Swine, human or avian influenza viruses differentially activates porcine dendritic cells cytokine profile

G Model VETIMM-9026; No. of Pages 11

ARTICLE IN PRESS Veterinary Immunology and Immunopathology xxx (2013) xxx–xxx

Contents lists available at SciVerse ScienceDirect

Veterinary Immunology and Immunopathology journal homepage: www.elsevier.com/locate/vetimm

Research paper

Swine, human or avian influenza viruses differentially activates porcine dendritic cells cytokine profile Tufária Mussá a , Maria Ballester b , Erika Silva-Campa c , Massimiliano Baratelli a , Núria Busquets a , Marie-Pier Lecours d , Javier Dominguez e , Massimo Amadori f , Lorenzo Fraile a,g , Jesús Hernández c , María Montoya a,h,∗ a Centre de Recerca en Sanitat Animal (CReSA), UAB-IRTA, Campus de la Universitat Autònoma de Barcelona, 08193 Bellaterra (Cerdanyola del Vallès), Spain b Centre de Recerca en Agrigenòmica (CRAG), CSIC-IRTA-UAB-UB, Campus UAB, Barcelona, Spain c Laboratorio de Inmunología, CIAD A.C. Hermosillo, Sonora, Mexico d Faculté de Médecine Vétérinaire, GREMIP-CRIP, Université de Montréal, St-Hyacinthe, Québec, Canada e Dpto. de Biotecnología, INIA, Madrid, Spain f Laboratory of Cellular Immunology, Istituto Zooprofilattico Sperimentale della Lombardia e dell’Emilia-Romagna, Brescia, Italy g Universitat de Lleida, Lleida, Spain h Instituto de Recerca i Tecnologia Agroalimentaria (IRTA), Barcelona, Spain

a r t i c l e

i n f o

Article history: Received 10 July 2012 Received in revised form 4 April 2013 Accepted 6 April 2013 Keywords: Dendritic cells Cytokines Influenza virus Transcription factors

a b s t r a c t Swine influenza virus (SwIV) is considered a zoonosis and the fact that swine may act as an intermediate reservoir for avian influenza virus, potentially infectious for humans, highlights its relevance and the need to understand the interaction of different influenza viruses with the porcine immune system. Thus, in vitro porcine bone marrow-derived dendritic cell (poBMDCs) were infected with a circulating SwIV A/Swine/Spain/SF32071/2007(H3N2), 2009 human pandemic influenza virus A/Catalonia/63/2009(H1N1), low pathogenic avian influenza virus (LPAIV) A/Anas plathyrhynchos/Spain/1877/2009(aH7N2) or high pathogenic avian influenza virus (HPAIV) A/Chicken/Italy/5093/1999(aH7N1). Swine influenza virus H3N2 infection induced an increase of SLA-I and CD80/86 at 16 and 24 h post infection (hpi), whereas the other viruses did not. All viruses induced gene expression of NF-B, TGF-ˇ, IFN-ˇ and IL-10 at the mRNA level in swine poBMDCs to different extents and in a time-dependent manner. All viruses induced the secretion of IL-12 mostly at 24 hpi whereas IL-18 was detected at all tested times. Only swH3N2 induced IFN-␣ in a timedependent manner. Swine H3N2, aH7N2 and aH7N1 induced secretion of TNF-␣ also in a time-dependent manner. Inhibition of NF-␬B resulted in a decrease of IFN-␣ and IL-12 secretion by swH3N2-infected poBMDC at 24 hpi, suggesting a role of this transcription factor in the synthesis of these cytokines. Altogether, these data might help in understanding the relationship between influenza viruses and porcine dendritic cells in the innate immune response in swine controlled through soluble mediators and transcription factors. © 2013 Elsevier B.V. All rights reserved.

1. Introduction ∗ Corresponding author at: Campus UAB, edifici CReSA, 08193 Bellaterra, Barcelona, Spain. Tel.: +34 93 581 45 62; fax: +34 93 581 44 90. E-mail address: [email protected] (M. Montoya).

Swine influenza virus (SwIV) causes a relevant respiratory disease in swine which has often been neglected due to the impact of other porcine pathogens until the

0165-2427/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.vetimm.2013.04.004

Please cite this article in press as: Mussá, T., et al., Swine, human or avian influenza viruses differentially activates porcine dendritic cells cytokine profile. Vet. Immunol. Immunopathol. (2013), http://dx.doi.org/10.1016/j.vetimm.2013.04.004

VETIMM-9026; No. of Pages 11

ARTICLE IN PRESS

2

T. Mussá et al. / Veterinary Immunology and Immunopathology xxx (2013) xxx–xxx

G Model

emergence of the novel swine-derived influenza A (H1N1) virus in 2009. Influenza viruses are enveloped, singlestranded RNA viruses of the Orthomyxoviridae family. The genome of influenza A viruses consists of eight segments of single-stranded RNA, which are of negative polarity. The haemagglutinin (HA) and neuraminidase (NA) are very important targets of the antibody response in the host, but they are also highly variable; the nucleoprotein (Davenport et al., 1953) and M proteins are more conserved between different influenza-A viruses (Webster et al., 1992). Nevertheless, influenza viruses are genetically unstable due to antigenic drift and shift mechanisms (Hay et al., 2001). Three virus subtypes (H1N1, H1N2 and H3N2) are currently circulating in swine herds in Europe (Van Reeth et al., 2008) and Spain (Maldonado et al., 2006; Simon-Grife et al., 2011) and they have been associated with disease in swine (Ellis et al., 2004). Pigs are susceptible to infection with low pathogenic and high pathogenic avian influenza viruses (LPAIV and HPAIV, respectively) (Van Reeth, 2007). Most of the LPAIV subtypes diagnosed in field samples possess an H1 or H3 usually restricted to birds. The HPAIV can and do infect pigs under natural and experimental conditions (Van Reeth, 2007). Studies designed to analyze the occurrence of cross protection between SwIV and avian or human influenza viruses have shown that prior infection of pigs with SwIV induces a barrier to infection with avian influenza viruses of unrelated subtype (De Vleeschauwer and Van Reeth, 2010); and that experimental infection with H1N1 European SwIV protects pigs from an infection with the 2009 pandemic H1N1 human influenza virus (Busquets et al., 2010). It is currently well accepted that pigs are “mixing vessels” as they possess ␣-2,3 and ␣-2,6 sialic acid receptors for both avian and human viruses respectively (Van Poucke et al., 2010); and they are susceptible to infection with low pathogenic (LPAI) and high pathogenic (HPAI) avian influenza viruses (Van Reeth, 2007). Sialic acids (SA, N-acetylneuraminic acid) are considered the primary receptors for virus attachment to cell surfaces, binding to a pocket at the distal tip of the HA of influenza A virus (Weis et al., 1988). SA consist of nine carbon sugars frequently attached through ␣-2,3 or ␣-2,6 linkages to underlying sugar chains of glycoproteins in the cell membrane. It is well established that avian and human viruses differ in their SA binding affinity, since HA from human isolates usually bind SA ␣-2,6, whereas the avian isolates usually have affinity for SA ␣-2,3 (Rogers and Paulson, 1983). The fact that SwIV is considered a zoonosis, as SwIV can infect humans, and importantly, that swine may act as an intermediate reservoir for avian influenza virus to colonize humans illustrates its relevance and the need to understand the interaction of influenza viruses with the porcine immune system. The presence on the pig’s respiratory tract of receptors for both human (␣-2,6 sialic acids) and avian (␣-2,3 sialic acids) viruses favours the possibility of reassortment and outbreaks of new and more pathogenic viruses (van Eijk et al., 2004). Also, cytokines like IFN-␣, IL-6, IL-1, TNF-␣, IFN-␥ and IL-12 were reported as being associated with acute influenza virus infection in pigs (Barbe et al., 2011).

The adaptive immune response against a particular pathogen demands that the pathogen be recognized efficiently; in this respect, the efficacy of the immune response depends on the role played by dendritic cells (DCs). Dendritic cells are competent antigen-presenting cells (APCs) responsible for the activation of naïve T cells and the generation of primary T-cell responses (Inaba et al., 1990), acting as a bridge between the innate and adaptive immune response (Steinman and Hemmi, 2006). To accomplish these functions, they express different specialized pattern recognition receptors (PRRs) for particular pathogen-associated molecular patterns (PAMPs) (Kawai and Akira, 2007, 2008). According to their functionality and phenotype, DCs can be classified as conventional DCs (cDCs) known as professional APCs, or plasmacytoid DCs (pDCs), which naturally produce high levels of type-I interferon (Liu, 2005). In swine, both cDCs and pDCs have important antigen-presenting functions and they complement each other by distinct regulation of major histocompatibility complex class I (MHC I, SLAI in swine) and class II (MHC II, SLA-II molecules in swine), which affects antigen presentation and the profile of secreted cytokines (Summerfield and McCullough, 2009). Interestingly, conventional DCs are among the first cells encountered by most viruses, simply due to their availability at every possible entry site of the body (Freer and Matteucci, 2009). Activation of DCs by PAMPs may activate nuclear factor ␬B (NF-␬B), a central orchestrator of inflammation and immune responses. NF-␬B has been shown to have a critical role in homeostasis of cells of the immune system by maintaining the expression of pro-survival genes (Baltimore, 2011; Smale, 2011) and up-regulating a variety of antiviral genes (Ludwig and Planz, 2008). Also, NF-␬B has been described as being the major host signalling pathway implicated in the replication of influenza virus (Garoufalis et al., 1994; Kumar et al., 2008). On the basis of this previous knowledge, and bearing in mind the location of DCs beneath the epithelium of respiratory organs, our main goal was to evaluate whether different influenza viruses can induce a different activation pattern on porcine DCs, an immune response that might influence the pathogenesis; and whether the NF-␬B pathway may be involved. 2. Materials and methods 2.1. Cells Bone marrow hematopoietic cells (BMHC) were obtained from femurs of healthy Large White X Landrace pigs of eight weeks of age, negative for porcine reproductive and respiratory syndrome virus (PRRSV) and type-2 porcine circovirus (PCV2) by RT-PCR, as previously described (Olvera et al., 2004; Sibila et al., 2004). These animals were also negative by enzyme linked-immunosorbent assay (ELISA) for influenza virus and Actinobacillus (HIPRA, Amer, Spain), Mycoplasma (OXOID, Cambridge, UK), Parvovirus, Adenovirus, Aujeszky’s disease virus (INGENASA, Madrid, Spain) and Salmonella (SVANOVA Biotech AB, Uppsala, Sweden). Bone marrow dendritic cells (BMDCs)

Please cite this article in press as: Mussá, T., et al., Swine, human or avian influenza viruses differentially activates porcine dendritic cells cytokine profile. Vet. Immunol. Immunopathol. (2013), http://dx.doi.org/10.1016/j.vetimm.2013.04.004

G Model VETIMM-9026; No. of Pages 11

ARTICLE IN PRESS T. Mussá et al. / Veterinary Immunology and Immunopathology xxx (2013) xxx–xxx

were generated in an eight-day protocol as previously described (Carrasco et al., 2001; Mussa et al., 2011). Briefly, BMHC were resuspended in RPMI-1640 culture medium containing 2 mM l-glutamine (Invitrogen® , Barcelona, Spain), 100 U/ml Polymixin B (Sigma Aldrich, Madrid, Spain), 10% foetal calf serum (FCS) Euroclone, Sziano, Italy) and 100 U/ml penicillin and 100 ␮g/ml streptomycin (Invitrogen® , Barcelona, Spain). Every 3 days, new medium containing 100 ng/ml rpGM-CSF (R&D Systems, Madrid, Spain) was added. At day 8 of generation, floating cells and semi-adherent cells were harvested, washed in RPMI containing l-glutamine and penicillin/streptomycin and used in the experiments. 2.2. Viruses The A/Swine/Spain/SF32071/2007(H3N2) (hereafter referred to as swH3N2), strain was isolated from a porcine influenza virus outbreak in Spain using embryonated, specific pathogen free (SPF) eggs and subsequently multiplied in Madin-Darby canine kidney cells (MDCK) following the procedures of the International Organization of Epizooties (OIE) (OIE, 2010). Eight sequences of this swH3N2 virus, corresponding to HA, NP, PA, PB2, NA, PB1/PB1-F2, NS1/NS2 and M1/M2 genes were submitted to GenBank (accession numbers: HE774666, HE774667, HE774668, HE774669, HE774670, HE774671, HE774672 and HE774673). The A/Catalonia/63/2009 (H1N1) (hereafter referred as hH1N1), influenza virus was isolated from a patient in the Hospital Clinic, Barcelona, Spain, during the 2009 pandemic and the complete genome was sequenced and submitted to GenBank (accession numbers: GQ464405–GQ464411 and GQ168897). The A/Catalonia/63/2009(H1N1) strain was propagated at 37 ◦ C in the allantoic cavities of 11-day-old embryonated chicken eggs originating from a commercial SPF flock (GDdeventer) following the same procedures of the OIE. The low pathogenic avian influenza virus (LPAIV) A/Anas plathyrhynchos/Spain/1877/2009(H7N2) (hereafter referred to as aH7N2) and high pathogenic avian influenza virus (HPAIV) A/Chicken/Italy/5093/1999(H7N1) (hereafter referred to as aH7N1) were used. The aH7N2 was isolated from samples of avian influenza virus from a surveillance programme in Catalonia (North-eastern of Spain) and the aH7N1 was isolated from a poultry outbreak in Italy in 1999, and was kindly provided by Dr. Ana Moreno from Istituto Zooprofilattico Sperimentale della Lombardia e dell’Emilia Romagna, Brescia, Italy. The deduced amino acid sequence of the region coding for the cleavage sites of the precursors of the haemagglutinin molecules (HA0) were PEIPKGSRVRR*GLF for the aH7N1 and PEIPKGR*GLF for the aH7N2, being typical of HPAIV and LPAIV respectively. All four viruses were previously used in experimental infections (Bertran et al., 2011, 2012; Busquets et al., 2010; Chaves et al., 2011a, 2011b; Mussa et al., 2011). For all viruses, virus titre was calculated by titration in MDCK cells, using the Reed and Muench method (Reed and Muench, 1938). When required, swH3N2 and aH7N1 influenza virus were inactivated by heat at 70 ◦ C for 5 min in a thermoblock.

3

2.3. Sialic acid detection and poBMDCs infection At day 8 of generation, porcine BMDCs or a continuous cell line (MDCK) were stained for ␣-2,3 and ␣-2,6 sialic acids using 20 ␮g/ml of Biotin-labelled Macckia amurensis type II (MAA-II) or Sambucus nigra (SNA) (both from Vector Laboratories INC, CA, USA) for 1 h at 4 ◦ C. After this, cells were washed, and the FITC-conjugated streptavidin (Jackson ImmunoResearch, Suffolk, UK) diluted 1:200 was added for a further 1 h at 4 ◦ C. Then, cells were washed and analyzed using a Coulter® EPICS XL-MCL cytometer. Influenza virus infection/treatment was performed in a 24-well plate (Nunc, Kamstrepvej, Denmark) in which 106 cells were infected with 104 TCID50 of virus for 4, 8, 16 and 24 h following the procedures previously described (Mussa et al., 2011; Rimmelzwaan et al., 1998). Briefly, 104 TCID50 of previous porcine trypsin IX (Sigma–Aldrich, St. Louis, USA) treated swH3N2, hH1N1, aH7N2 or aH7N1 were added to the cells. Then, cells were incubated for 1 h at 37 ◦ C 5% CO2 for virus adsorption. After which, cells were washed once with PBS with 2% FCS and 500 ␮l of RPMI-1640 culture medium containing 2 mM l-glutamine, 10% FCS and 100 U/ml penicillin with 100 ␮g/ml streptomycin were added. Control and infected/treated cells were incubated for 4, 8, 16 and 24 h at 37 ◦ C 5% CO2 . When required, for reverse transcription quantitative real time PCR (RT-qPCR) standard curves, poBMDCs where stimulated with 50 ␮g/ml polyinosinic–polycytidilic acid salt (Poly:IC) (Sigma–Aldrich, St. Louis, USA) for 8 and 16 h. After each time point, supernatants were collected and frozen for IFN-␣, TNF-␣, IL-12 and IL-18 detection by ELISA, while cells were collected in TRIZOL reagent (Ambion-Life Technologies, CA, USA) for RPL19, ˇ2M, IFNˇ, NF-B, TGF-ˇ and IL-10 gene expression analyses by RT-PCR.

2.4. Phenotype of infected cells Flow cytometry was performed using indirect labelling for SLA-I, SLA-II and CD80/86. The human CD152 (CTLA4)muIg fusion protein was used to stain CD80/86 molecules while SLA-I and SLA-II were detected by hybridoma supernatants. For the three markers, the secondary antibody was R-Phycoerythrin Goat anti-mouse IgG (Jackson ImmunoResearch, Suffolk, UK). Briefly, 2.5 × 105 cells/50 ␮l/well were labelled for 1 h at 4 ◦ C for each CD marker, using 50 ␮l anti-SLA-I (clon 4B7/8), 50 ␮l anti-SLA-II (clon 1F12) while manufacturer’s instructions were followed to detect CD80/86 using the CTLA4-muIg (Ancell, Minnesota, USA). After 1 h incubation at 4 ◦ C, cells were washed with cold PBS with 2% FCS by centrifugation at 450 × g, at 4 ◦ C for 5 min. Then, the secondary antibody conjugated to R-Phycoerythrin diluted 1:200 was added. Cells were incubated for further 1 h at 4 ◦ C, and then were washed as before and resuspended in PBS with 2% FCS. SLA-I, SLA-II and CD80/86 stained cells were acquired using FACSaria I (Becton Dickinson® ) and mean fluorescence intensities (MFI) analyzed by FACSDiva v.6.1.2, while for sialic acids a Coulter® EPICS XL-MCL cytometer and an EXPO 32 ADC v.1.2 program were used for analysis. In both cytometers,

Please cite this article in press as: Mussá, T., et al., Swine, human or avian influenza viruses differentially activates porcine dendritic cells cytokine profile. Vet. Immunol. Immunopathol. (2013), http://dx.doi.org/10.1016/j.vetimm.2013.04.004

VETIMM-9026; No. of Pages 11

ARTICLE IN PRESS

4

T. Mussá et al. / Veterinary Immunology and Immunopathology xxx (2013) xxx–xxx

G Model

Table 1 Primers sequences used in this study. Gene

Forward primer (5 to 3 )

Reverse primer (5 to 3 )

Ensembl ID or accession n◦

Amplicon size (pb)

RPL19 ␤2M NF-␬B TGF-␤ IL-10 IFN-␤

AACTCCCGTCAGCAGATCC ACCTTCTGGTCCACACTGAGTTC CTGGCAGCTCTCCTCAAAGC GCTTCAGCTCCACGGAGAAG AGGATATCAAGGAGCACGTGAAC TCCAGCAGATCTTCGGCATT

AGTACCCTTCCGCTTACCG GGTCTCGATCCCACTTAACTATCTTG CACGAGTCATCCAGGTCATACAG TGGTAGCCCTTGGGTTCATG CACAGGGCAGAAATTGATGACA CCAGGATTGTCTCCAGGTCATC

AF435591 ENSSSCG00000004682 ENSSSCG00000009168 ENSSSCG00000003017 ENSSSCG00000015652 GQ415073

147 108 80 99 89 120

a gate strategy was applied in 80% of living cells using the forward and side scatter (FS/SS) characteristics. 2.5. RNA extraction, DNAse treatment and reverse transcription (RT) Approximately 106 infected/treated cells were harvested with 1 ml of Trizol reagent. Then, samples were frozen at −80 ◦ C before RNA extraction. Total RNA from mock or infected poBMDCs was extracted using the RiboPureTM kit (Ambion-Life Technologies, CA, USA) following the manufacturer’s instruction. For IFN-ˇ gene analysis, contaminating DNA was removed from the RNA preparations using a Turbo DNA-FreeTM kit (Ambion-Life Technologies, CA, USA). After that, the isolated RNA was reverse transcribed into cDNA using the High Capacity cDNA Reverse Transcription kit (Applied BiosystemsLife Technologies, CA, USA) following the manufacturer’s instructions. Negative RT control was performed using sterile water instead of MultiScribe® Reverse Transcriptase. 2.6. Quantitative real time PCR (qPCR) A qPCR assay using SYBR Green chemistry (Life Technology, Carlsbad, CA, USA) and the 2−CT method (Livak and Schmittgen, 2001) was performed in an ABI PRISM 7900HT Sequence Detection System (Applied Biosystems). Primers for amplification of NF-B, TGF-ˇ, IL-10 and IFN-ˇ mRNA were designed using the Primer Express 2.0 software (Applied Biosystems) and are shown in Table 1. Two genes, ˇ2M and RPL19, previously validated as stable expressed control genes were used as endogenous controls (Corominas et al., unpublished data; Facci et al., 2011). In order to validate our designs to use the 2−CT method, standard curve for all the genes were generated using cDNA extracted from poBMDCs stimulated with Poly:IC for 8 h and 16 h. Then, the log input amount of cDNA (dilutions of 1:20, 1:200, 1:2000, 1:20,000) was plotted versus the CT, obtaining absolutes slopes