kinetic parameters. Table 2 summarizes the kinetic parameters for the hydrolysis of various substrates. With nitrocefin, initial rates were determined at concentrations ranging from 25 to 400 mM, and the Km value was obtained with the help of the Hanes linearization of the Henri-Michaelis equation. Higher concentrations could not be used due to interference by the dimethylformamide used as solvent. The kcat and Km values for cephaloridine were similarly determined with substrate concentrations ranging from 100 mM to 1 mM. With benzylpenicillin and cefoxitin, the kcat values were determined under zero-order conditions ([S] .. Km), and the Km values were estimated as Ki values in competition assays with 100 mM nitrocefin as the substrate. With the other compounds and under similar conditions, no significant inhibition of nitrocefin hydrolysis was observed at concentrations up to or higher than 1 mM. Only the Vmax/Km values could accordingly be determined on the basis of the first-order reaction time courses obtained at 100 mM substrate concentrations. Finally, the en-
FIG. 3. Hybridization of total DNA of b-lactam antibiotic producers with the bla gene of S. clavuligerus. Total DNA samples were digested with MluI and hybridized with a 0.6-kb SacI fragment internal to the bla gene of S. clavuligerus. Lanes: 1, S. griseus NRRL 3851; 2, S. cattleya; 3, N. lactamdurans; 4, Flavobacterium sp.
J. BACTERIOL.
FIG. 4. (A) Expression of the b-lactamase of S. lividans[pULFL2] in the absence (F) and presence (■) of thiostrepton and b-lactamase activity in S. lividans[pIJTipA] in the presence or absence of thiostrepton (Œ). The inset shows plasmid pULFL2, used for expression of bla, which contains the bla gene downstream of the tipA promoter. A 1.3-kb BclI-BamHI fragment containing the bla gene (internal to the 1.8-kb BamHI DNA fragment) was subcloned into pBluescript KS1 digested with BamHI. The fragment, rescued with HindIII and BamHI, was ligated to plasmid pIJTipA restricted with the same enzymes and transformed into S. lividans. (B) [3H]penicillin binding by the S. clavuligerus b-lactamase. Lane 1, assay with 1.5 nmol of [3H]benzylpenicillin; lane 2, assay with 3.75 nmol of [3H]benzylpenicillin.
zyme activity was strongly inhibited in the presence of 5 mM BLIP or 30 mM clavulanate (details not shown). DISCUSSION The presence of a b-lactamase gene in the cluster of cephamycin genes in S. clavuligerus is particularly interesting. This microorganism contains genetic information for the synthesis of the b-lactam antibiotic cephamycin C and an adjacent cluster for the synthesis of clavulanic acid (a well-known b-lactamase inactivator) (34) in addition to the gene encoding BLIP (8). It is tempting to propose that clavulanic acid and BLIP are synthesized to modulate the b-lactamase activity, which in turn appears to play a role in cell wall biosynthesis and/or differentiation (19).
FIG. 5. SDS-PAGE of samples (2 mg of protein per lane) at different stages of the purification of the S. clavuligerus b-lactamase. Lanes: 1, Mr standards; 2, culture supernatant; 3, proteins released (supernatant) after obtaining protoplasts; 4, CM-Sepharose; 5, MonoS high-pressure liquid chromatography. A 14-kDa protein in lane 3 corresponds to the lysozyme used to obtain protoplasts that was removed by MonoS fast protein liquid chromatography (lane 5).
b-LACTAMASE GENE OF S. CLAVULIGERUS
VOL. 179, 1997
6039
TABLE 1. Purification of the b-lactamase of S. clavuligerus Purification step
Protoplast supernatant CM-Sepharose MonoS high-pressure liquid chromatography
Protein (mg)
Activity (mmol/min)
Sp act (mmol/mg of protein/min)
Recovery (%)
Purification (fold)
416 4 0.85
78.31 15.04 4.86
0.188 3.76 5.71
100 19.2 6.2
1.0 20.0 30.4
A b-lactamase gene was first reported in the cephamycin C cluster of N. lactamdurans (5). Subsequently a different blactamase was found in the cephabacin cluster of Lysobacter lactamgenus (17). As described here, class A b-lactamase genes also occur in the cephamycin producers S. griseus and S. cattleya. The bla gene of S. clavuligerus is present in the cephamycin C gene cluster, although it is located in a different position than in the cluster of N. lactamdurans. However, not all b-lactamases in actinomycetes are associated with clusters of genes for the biosynthesis of b-lactams. Hybridization with the pcbC gene (encoding IPN synthase, an enzyme common to all penicillin, cephalosporin, and cephamycin producers) unequivocally showed that well-known b-lactamase producers such as S. cacaoi, S. badius, S. cellulosae, and S. fradiae (9) lack this gene. It seems that the b-lactamase gene, which may have originated in b-lactam-producing bacteria, has been transferred separately to other actinomycetes as well as to a variety of other gram-positive and gram-negative bacteria. As clearly demonstrated by sequence similarity, the b-lactamase of S. clavuligerus belongs to class A. It exhibits the four conserved motifs, but the second one is modified (SDG instead of SDN). The SDN motif is highly conserved in class A b-lactamases (2) and replaced by YAN and YGN in class C and class D b-lactamases, respectively, by SXN in most penicillin-binding proteins and by YSN in the Streptomyces strain R61 DD-peptidase. The third residue in this motif is always an asparagine, with the exceptions of the Bacillus cereus III class A b-lactamase (SDS) and the Streptomyces strain K15 DD-peptidase (SGC). Nonetheless, this residue always contains an H-bondforming group. The S. clavuligerus enzyme is a b-lactamase of very poor activity. Its kcat/Km value for benzylpenicillin is 2 to 4 orders of magnitude lower than that of most class A blactamases (10, 23), and it is tempting to correlate this low activity with the N3G substitution at position 132. Indeed, its kinetic parameters for benzylpenicillin are strikingly similar to those of the N132A mutant of the S. albus G b-lactamase
TABLE 2. Kinetic parameters of the S. clavuligerus b-lactamase with different b-lactam compounds as substrates Compound
kcat (s21)
Km (mM)
kcat/Km (M21 s21)
Benzylpenicillin Nitrocefin Cephaloridine Cephalothin Cephacetrile Cefoxitin Cephamycin C Cephalosporin C Cefamandole Cephalexin Cefotaxime Ceftazidime
0.36 6 0.05 10 6 1 1.8 6 0.5
11 6 3 300 6 30 550 6 20 .1,000 .1,000 2.3 6 0.5 250 .500 .1,000 .5,000 .1,000 .1,000
32,000 30,000 3,300 700 500 97,000
0.22 6 0.05
8 6 2a 361 ,5 ,5 ,5
a Substrate-induced inactivation was observed after long contact times (60 to 90 min).
studied by Jacob et al. (14). But in contrast to the S. clavuligerus enzyme, the cephalosporinase activity of this mutant was nearly undetectable. In fact, the relative cephalosporinase activity (i.e., the cephalosporinase/benzylpenicillinase ratio) of the S. clavuligerus b-lactamase was in the range of those observed for several class A b-lactamases (23, 27). One can conclude that the impairing effect of the N132G substitution is compensated for by other replacements in the S. clavuligerus enzyme. Three such substitutions could be of particular importance: (i) the R164Q mutation, which should increase the mobility of the V loop by disrupting the R164-Asp179 salt bridge (12) and thus both depress the general activity of the enzyme and increase the relative cephalosporinase activity; (ii) the presence of a Lys residue at position 104 (in other class A enzymes, this residue is either negatively charged or neutral [2]); and (iii) the T-237 residue. In the TEM enzyme, the A237T mutation is known to increase the relative cephalosporinase activity (11). Similarly, the A237T replacement is found in the S. badius and S. cacaoi CADSM b-lactamases and might be responsible for their rather wide-spectrum activities (31). It is also quite possible that these mutations might act in synergy with other, nonidentified residues, to drastically increase the cephalosporinase activity over that of the S. albus N132A mutant. The low kcat value for benzylpenicillin also explains why trapping of the acyl enzyme was possible. The acyl enzyme present at the steady state could be precipitated by acetone and stabilized by denaturation, which allowed its detection by fluorography. This finding shows that the acylation rate constant (k2) is significantly higher than that characteristic of deacylation (k3). Finally, the relatively high activity toward cefoxitin remains unexplained. This result suggests a rather unique mode of binding of the antibiotic to the active site, since in the other class A b-lactamases, the 7-a-methoxy side chain of cefoxitin is known to modify the position of a water molecule which is thought to play an active role in the acylation reaction (21). A possible physiological role for b-lactamases, besides the hydrolysis of b-lactam antibiotics, is suggested by the presence of the corresponding gene in the chromosome of a large number of bacterial genera but has remained elusive up to the present time. The presence of a gene encoding a b-lactamase of very poor activity in the b-lactam synthesis gene cluster is even more surprising if the primary role of the enzyme is to destroy b-lactams and might suggest an alternative hypothesis. Disruption of the N. lactamdurans b-lactamase gene (also located in the cephamycin cluster) showed that it is not essential for cephamycin biosynthesis but affects morphology (and antibiotic production) on solid medium (19). We propose that the primary role of the b-lactamase encoded in the b-lactam clusters is in cell wall synthesis and morphology and that its activity in the S. clavuligerus cells is regulated by BLIP and clavulanic acid. If this hypothesis is correct, BLIP-like inhibitors are likely to be present in all b-lactamase-producing actinomycetes.
6040
´ REZ-LLARENA ET AL. PE
J. BACTERIOL.
ACKNOWLEDGMENTS This work was supported by grants of the CICYT (Petri 93-0081). J. Perez-Llarena was supported by a fellowship of the Education Council of the Basque Government (Spain). J. J. R. Coque and J. L. Fuente were supported by fellowships of the PFPI Program, Ministry of Education and Science (Madrid). The work in Lie`ge was supported by the Belgian Program of Interuniversity Poles of Attraction (PAI no. 19) and an Action Concerte´e with the Belgian Government (93-98/170). We thank M. Forsman for providing b-lactamase-producing strains, Y. Aharonowitz for Flavobacterium sp., S. Jensen for a sample of BLIP, Merck, Sharp & Dohme (Rahway, N.J.) and Antibio ´ticos, S.A. (Leo ´n, Spain), for providing cephamycin C and cephalosporin C, and S. Baumberg for critical reading of the manuscript. REFERENCES 1. Aharonowitz, Y., G. Cohen, and J. F. Martı´n. 1992. Penicillin and cephalosporin biosynthetic genes: structure, organization, regulation and evolution. Annu. Rev. Microbiol. 46:461–495. 2. Ambler, R. P., A. F. Coulson, J. M. Fre`re, J. M. Ghuysen, B. Jaurin, B. Joris, R. Levesque, G. Tiraby, and S. G. Waley. 1991. The structure of b-lactamases. Biochem. J. 276:269–272. 3. Benveniste, R., and J. Davies. 1973. Aminoglycoside antibiotic-inactivating enzymes in actinomycetes similar to those present in clinical isolates of antibiotic-resistant bacteria. Proc. Natl. Acad. Sci. USA 70:2276–2280. 4. Brown, A. G., D. Butterworth, M. Cole, G. Hanscomb, J. D. Hood, and C. Reading. 1976. Naturally occurring b-lactamase inhibitors with antibacterial activity. J. Antibiot. 29:668–669. 5. Coque, J. J. R., P. Liras, and J. F. Martı´n. 1993. Genes for a b-lactamase, a penicillin-binding protein and a transmembrane protein are clustered with the cephamycin biosynthetic genes in Nocardia lactamdurans. EMBO J. 12:631–639. 6. Coutoure, F., J. Lachapelle, and R. C. Levesque. 1992. Phylogeny of LCR-1 and Oxa-5 with class A and class D b-lactamases. Mol. Microbiol. 6:1693– 1705. 7. Cundliffe, E. 1989. How antibiotic-producing organisms avoid suicide. Annu. Rev. Microbiol. 43:207–223. 8. Doran, J. L., B. K. Leskiw, S. Aippersbach, and S. E. Jensen. 1990. Isolation and characterization of a b-lactamase-inhibitory protein from Streptomyces clavuligerus and cloning and analysis of the corresponding gene. J. Bacteriol. 172:4909–4918. 9. Forsman, M., B. Haggstrom, L. Lindgren, and B. Jaurin. 1990. Molecular analysis of b-lactamases from four species of Streptomyces: comparison of amino acid sequences with those of other b-lactamases. J. Gen. Microbiol. 136:589–598. 10. Fre`re, J. M. 1995. b-Lactamases and bacterial resistance to antibiotics. Mol. Microbiol. 16:385–395. 11. Hall, A., and J. R. Knowles. 1976. Directed selective pressure on a blactamase to analyse molecular changes involved in development of enzyme function. Nature 264:803–804. 12. Herzberg, O., G. Kapadia, B. Blanco, T. S. Smith, and A. Coulson. 1991. Structural basis for the inactivation of the P54 mutant of b-lactamase from Staphylococcus aureus PC1. Biochemistry 30:9503–9509. 13. Hopwood, D. A., M. J. Bibb, K. F. Chater, T. Kieser, C. J. Bruton, H. M. Kieser, D. J. Lydiate, C. P. Smith, J. M. Ward, and H. Schrempf. 1985. Genetic manipulation of Streptomyces: a laboratory manual. The John Innes Foundation, Norwich, England. 14. Jacob, F., B. Joris, S. Lepage, J. Dusart, and J. M. Fre`re. 1990. Role of the conserved amino acids of the SDN loop (Ser130, Asp131 and Asn132) in a class A b-lactamase studied by site-directed mutagenesis. Biochem. J. 271:399– 406. 15. Jaurin, B., M. Forsman, and B. Haggstrom. 1988. b-Lactamase genes of Streptomyces badius, Streptomyces cacaoi and Streptomyces fradiae: cloning and expression in Streptomyces lividans. Biochim. Biophys. Acta 949:288–296. 16. Joris, B., P. Ledent, O. Dideberg, E. Fonze´, J. Lamotte-Brasseur, J. A. Kelly,
17.
18.
19.
20. 21.
22.
23.
24.
25. 26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
J. M. Ghuysen, and J. M. Fre`re. 1991. Comparison of the sequences of class A b-lactamases and of the secondary structure elements of penicillin-recognizing proteins. Antimicrob. Agents Chemother. 35:2294–2301. Kimura, H., H. Miyashita, and Y. Sumino. 1996. Organization and expression in Pseudomonas putida of the gene cluster involved in cephalosporin biosynthesis from Lysobacter lactamgenus YK90. Appl. Microbiol. Biotechnol. 45:490–501. Kovacevic, S., M. B. Tobin, and J. R. Miller. 1990. The b-lactam biosynthesis genes for isopenicillin N epimerase and deacetoxycephalosporin C synthetase are expressed from a single transcript in Streptomyces clavuligerus. J. Bacteriol. 172:3952–3958. Kumar, C. V., J. L. de la Fuente, A. L. Leita ˜o, P. Liras, and J. F. Martı´n. 1996. Effect of amplification or targeted disruption of the b-lactamase gene of Nocardia lactamdurans on cephamycin biosynthesis. Appl. Microbiol. Biotechnol. 45:621–628. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680–685. Lamotte-Brasseur, J., G. Dive, O. Dideberg, P. Charlier, J. M. Fre`re, and J. M. Ghuysen. 1991. Mechanism of acyl transfer by the class A serine b-lactamase of Streptomyces albus G. Biochem. J. 279:213–221. Matagne, A., B. Joris, J. Van Beeumen, and J. M. Fre`re. 1991. Ragged N-termini and other variants of class A b-lactamases analysed by chromatofocusing. Biochem. J. 273:503–510. Matagne, A., A. M. Misselyn-Bauduin, B. Joris, T. Erpicum, B. Granier, and J. M. Fre`re. 1990. The diversity of the catalytic properties of class A blactamases. Biochem. J. 265:131–146. O’Callaghan, C. H., A. Morris, S. Kirby, and A. Shingler. 1972. A novel method for detection of b-lactamases by using a chromogenic cephalosporin substrate. Antimicrob. Agents Chemother. 1:283–288. Ogawara, H. 1975. Production and properties of beta-lactamase in Streptomyces. Antimicrob. Agents Chemother. 8:402–408. Ogawara, H., and S. Horikawa. 1980. Penicillin-binding proteins of Streptomyces cacaoi, Streptomyces olivaceus, and Streptomyces clavuligerus. Antimicrob. Agents Chemother. 17:1–7. Raquet, X., J. Lamotte-Brasseur, E. Fonze´, S. Goussard, P. Courvalin, and J. M. Fre`re. 1994. TEM b-lactamase mutants hydrolysing third-generation cephalosporins. J. Mol. Biol. 244:625–639. Romero, J., P. Liras, and J. F. Martı´n. 1984. Isolation and biochemical characterization of Streptomyces clavuligerus mutants in the biosynthesis of clavulanic acid and cephamycin C. Appl. Microbiol. Biotechnol. 20:318–325. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. Sendouda, A., H. Urabe, and H. Ogawara. 1993. Cloning, nucleotide sequence and expression of a b-lactamase gene from Streptomyces lavendulae. FEMS Microbiol. Lett. 112:343–348. Sougakoff, W., A. Petit, S. Goussard, D. Sirot, A. Bure, and P. Courvalin. 1989. Characterization of the plasmid genes blaT-4 and blaT-5 which encode the broad-spectrum b-lactamases TEM-4 and TEM-5 in Enterobacteriaceae. Gene 78:339–348. Strynadka, N. C. J., S. Jensen, K. Johns, H. Blanchard, M. Page, A. Matagne, J. M. Fre`re, and M. N. G. James. 1994. Structural and kinetic characterization of a b-lactamase-inhibitor protein. Nature 368:657–660. Takano, E., J. White, C. J. Thompson, and M. J. Bibb. 1995. Construction of thiostrepton-inducible, high copy-number expression vector for use in Streptomyces spp. Gene 166:133–137. Ward, J. M., and J. E. Hodgson. 1993. The biosynthetic genes for clavulanic acid and cephamycin production occur as a “super-cluster” in three Streptomyces. FEMS Microbiol. Lett. 110:239–242. Yu, H., E. Serpe, J. Romero, J. J. R. Coque, K. Maeda, M. Oelgeschla ¨ger, G. Hintermann, P. Liras, J. F. Martı´n, A. L. Demain, and J. Piret. 1994. Possible involvement of the lysine S-aminotransferase gene (lat) in the expression of the genes encoding ACV synthetase (pcbAB) and isopenicillin N synthase (pcbC) in Streptomyces clavuligerus. Microbiology 140:3367–3377.
