Species recognition in New Zealand Porphyra using 18S rDNA sequencing

Journal of Applied Phycology 11: 421–428, 1999. © 2000 Kluwer Academic Publishers. Printed in the Netherlands.

421

Species recognition in New Zealand Porphyra using 18S rDNA sequencing J.E. Broom1,∗ , W.A. Jones1 , D.F. Hill1 , G.A. Knight2 & W.A. Nelson2 1 Department 2 Museum

of Biochemistry, University of Otago, PO Box 56, Dunedin, New Zealand of New Zealand Te Papa Tongarewa, PO Box 467, Wellington, New Zealand

(∗ Author for correspondence; e-mail: [email protected]) Received 8 June 1999; in revised form 12 June 1999; accepted 12 June 1999

Key words: SSU, small-subunit rDNA, 18S rDNA, phylogenetics, Bangiales, Bangiophycidae, Porphyra, species identification Abstract The long geographic isolation of New Zealand, an archipelago with a large latitudinal range (29◦ to 54◦ S) and an extensive coastline, has resulted in a high level of endemism in both land and coastal marine flora. The genus Porphyra in NZ is represented by 5 epiphytic species and a number of epilithic species, many of which are undescribed. Systematic studies aimed at understanding variation in morphology and life history are underway, and have led to the description of a number of new species. The present study uses sequence data from the 18S rDNA locus to investigate genetic variation in New Zealand Porphyra. Sequences have been fully determined for 10 epilithic species. A subset of these data has been shown to be sufficient to distinguish established taxa and to identify new entities. Our data indicate that New Zealand harbours at least 12 epilithic species of Porphyra, establishing the NZ coastline as a repository of diversity for this genus. Phylogenetic trees based on complete 18S rDNA sequence data show a deep division in the genus that is not obviously correlated with existing morphological characters, and indicate that representatives of the New Zealand flora have undergone long reproductive isolation.

Introduction Recent studies of the genus Porphyra in New Zealand have revealed the presence of a number of undescribed species (Brostoff & Gordon, 1997; Nelson & Broom, 1997; Broom & Nelson, 1998). At present, only two names are used for epilithic species around mainland New Zealand: P. columbina Mont. and P. lilliputiana W.A. Nelson, G.A. Knight et M.W. Hawkes (Adams, 1994; Nelson et al., 1998), a situation that does not reflect the very significant species diversity we have discovered in this region. In addition to studying morphology, life history and polysaccharide chemistry of Porphyra in New Zealand, our systematics programme is also investigating the use of molecular data, in particular sequence data from the 18S rDNA locus for species recognition in New Zealand Porphyra. The 18S rDNA locus is among the slowestevolving sequences in living organisms (Hillis &

Dixon, 1991), and has been used to investigate very ancient evolutionary events (Van de Peer & De Wachter, 1997). However, within the locus there are regions that are substantially more variable than the most conserved domains (Hillis & Dixon, 1991). In studies of Florideophytes, the 18S rDNA locus has proved useful in intra-ordinal comparisons, but generally has been found to be too conservative to provide phylogenetic information at an interspecies level (Ragan et al., 1994; Bailey & Freshwater, 1997). In contrast, a substantial amount of variation occurs within Porphyra at the 18S rDNA locus, reflecting the long reproductive isolation of species within this ancient genus (Stiller & Waaland, 1993; Ragan et al., 1994; Oliveira et al., 1995). At the 30 end of the 18S rDNA gene is a relatively variable region flanked by conserved sites. All existing 18S rDNA sequences in GenBank derived from different species of Porphyra have non-identical

422 sequences over this region. In this study, we have evaluated the use of this part of the 18S rDNA gene for the identification of Porphyra species in New Zealand. We have also used more complete 18S rDNA sequences to examine the phylogenetic relationships between New Zealand species and those from other geographic regions.

Materials and methods Sample collection Forty nine samples of Porphyra were collected from locations around New Zealand. The samples were classified initially into 8 ‘morphological groups’ on the basis of morphology and life history, corresponding to the recently described species Porphyra lilliputiana and 7 morphotypes (BRU107, PAP52, RAK49, ROS54, LGD18, SSR53 and GRB108). Collection information and GenBank accession numbers for the 18S rDNA sequences for each sample included in this study are listed in Table 1. DNA extraction DNA was extracted according to Goff and Moon (1993), or as in Hong et al. (1995) with the following modifications: 10 mg dried tissue were added to 500 µL of extraction buffer with 25 µL βmercaptoethanol. The final extract was resuspended in 30 µL TE, and a 1:10 dilution used for PCR amplification. PCR amplification and sequencing Primers for amplification and sequencing are as in Saunders and Kraft (1994) with two exceptions: primer G13 was replaced by primer J05 (acaaagggcagggacgtattc), and primer G07 was replaced by primer J04 (aaaccttgttacgacttctcc). Amplifications were performed in a Stratagene Robocyler (Stratagene Corporation, La Jolla, CA) as follows: 30 s at 96 ◦ C; 30 cycles of 30 s at 94 ◦ C, 1 min at 50 ◦ C, 2 min at 72 ◦ C; followed by final extension for 10 min at 72 ◦ C. We designate the PCR amplification product obtained using primers G06 and J04 (approximately 550 bp) the ‘Xs PCR product’ for ease of reference. For amplification of the 18S rDNA locus between primers G01 and J04 (approximately 1740 bp), two amplifications were usually performed with primer pairs G01/G14 and G02/J04, giving two overlapping products. When

the yield of one of these products was insufficient, other primer pairs were used as necessary. Sizes and yields of PCR products were assessed by electrophoresis through a 1% agarose gel. Reaction products were sequenced directly after purification by either PEG precipitation (Hillis et al., 1996), by using the QIAquick PCR Purification Kit (QIAGEN Pty Ltd, Clifton Hill, Victoria, Australia) or by isolation through agarose and extraction using the QIAquick Gel Extraction Kit (QIAGEN). Products were sequenced on an ABI 377 automatic sequencer (Perkin Elmer Applied Biosystems Foster City, CA) according to standard methods. Sequence identification and alignment Sequences were compared with existing sequences in GenBank using BLAST (Altschul et al., 1990). In addition, sequences obtained from amplification products of primers G06 and J04 (Xs PCR products) were compared with sequences in a local database of New Zealand Porphyra sequences using the GCG software package (Genetics Computer Group, 1994). Approximately 1740 bp of the 18S rDNA locus (between primers G01 and J04) were amplified and sequenced from entities that had novel Xs sequences. Sequences were aligned interactively using HOMED (Stockwell & Petersen, 1987) after initial comparison with alignments obtained from the SSU rRNA Database (Van de Peer et al., 1999). 18S rDNA sequence data from 28 Bangiales species and 3 Compsopogonales species were obtained from GenBank and were also included in the alignment. Regions of the dataset that could not be unambiguously aligned were excluded from further analysis, yielding a final matrix of 1479bp of unambiguously aligned 18S rDNA sequence data from 41 entities. In the final matrix, the 18S rDNA sequence of P. tenera (GenBank accession number AB013175, collected Shinwa Kumamoto, Japan) was identical to that of P. yezoensis, and was excluded from the analysis. Pairwise similarity values were calculated using HOMED. Phylogenetic inference Phylogenetic trees were inferred by both maximum parsimony and maximum likelihood methods, using PAUP 3.1.1 (Swofford, 1993) and PUZZLE 4.0 (Strimmer & von Haeseler, 1997). The three Compsopogonales sequences were used as an outgroup to the Porphyra and Bangia sequences (Holton et al., 1998).

423 Table 1. Collection locations, references and GenBank accession numbers relating to sequences used in this study Sequences from GenBank

GenBank Location Accession No.

Erythrocladia sp. Erythrotrichia carnea Boldia erythrosiphon Bangia atropurpurea Bangia, Alaska Bangia, California Bangia, Great Lakes and Europe

L26188 L26189 AF055299 L36066 AF043355 AF043356 AF043365

Bangia, New Hampshire AF043353 Bangia, Newfoundland AF043357 Bangia, Northern British ColumbiaAF043360 Bangia, North Carolina AF043363 Bangia, Oregon AF043358 Bangia, Rhode Island AF043354 Bangia, Texas AF043361 Bangia, Victoria, British Columbia AF043359 Bangia, Virgin Islands AF043364 Bangia, Massachusetts AF043362 Porphyra acanthophora L26197 P. amplissima L36048 P. dentata AB013183 P. haitenensis AB013181 P. katadae AB013184 P. leucosticta L26199 P. pseudolinearis AB013185 P. purpurea L26201 P. miniata L26200 P. spiralis L26177 P. suborbiculata AB013180 P. umbilicalis AB013179 P. yezoensis AB013177 Porphyra sp. AB013182

Latitude & Longitude

– – – – Hiwassee River, Tennessee, USA – Sandy Cove, Halifax County, N.S., Canada – Alaska, Greenland and Nunavut, Canada – California, USA – Lakes Ontario, Erie, Huron, Michigan, – Simcoe; St. Lawrence R.; Italy, Ireland, England (Thames) New Hampshire, USA – Newfoundland, Canada – Northern British Columbia, Canada – North Carolina, USA – Oregon, USA – Rhode Island, USA – Texas, USA – Victoria, British Columbia, Canada – Virgin Islands – Massachusetts, USA – Ubatuba, São Paulo, Brazil – Sandy Cove, Digby County, N.S., Canada – Koga Fukuoka, Japan – Yuge Ehime, Japan – Kawatana Yamaguchi, Japan – Gulliver’s Cove, Digby County, N.S., Canada– Tohaku Tottori, Japan – Avonport, Kings County, N.S., Canada – Sandy Cove, Halifax County, N.S., Canada – Ilha do Cardoso, São Paulo, Brazil – Kawatana Yamaguchi, Japan – Nahant, Mass, USA – Hakodate Hokkaido, Japan – Shimonoseki Yamaguchi, Japan –

Reference

Ragan et al. (1994) Ragan et al. (1994) Holton et al. (1998) Oliveira et al. (1995) Müller et al. (1998) Müller et al. (1998) Müller et al. (1998)

Müller et al. (1998) Müller et al. (1998) Müller et al. (1998) Müller et al. (1998) Müller et al. (1998) Müller et al. (1998) Müller et al. (1998) Müller et al. (1998) Müller et al. (1998) Ragan et al. (1994) Ragan et al. (1994) Oliveira et al. (1995) Kunimoto et al. (1998) Kunimoto et al. (1998) Kunimoto et al. (1998) Ragan et al. (1994) Kunimoto et al. (1998) Ragan et al. (1994) Ragan et al. (1994) Kunimoto et al. (1998) Kunimoto et al. (1998) Kunimoto et al. (1998) Kunimoto et al. (1998) Kunimoto et al. (1998)

18S rDNA sequnces, New Zealand samples BRU107.JB01 AF136418/ AF136419 GRB108.JB10 AF136420 LGD18. PLyLGD AF136421 LGD30.PLyBGD AF136422 PAP52.PLPap AF136423 P. lilliputiana AF136424 RAK49.Prakiura AF136425 ROS54.ProsOV AF136426 SSR53.PSSROV AF136427 SSR 91.PSSRBr AF136428

Bruce’s Rock, Otago, NZ

45◦ 590 S, 170◦ 170 E

Southern Cape Wanbrow, Otago, NZ Lyall Bay, Wellington, NZ Lyall Bay, Wellington, NZ Leigh, Northland, NZ Frank Kitts Park, Wellington, NZ Ocean View, Kaikoura, NZ Ocean View, Kaikoura, NZ Ocean View, Kaikoura, NZ Brighton, Otago, NZ

45◦ 41◦ 41◦ 36◦ 41◦ 42◦ 42◦ 42◦ 45◦

Xs sequences, New Zealand samples BRU107.PBUHB AF136429 BRU107.PSols AF136429 BRU107.PBrOh AF136429

Houghton Bay, Wellington, NZ Solander Island, NZ Ohau Point, Kaikoura, NZ

41◦ 210 S, 174◦ 470 E 46◦ 340 S, 166◦ 520 E 42◦ 150 S, 173◦ 500 E

080 S, 171◦ 210 S, 174◦ 210 S, 174◦ 170 S, 174◦ 210 S, 174◦ 310 S, 173◦ 310 S, 173◦ 310 S, 173◦ 570 S, 170◦

580 E 480 E 480 E 480 E 470 E 300 E 300 E 300 E 200 E

424 Table 1. Continued. Sequences from GenBank

GenBank Accession No.

Location

Latitude & Longitude

BRU107.PGCuOV GRB108.PRSK GRB108.JB10 GRB108.PHGTH GRB108.PLREC LGD18.PLGDSC LGD18.PLyBGD/D LGD18.POVLGD/ii LGD18.PPUROS LGD18.PHendersonPt LGD18.P18v LGD30.PPLR LGD30.PIsBLGD PAP52.PPapAT PAP52.PPapMar PAP52.PAhP PAP52.PPapKW PAP52.PGHCh P. lilliputiana P. lilliputiana RAK49.PrakPH RAK49.PSBR RAK49.POyBNM RAK49.PSeColR RAK49.PSeColGR1 ROS54.JB05 ROS54.PAGR ROS54.PAhRos ROS54.PRosOwB ROS54.povros SSR53.PWhBe SSR53.Prrfr SSR53.PorHasBa SSR53.POVSSR SSR91.PSeBaCodRib SSR91.PSeBaCodRibB2

AF136429 AF136430 AF136430 AF136431 AF136431 AF136434 AF136434 AF136434 AF136433 AF136433 AF136434 AF136432 AF136432 AF136435 AF136435 AF136435 AF136435 AF136435 AF136436 AF136436 AF136437 AF136437 AF136437 AF136437 AF136437 AF136438 AF136438 AF136438 AF136438 AF136438 AF136439 AF136439 AF136439 AF136439 AF136440 AF136440

Ocean View, Kaikoura, NZ Kiritehere, North Taranaki, NZ Southern Cape Wanbrow, Otago, NZ Te Henga, Auckland, NZ East Cape, Te Wharenao no Pt, NZ Seal colony, Kaikoura, NZ Lyall Bay, Wellington, NZ Ocean View, Kaikoura, NZ Puheke, Northland, NZ Henderson Point, Northland, NZ Lyall Bay, Wellington, NZ Puheke, Northland, NZ Island Bay, Wellington, NZ Ataata Point, Tasman Bay, NZ Maraetai, Bay of Plenty, NZ Ahipara, Northland, NZ Kuaotunu, Coromandel, NZ Joyce Bay, Buller, NZ Maketu, Okurei Point, Bay of Plenty, NZ Frank Kitts Park, Wellington, NZ Palmer Head, Wellington, NZ Scorching Bay, Wellington, NZ Oyster Bay, Marlborough, NZ Seal Colony, Kaikoura, NZ Seal Colony, Kaikoura, NZ Bruce’s Rock, Otago, NZ Ahipara, Northland, NZ Ahipara, Northland, NZ Owhiro Bay, Wellington, NZ Ocean View, Kaikoura, NZ Wharariki Beach, Northwest Nelson, NZ Ringaringa, Stewart Is., NZ Haskell Bay, Auckland Is., NZ Ocean View, Kaikoura, NZ Sealer’s Bay, Codfish Is., NZ Sealer’s Bay, Codfish Is., NZ

42◦ 38◦ 45◦ 36 ◦ 37◦ 42◦ 41◦ 42◦ 34◦ 34◦ 41◦ 34◦ 41◦ 41◦ 37◦ 35◦ 36◦ 41◦ 37◦ 41◦ 41◦ 41◦ 41◦ 42◦ 42◦ 45◦ 35◦ 35◦ 41◦ 42◦ 40◦ 46◦ 50◦ 42◦ 46◦ 46◦

Maximum parsimony trees were inferred by a heuristic search using the tree-bisection-reconnection algorithm with random sequence addition (100 replicates) and with COLLAPSE and MULPARS options in effect. Gaps were treated as missing data, and all sites were weighted equally. Support for the parsimony tree was assessed by calculating bootstrap proportion values based on 100 resamplings of the dataset (Felsenstein, 1985).

310 S, 173◦ 190 S, 174◦ 080 S, 171◦ 540 S, 174◦ 400 S, 178◦ 250 S, 173◦ 210 S, 174◦ 310 S, 173◦ 520 S, 173◦ 440 S, 173◦ 210 S, 174◦ 520 S, 173◦ 210 S, 174◦ 090 S, 173◦ 440 S, 177◦ 100 S, 173◦ 430 S, 175◦ 540 S, 171◦ 450 S, 176◦ 180 S, 174◦ 210 S, 174◦ 180 S, 174◦ 150 S, 174◦ 250 S, 173◦ 250 S, 173◦ 590 S, 170◦ 100 S, 173◦ 100 S, 173◦ 210 S, 174◦ 310 S, 173◦ 300 S, 172◦ 540 S, 168◦ 360 S, 166◦ 310 S, 173◦ 460 S, 167◦ 460 S, 167◦

Reference 300 E 430 E 580 E 260 E 320 E 190 E 480 E 300 E 190 E 070 E 480 E 190 E 460 E 240 E 410 E 070 E 440 E 260 E 280 E 470 E 490 E 500 E 160 E 190 E 190 E 170 E 070 E 070 E 460 E 300 E 400 E 080 E 140 E 300 E 390 E 390 E

For maximum likelihood analyses performed with PUZZLE, gaps were also treated as missing data. Analyses were performed with 10,000 puzzling steps and random orders of sequence addition. The HKY model of substitution was used in three separate analyses: one with a uniform substitution rate over all sites, one with two rate classes (one invariable rate and one uniform rate) and one with a mixed-model of substitution rates (one invariable rate and an estimated gamma distri-

425 Table 2. Variation within and between New Zealand Porphyra sequence groups over 480 bp at the 30 end of 18S rDNA locus (Xs PCR product). Sequences were aligned, and a 25 bp insertion in the PAP52 sequence was re-coded to 1bp in order to avoid artificially inflating the variation between this sequence and the others. Pairwise% variations were calculated between all sequences. Sequences (n) within each group are identical with the exception of LGD18 and GRB108. Morphological evidence suggests that each of these groups contain two distinct entities Group

n

BRU107 GRB108

5 5

LGD18

LGD30 PAP52 Porphyra lilliputiana RAK49 ROS54 SSR53 SSR91

% Diff. from nearest NZ neighbour group

% Diff. within the group

No. and description of variant sequences

3.8 3.2

0 0.6

7

1.2

0.4

3 6 3 6 6 5 3

3.2 10.5 5.2 2.0 1.2 2.0 3.8

– 2 samples (identical to one another) vary at 3 positions from the original sequence 2 samples (identical to one another) vary at 2 positions from the original sequence – – – – – – –

bution of substitution rates with 8 rate classes). The expected pyrimidine transition/purine transition and transition/transversion ratios were estimated from the data. Results Sequences of the Xs PCR product were compared for each of the 49 New Zealand Porphyra samples. Sequences obtained from samples from different morphological groups were never identical. Moreover, within 5 of the original morphological groups (Porphyra lilliputiana, BRU107, ROS54, RAK49 and PAP52) Xs sequences of all samples were identical (Table 2). There was, then, complete correlation between Xs sequence data and 5 of the original morphological groups. It was immediately obvious that two distinct sequence types were present within both the LGD18 and the SSR53 morphological groups. The new sequence types were designated LGD30 and SSR91 respectively. A more complete 18S rDNA sequence (approximately 1740 bp, between primers G01 and J04) was obtained for all four entities. Raw percentage similarity between LGD18 and LGD30 was 87.7%, and between SSR53 and SSR91 was 96.3%, indicating

0 0 0 0 0 0 0

that neither the LGD pair nor the SSR pair are conspecific. Careful examination of voucher specimens for each pair revealed similar but distinct morphologies corresponding to the two sequence groups in each case. Two further entities have been identified on the basis of Xs variation. Further sequencing of LGD18 samples revealed two samples with a third sequence type, which differs from the original LGD18 Xs sequence by 2bp out of 480bp sequenced (0.4% variation over the Xs region). Within the GRB108 morphological group, two distinct sequences were also observed, differing at 3bp out of approximately 480bp sequenced (0.6% variation over the Xs region, two samples). Determination of more complete 18S rDNA sequences from these two recently identified sequence types is in progress. Phylogenetic analysis of the large 18S rDNA dataset Approximately 1740 bp of sequence data were obtained from representatives of each of the 10 morphological groups. Maximum parsimony analysis of the dataset with PAUP 3.1.1 produced 29 equally parsimonious trees (length = 825 steps, consistency index = 0.584). The bootstrap 50% majority rule consensus tree is shown in Figure 1. Maximum likelihood ana-

426 all other Porphyra sequences for which there is moderate bootstrap support. This group also includes the North Atlantic species P umbilicalis and P. purpurea and a sequence obtained from Bangia samples collected from the Great Lakes and from Europe. Two other Bangia sequences obtained from samples collected in North Carolina and in Massachusetts are also associated with this group at moderate bootstrap support.

Discussion

Figure 1. Bootstrap 50% majority-rule consensus tree resulting from parsimony analysis of 18S rDNA sequence data for 41 Bangiophycidean samples. Bootstrap values of 50% and over are shown for each resolved internode. New Zealand entities are shown in bold.

lyses of the dataset, using PUZZLE, generated trees with essentially the same structure. In this tree, the Porphyra/Bangia clade is separated into three distinct groups, two of which have significant bootstrap support. One clade consists of Bangia samples from North America, which group together with 100% bootstrap support. A second large clade consists of species of Porphyra and Bangia from widely disparate geographical regions. Within this clade, four New Zealand entities – ROS54, LGD18, BRU107 and SSR91 – cluster together to the exclusion of any others. More Southern Hemisphere samples are needed to address the question of whether or not these species represent a true New Zealand radiation, or are a subset of an older, possibly Gondwanan radiation. A further three New Zealand entities (LGD30, GRB108, PAP52) form part of a clade distinct from

In this study we have addressed problems of species recognition and identification of species boundaries using molecular biology techniques in conjunction with morphological studies. This simultaneous application of two approaches has led to a novel means of sample identification using DNA sequencing of a small PCR product. The Xs PCR product amplifies very reliably from simple extracts of Porphyra DNA, and allows us to identify a sample rapidly – usually within one week of receipt of material. It includes a variable region of the 18S rDNA gene, which is non-identical in all species examined so far. Table 3 shows percentage sequence similarity over the Xs region compared with that over 1750bp of 18S rDNA sequence for New Zealand entities and their nearest neighbours (identified by sequence similarity over the Xs region). Data for the full matrix of 41 sequences are available from the authors on request. Differences between similarities over the two regions are small (