Ribosomal RNA Sequences of Enterocytozoon bieneusi, Septata intestinalis and Ameson michaelis: Phylogenetic Construction and Structural Correspondence

J . Euk. Microbial., 41(3). 1994, pp. 204-209 0 1994 by the Society of Protozoologists

Ribosomal RNA Sequences of Enterocytozoon bieneusi, Septata intestinalis and Ameson michaelis: Phylogenetic Construction and Structural Correspondence XIAOLONG ZHU,* MURRAY WITTNER,* HERBERT B. TANOWITZ,*.** A N N CALI*** and LOUIS M. WEISS*.**.’ *Department of Pathology. Division of Parasitology and Tropical Medicine, Albert Einstein College of Medicine, Bronx, New York 10461, **Department of Medicine, Division of Infectious Diseases. Alberi Einstein College of Medicine, Bronx, New York 10461, and ***Departmentof Biological Sciences, Rutgers University, Newark, New Jersey 07102

ABSTRACT. The microsporidian species Enterocytoroon bieneusi, Septata iniesiinalis and Ameson michaelis were compared by using sequence data of their rRNA gene segments, which were amplified by polymerized chain reaction and directly sequenced. The forward primer 530f (5’-GTGCCATCCAGCCGCGG-3’) was in the small subunit rRNA (SSU-rRNA) and the reverse primer 580r (5‘GGTCCGTGTTTCAAGACGG-3’) was in the large subunit rRNA (LSU-rRNA).We have utilized these sequence data, the published data on Encephalitozoon cuniculi and Encephalitozoon hellem and our cloned SSU-rRNA genes from E. bieneusi and S. intestinalis to develop a phylogenetic tree for the microsporidia involved in human infection. The higher sequence similarities demonstrated between S. irztesrrrzalrs and E. cuniculi support the placement of S. intesrinalis in the family Encephalitozoonidae. This method of polymerized chain reaction rRNA phylogeny allows the establishment of phylogenetic relationships on limiting material where culture and electron microscopy are difficult or impossible and can be applied to archival material to expand the molecular phylogenetic analysis of the phylum Microspora. In addition, the highly variable region (E.coli numbering 590-650) and intergenic spacer regions in the microsporidia were noted to have structural correspondence,suggesting the possibility that they are coevolving. Supplementary key words. Microsporidia. phylogeny.

M

ICROSPORIDIA are obligate intracellular. spore-forming parasites found in many vertebrates and invertebrates and are sufficiently unique to be classified in a separate phylum, the Microspora [ 11. Within the phylum, there are dozens of genera and hundreds of species. All the microsporidia contain an extrusion apparatus with a polar tube that coils around the sporoplasm. This tube serves as a unique vehicle for transmission of infection in that the polar tube can pierce an adjacent cell, inoculating the sporoplasm directly into that cell. Currently, the classification of microsporidia is based upon spore morphology and developmental life cycle as demonstrated by electron microscopy [2, 171. Vossbrinck has recently described a phylogenetic construction of several microsporidia based on ribosomal RNA sequence analysis [ 121. We have sought to expand this approach to include Enterocytozoon bieneusi and Septata intestinalis, the microspondia that account for most of the described human infections [ 171. Both of these microsporidia arc non-cultivatable; however, the SSU-rRNA were cloned from infected human tissue using phylogenetically conserved rRNA primers [ 18-2 11. Because these organisms have only been found in humans, the determination of their phylogenetic relationships may be of importance in suggesting the reservoir hosts for these opportunistic pathogens [ 121. In addition, our analysis confirms that S. intestinalis and E. hellem are distinct organisms [ 2 I]. Five microsporidian genera have been implicated in human infection: Encephalitozoon, Enferocytozoon. Septuta, Nosema, and Pleistophora [ 171. A sixth genus, Microsporidium, has been used to designate microsporidia of uncertain taxonomic status. These organisms appear to be important opportunistic pathogens in patients with human immunodeficiency virus type 1 infection (HIV-I or AIDS). Nosema is found mainly in insects, Encephalitozoon in a wide variety of mammals, and Pleistophora in fish and insects. Enterocyto:oon has only been described in AIDS patients and salmon and Septata has only been found in AIDS patients [ 171. Enterocvtozoon hieneusi was first described in 1985, in an AIDS patient with intestinal malabsorption and diarrhea, and

thus far has been described only in humans [ 5 , 91. Based on its morphologic characteristics, it was placed in a new family, Enterocytozoonidae [2]. Recently the SSU-rRNA of E . bieneusi has been sequenced and a polymerized chain reaction (PCR) developed for the diagnosis of human infection [17]. Septata infesfinaliswas recently reported to cause enteric infection in AIDS patients [3]. Although it is found in enterocytes it also infects cells of the lamina propria. Its unique morphology justified the establishment of a new genus and species for this organism [3]. On morphologic analysis S. intestinalis was most closely aligned with the family Encephalitozoonidae, which contains only the genus Encephalitozoon; therefore it has been placed in this family [3]. Recent studies on SSU-rRNA have shown that S. intestinalis and Encephalitozoon cuniculi are closely related [21]. Recently, Vossbrinck has reported on a highly conserved eukaryotic primer (580r) in the large rRNA subunit which is useful for direct dideoxy sequencing as well as the use of this primer along with conserved primers in the SSU-rRNA gene (530f and 2280 to amplify a segment of rRNA containing SSU-rRNA, intergenic spacer (IGS) and LSU-rRNA [ 12, 14, 151. This technique was employed to obtain sequence data on the cultivatable microsporidia E. cuniculi and E. hellem [ 121. Sequence comparison supported the morphologic classification that they are different species of the same genus [ 121. In the present study we have cloned and sequenced the SSUrRNA, IGS and LSU-rRNA fragments of the non-cultivatable microsporidia E. bieneusi, S. intestinalis and Ameson michaelis. We have utilized this sequence data together with the published data on E. cunicirli and E. hellem [ 121 and our cloned SSUrRNA genes from E. bieneusi and S. intestinalis to develop a phylogenetic tree for the microsporidia involved in human infection. This method allows the establishment of phylogenetic relationships on limited material where culture and electron microscopy are difficult ifnot impossible [ 121. This method also can be applied to archival material to expand the molecular phylogenetic analysis of the phylum Microspora.

To whom correspondence should be addressed: Alben Einstein College of Medicine, 1300 Moms Park Avenue, Room 504 Forchheimer, Bronx, New York, 1046 I .

MATERIALS AND METHODS Microsporidian DNA isolation. Enterocytozoon bieneusi and S. intestinalis DNA was extracted from intestinal biopsies of

I

204

205

ZHU ET AL.-PHYLOGENETICS OF HUMAN MICROSPORIDIA

Table 1. Percent sequence difference among the eight species of microsporidia in Fig. 1. Sequences are compared for each region (530f, 228r and 580r) separately and for all three regions combined.

1. V. necatrix

2. 3. 4. 5. 6. 7. 8. 1. 2. 3. 4.

5. 6. 7. 8. 1. 2. 3. 4.

5. 6. 7. 8.

V. lvmantriae

2

3

4

-

0.030

0.362 0.369

530f 0.24 1 0.251 0.394

-

E. bieneusi S. intestinalis E. cuniculi E. hellem A. michaelis I. giganteum V necatrix V. l.vrnantriae

-

0.066

-

E. bieneusi S. intestinalis E. cuniculi E. hellem A. michaelis I. giganteum V. necatrix V. lymantriae

0.09 1 -

0.559 0.535

-

0.361 0.363

E. bieneusi S. intestinalis E. cuniculi E. hellem A. michaelis I. giganteum

1. V. necatrix 2. V. lymantriae

3. 4. 5. 6. 7. 8.

1

E. bieneusi S. intestinalis E. cuniculi E. hellem A. michaelis I. giganteurn

228r 0.361 0.346 0.489

-

580r 0.536 0.530 0.494

-

0.06 1

-

0.428 0.42 1 -

All regions 0.385 0.381 0.457

HIV- 1 positive patients with diarrhea and transmission electron microscopic proven microsporidian infection as previously published [ 171. Spores ofA. michaelis (previously Nosema michaelis [ 11) obtained from the muscle ofblue crabs (Callinectes sapidus) [ 1, 201 were suspended in 0.05 M Hepes (4-(2-hydroxyethyl)1-piperazineethanesulfonicacid) pH 7.0, 0.1 mM CaCI,, 1 Yo Mucin for 1 h. Spores were then centrifuged for 5 min at 100 g and germinated in 0.1 M Hepes pH 9.5, 0.001% H,O, for 10 min, centrifuged at 1,000 g for 5 min and DNA extracted from the supernatant containing sporoplasm. Encephalitozoon cuniculi was maintained in culture and DNA purified from spores disrupted by glass beads in a Mini-Beadbeater (Biospec Products Inc., Bartlesville, OK) as previously described [ 12, 191. Gene amplification. Primers were selected to amplify a region of rRNA containing known conserved and variable regions on the large and SSU-rRNA genes and the intergenic spacer region as described by Vossbrinck [ 121. The forward primer 530f (5'GTGCCATCCAGCCGCGG-3') is in the SSU-rRNA and the reverse primer 580r (5'-GGTCCGTGTTTCAAGACGG-3') is in the LSU-rRNA. As previously demonstrated these primers amplify a DNA segment of about 1,350 bp in E. cuniculi and E. hellem. The PCR reaction was camed out using a standard PCR buffer and conditions (Perkin Elmer Cetus, Norwalk, CT) as previously published [ 17-2 11 using 100 pm of each primer and 0.1-1 .O pg

-

5

6

I

8

0.257 0.265 0.392 0.145 -

0.268 0.275 0.40 1 0.212 0,125

0.365 0.37 1 0.500 0.466 0.448 0.449 -

0.334 0.352 0.469 0.375 0.36 1 0.386 0.450 -

0.363 0.351 0.490 0.140 -

0.358 0.346 0.469 0.175 0.161

0.472 0.467 0.561 0.479 0.45 1 0.47 I -

0.385 0.376 0.581 0.4 12 0.379 0.439 0.459 -

0.369 0.398 0.426 0.415

0.353 0.383 0.430 0.400 0.275

0.401 0.407 0.427 0.535 0.448 0.445 -

0.395 0.403 0.445 0.48 1 0.368 0.3 12 0.432 -

0.332 0.335 0.422 0.264 0.167 -

0.4 17 0.420 0.503 0.501 0.447 0.453 -

0.369 0.371 0.495 0.420 0.362 0.381 0.452 -

-

0.338 0.336 0.432 0.219 -

-

-

-

of sample DNA. Reactions were run in a Barnsted-Thermolyne thermocycler for 35 cycles of 94" C for 1 min, 42" C for 2 min, 72" C for 3 min followed by a 10-min 72" C extension. The primer set generated a fragment of about 1,350 bp for S . intestinalis, E. cuniculi, and A . michaelis and about 1,550 bp for E. bieneusi. The amplification products were purified using Magic PCR Preps@ (Promega, Madison, WI) [ 121. If the PCR products had more than one band evident on gel electrophoresis, as was the case for S. intestinalis and E . bieneusi. then the desired bands were excised under a UV lamp from ethidium bromide stained low melting point agarose gels after electrophoresis prior to Magic PCR Preps@ (Promega). Sequencing. Direct sequencing of a purified fragment was accomplished by using the AmpliTaq cycle sequencing kit (Perkin Elmer Cetus) [ 18-2 11 using the primers 530f, 580r and 228r (5'-GTTAGTTTCTTTTCCTCC-3').Sequences obtained using primer 228r overlapped with the sequences on the 3'-end SSUrRNA. In addition, primer EB2S (5'-ATCCAACCATCACGTACC-3') was used to further sequence the E . bieneusi spacer region. Sequence of the SSU-rRNA segments was compared with full-length sequences we had obtained from previously cloning these genes [ 17-2 11. Sequence accession numbers are: A . michaelis SSU-rRNA L1574 1, IGSILSU-rRNA L20293: E. bieneusi SSU-rRNA LO7 123, IGSILSU-rRNA L20290; S. intestinalis SSU-rRNA L19567, IGS/LSU-rRNA L20292; E. cu-

206

J. EUK. MICROBIOL., VOL. 41. NO. 3. MAY-JUNE

1994

228r region

V. V. b. S. F. p.

necatrix lvmantriae bieneusi intestinalis cuniculi hellem Ji.michaelis I. aisanteum

V. V.

F. S.

E. E. A. I.

ATCTTTATGGGATAATATTTGTAAGAGATATTTGGAACTTGGAATTGCTAGT~TTTTATT~TAAGTAGAATTG

.............................................................................. ..... ..... ...

.GA.GAG.A....CTACG.......ATACGTAG.-...TA......C...,...CGG.GCC.C.TC...GCATTG.. GAC.G.GA G.AGC.G TG.GCT.C-.. G.......C...... .TAACAT.G..CC....T.TT... C.-G.G.G.....G.AGC.G.....-G.GCT.C-.....G.......C.......TAGCGGC.G.CG...CT.CT... C.-G.G....T..CTACG.......TTACGTAG-....TA......C.......GAA.G...G..C....TATT... AGA G..AT.G.GGGC.-.A...C.-CTCA-.-. AC.....A........CG.CAG..C....TACG.CGA.. GAG A..G.-GC....G.....GC.CAG.....G...............TCGCGGAC.C.....AC.CGA..

.. .. .. ... .-.. AATGTGTCCCTGTTCTTTGTACACACCGCCCGTCGCTATCT~GATGAATATGTGTTGTG~TTAGTG~CTACT necatrix .................................................... A . . . . . . . . . . . . . . . . . . . . . . . . . lvmantriae .................................. A.. ..T. C.....GTC..A..GA-....GAGCT.-CG---GCTC bieneusi ................................. .CGCA...GAAC...GA.TGG-..---GGTC intestinalis ....G........C .............C..................................CGCAC..GAAC...GA.CCG...---GGTC

cuniculi hellem michaelis sisanteum

.............C...................................CGCAG..GAAC...GA.TTGAG.---GGTC ...A........ .......................T.... G......G-AG..AT..T...GTCA.T.AT.,--.TGG ...A C . . . . . . . ....................... T..N.G....C.G.GC.T-GGC.C..GCA..-.TG...A.CAC

V. necatrix TGAACAATATGTATTAGATCTGATATAAGTCGT~CATGGTTGCT-GTTGGAGAACCATTAGCAGGATCAT~taagt T...........................tq aat V. lvmantriae E. bieneusi G T.TC------- TATGGCT.G AGTAC-- A....C.AG...CC..TGAG.CC...T.A.GACATTt-cag GTCC.TC G......A....................C....-............GC..........GT.t-ttg S. intestinalis E. cuniculi GTCC.GA G......A...................C....-............GC..........GT.tgttg E. hellem GTCT.TC G......A...................C....-............GC..........GT.tgttg A. michaelis C...TG.GT.A.TC..A.A.C.G..C...........A..C.A.G-....A....T..GC..T.....T.GCGtgttt G.G.GCGCAAG ...CCG A....C.......A...A.....A........TG...T........-A.cagat I. sisanteum

............................................. ... .... .. ... .. ... .. ... .. ... ....

V. necatrix V. lvmantriae E. bieneusi S. intestinalis E. cuniculi E. hellem A . michaelis I. sisanteum Fig. 1. Alignment of eight microsporidia rRNA sequences in region 228r including the 3‘ end of the small subunit rRNA, 5’ end of the large subunit rRNA and the intergenic spacer region (identified by lower case). Numbering is based on the published E. coli sequence alignment with I.’ necafriv [ 161. Alignments of regions 530r and 580f are not shown.

niculi SSU-rRNA ZI 9563. The sequences of Vairimorpha necatris, Vairirnorpha Iymantriae, E . hellem, E. cuniculi IGS/ LSU-rRNA, and Ichthyosporidiitm giganteurn are from Vossbrinck et al. [ 121. Phylogenetic analysis. Using the alignments given in Fig. I , maximum parsimony analysis was run on each region separately and all regions combined on a Macintosh I1 computer using PAUP version 3.1.1 [ 1 I]. The branch and bound option was used to find the shortest tree. Alignments were done by hand utilizing published alignments [ 12, 18-2 11 and the computer programs Wordsearch and Segment (GCG. Madison, WI). RESULTS Figure 1 shows the alignment of eight-microsporidian species rRNA sequences on the amplified region containing SSU-rRNA, IGS and LSU-rRNA (228r region). The sequences ofE. cuniculi, E. hellem. V. lymantriae, I. giganteum and V. necatrix are as previously published [6, 12, 16, 191. The complete SSU-rRNA sequences of E. hieneusi [ 181, S. intestinalis [2 1) and A. michaelis [20] are published. Sequencing of the amplified segments was done using the 580r and 228r primers. Primer 228r reads LSUrRNA, through the IGS region and into 3‘-end SSU-rRNA. Therefore, the sequences obtained by primer 228r overlap with those by 580r and 1492. Because of the longer length of the

spacer region of E. hieneusi (232 bp), primer EB2S was designed to allow overlap with the 3’-end sequence. The highly variable, moderately variable and highly conserved regions seen in E. cuniculi, E. hellem. V. lymantriae, I . giganteum and V. necatrix were also observed in E. bieneusi, S. intestinalis and A. michaelis. Thus, the sequences on these three regions are appropriate for comparison with other species. Table 1 shows the percent sequence differences among the eight species sequenced for all these regions separately and combined according to the Macintosh PAUP version 3.1.1 data distance program. In the 228r region the distance between S. intestinalis and E. cuniculi is smaller (0.140) than that (0.161) between E. cuniculi and E. hellem, in 530f, 580r and in all regions combined, E. cuniculi and E. hellem revealed the smallest distance (0.167 for all regions combined) suggesting that E. cuniculi and E. hellem belong to the same genus and that S. intestinalis belongs to the Encephalitozoonidae family and likely is a separate genus as classified by morphology. Much larger differences exist between the other microsporidia, thereby supporting their classification into different families. For example, in examining all the regions combined the distances are 0.41 7 between V. necatrixand A. michaelis, 0.385 between E. bieneusi and V. necatrix, 0.457 between S. intestinalis and E. bieneusi. Vairimorpha necatrix and E. cuniculi/E. hellem showed a distance of 0.338/0.332. These distances differ from those reported

207

ZHU ET AL.-PHYLOGENETICS OF HUMAN MICROSPORIDIA

necatrix lvmantriae bieneusi intestinalis cuniculi hellem A . michaelis I. qiqanteum

ACACATGGGATCAATAGGATACCATAACGATG-AAGGTCGTAATAGAATA-CGA----AAGTATATTATTT-ACC-TA NN.---. G..........G. GT-GCCCATCAAG.GGT.TATTTGG..AT.CCC..-.A..GGCACTTGG.-..CGCGATGCG.GCGCG~G.A..CG .TT..C.....TG.....CATTAGC.G...G.-....A...GTAG..GG.-...TATGC-C.T.T.----G GGAAG GTT..C.....TG..T. .CATTAGCGG.... A...GCAG..GG.--..TATGC-..TGT.GT.G.G..GG.G .TC........TG..T..CATTATCTG.....-. A...GC.G..GG.-...TATGCC..T.T..T.A-GCGGA.G GTT.----- T..GG.T.AGA.AGGATGG.CAC-....GACC.CA.TTGGT-.TCTTGGG..A.AGGATGGG-.GAG.. C.. -GTG CGCGGGAC..AT G-..CG-.AGCGGA.GC.T.........GGAGC.GC.G...TGA-C..--------

V. necatrix V. lvmantriae E. bieneusi S. intestinalis E. cuniculi E. hellem A. michaelis I. uiaanteum

A-TTAAT-ATAT-T N........N.. .AAAGTCCTCTCT. TC.G...GTAGCGG TC.G...TG.G.GC TC.G...T.GG.G. CCCAC.A-TGGAT. CC.G..AC.GC-GA

V. V. E. S. E. E.

..........................................................

.

.-.... ...

..

--

..

Fig. 1. Continued. by Vossbrinck [ 121perhaps due to slight differences in alignment or to the version of PAUP used. However, it does not affect the subsequent phylogenetic analysis. Figure 2 demonstrates a phylogenetic tree of the eight species examined. Sequence alignments on each region and all regions combined were done by PAUP version 3.1.1 using a branch and bound search. The consensus tree obtained is the same from each individual region separately and all of the regions combined. Septata intestinalis, E. hellem, and E. cuniculi are clustered together on all trees regardless of which microsporidian is defined as an outgroup. This tree is unchanged when using the entire SSU-rRNA gene for the microsporidia, for which these data are available (data not shown). Restriction digestion of the amplified fragments of S. intestinatis, E. bieneusi, A . michaelis and E. cuniculi by EcoRI, HindIII, Hinfl, DraI and Sau3A were conducted (data not shown). The fragments conformed to that predicted by the sequence data. The restriction patterns for these organisms were unique in these regions, allowing discrimination among these species. These studies agree with those of Vossbrinck [ 121 suggesting that as more data on the rRNA of the phylum become available restriction digests of these amplified regions may be useful for the identification of microsporidia [ 121. DISCUSSION Using the highly conserved primer 580r in the LSU-rRNA together with the conserved SSU-rRNA primer 530r we ob-

tained ribosomal sequence data from several non-cultivatable microsporidan organisms. This could be accomplished even in the presence of non-microsporidan DNA such as in human intestinal biopsy specimens. The primer set 530f-580r appears to recognize highly conserved regions in the phylum Microspora and is a useful tool for further phylogenetic analysis. The highly variable, moderately variable and highly conserved regions seen in E. cuniculi, E. hellem and V. necatrix, V. [vrnantriae and I . giganteum are also observed in E. bieneusi, S. intestinalis and A . michaelis. Thus, it appears that the region 530f-580rcontains sufficient information to be useful for studying the molecular phylogeny of the phylum Microspora [ 121. The method is especially useful for the study of phylogenetic relationships when material is limited or where culture is not feasible and sufficient morphologic features may not be present for classification. In addition, this method can be applied to archival material to develop a molecular phylogeny of the Microspora. In most eukaryotes the IGS region is divided by the 5.8s rRNA gene into two sections, the ITS 1 and ITS2 region. There is structural correspondence between ITS2 sequences and varC ious regions within LSU-rRNA genes, i.e. a high ITS2 G content is accompanied by a correspondingly high G + C content in variable regions within LSU-rRNA [4,7]. Microsporidia lack a 5.8s gene and the ITS2 region is fused to the 5’-end of LSU-rRNA gene [ 131. However, microsporidia possess the 590650 region ( E . coli alignment numbering, 16) in their SSUrRNA gene, which is considered to be eukaryotic, where little

+

208

J. EUK. MICROBIOL., VOL. 41, NO. 3, MAY-JUNE 1994

V. necatrix V. lymantriae E. bieneusi S. intestinalis

E. cuniculi E. hellem A.

michaelis

I. gigantem

i

Fig. 2. Unrooted tree based on maximum parsimony analysis (PAUP) of the sequence data from Fig. I and the sequences on 530f and 580r regions.

or no homology exists between eukaryotic and prokaryotic sequences [8, 221. Among the microsporidia the 590-650 region and the IGS region demonstrate the highest divergence amoung the organisms studied. In comparing the variable region (590650) and the IGS region we found a correlation between the base compositions seen in these two regions for the microsporidia we studied. This is summarized in Table 2. For example, S. intestinalis, E. cuniculi and E. hellem have GT-rich variable and IGS regions, and E. bieneusi and A. michaelis have a decrease in C in these regions. This is suggestive of parallel evolution of the variable and IGS regions in these organisms. Torres-Ruiz & Hemleben [ 10) characterized cultivars of Cucurbita pep0 and other Ciicurbita species by restriction fragment length polymorphism (RFLP) by using different fragments of the ribosomal intergenic spacer of Cucurbita pepPo as hybridization probes. Several cultivars could be distinguished by a specific rDNA restriction pattern, whereas some cultivars showed an identical RFLP pattern, suggesting a closer relationship. It is interesting to note that using either the variable or the intergenic spacer regions for PAUP analysis provided consensus phylo-

genetic trees to that from all regions combined (Table 3). Thus it may be possible to use the intergenic spacer region of an unknown microsporidian as a means of phylogenetic classification. Whether the variable and/or intergenic spacer regions are reliable enough to be representative of the entire genome requires more study. If this proves to be the case then phylogenetic analysis could be facilitated, inasmuch as there is a conserved region on the 3’-end of SSU-rRNA that could be used to design the forward primer to use with the reverse primer (228r) for this region. The developmental life cycle of E. bieneusi is unique among the microsporidia [2]. It is noteworthy that E. bieneusi has a much longer spacer sequence (232 bp) than the approximately 40-bp region seen with the other microsporidia studied to date. The E. bieneusi intergenic spacer can be folded into two independent sectors by either FOLD or SQUIGGLES (GCG). This configuration resembles that seen with ITS1 and ITS2 (Zhu et al., unpubl. data).

Table 3. Percent differences of the intergenic spacer region and 590650 variable region among six species of microsporidia. Table 2. Length and base compositionsof variable (590-650) region in SSU rRNA and the intergenic spacer regions of six microsporidia. Species

Region

Length (bp)

k’. necatrix

Variable Spacer Variable Spacer Variable Spacer Variable Spacer Variable Spacer Variable Spacer

2 36 33 232 45 28 52 31 49 46 56 35

E. hieneuri S. rntestinalis

E. cuniculi E. hellern A . rnrchaclis

A

C

0

0

17

1

9 43 8 6 5 2 7 6

4

20 3 0 I 0 2

16

9

11

2

1

G

T

0 2 1 17 8 12 104 65 16 18 10 12 21 25 15 20 13 27 10 29 16 15 9 13

Content

T only ATrich C deficient Cdeficient GT rich GTrich GT rich GT rich GT rich GTrich C deficient C deficient

Species

1. 1.: necatrix 2. E. hieneusr 3. S. rntestrnahs 4. E. cuniculi 5. E. hellem 6. A. michaelis

1

2

3

4

590-650 variable region - 0.000 0.000 0.500 0.781 0.727 - 0.289

-

5

6

0.500 0.742 0.524 0.304

-

0.500 0.727 0.733 0.740 0.7 17

0.636 0.51 1 0.214 0.216 -

0.625 0.641 0.577 0.533 0.543

-

Intergenic spacer region 1. V. necatri.u

2. 3. 4. 5. 6.

E. bieneusi S. intestinalis E. cuniculi E. hellern A. michaelis

-

0.750 -

0.708 0.571

-

0.704 0.444 0.2 17

-

-

ZHU ET AL.-PHYLOGENETICS OF HUMAN MICROSPORIDIA

ACKNOWLEDGMENTS T his work is supported by grants from A M F A R 1680-13R G R a n d NIH A131786. LITERATURE CITED 1. Spraque, V. & Vavra, J. 1977. Systematics of Microsporidia. In: Bulla, L. A. & Cheng, T. C. (ed.), Comparative Pathobiology, Vol. w. Plenum Press, New York. 2. Cali, A. & Owen, R. L. 1990. Intracellular development of Enferocyfozoon,a unique microsporidian found in the intestine of AIDS patients. J. Protozool., 37: 145-155. 3. Cali, A., Kotler, D. P. & Orenstein, J. M. 1993. Septata intestinalis N. G., N. Sp., an intestinal microsporidian associated with chronic diarrhea and dissemination in AIDS patients. J. Euk. Microbiol., 40: 101-1 12. 4. Dorfman, D. M., Lenardo, M. J., Reddy, L. V., Van der Ploeg, L. H. T. & Donelson, J. E. 1985. The 5.8s ribosomal gene of Trypanosoma brucei: structure and transcriptional studies. Nucl. Acids Res., 13: 3533-3549. 5. Desportes, L., Le Charpentier, Y., Galian, Y., Bernard, A., Cochand-Priollet, B., Lavergne, A., Ravisse, P. & Modigliani, R. 1985. Occurrence of a new microsporidian: Enterocytozoon bieneusi n. g., n. sp. in the enterocytes of human patient with AIDS. J. Protozool., 32: 250-2 54. 6. Hartakeerl, R. A,, Schuitema, A. R. & dewachter, R. 1993. Secondary structure of the small subunit ribosomal RNA sequence of the microsporidium Encephalitozoon cuniculi. Nucl. Acids Rex, 21: 1489. 7. Gray, M. W. & Schnare, M. N. 1990. Evolution of the modular structure of rRNA. In: Hill, W. E., Dahlberg, A., Garrett, R. A,, Moore, P. B., Schlessinger, D. & Warner, J. R. (ed.), The Ribosome: Structure, Function, and Evolution. American Society for Microbiology, Washington, D.C. Pp. 589-597. 8. Gutell, R. R., Weiser, B., Woese, C. R. & Noller, H. F. 1985. Comparative anatomy of 16s like ribosomal RNA. Prog. Nucl. Acid Rex, 32: 1 55-2 16. 9. Modigliani, R., Bones, C., Le Charpentier, Y., Salmeron, M., Messing, B., Galian, A., Rambaud, J. C. & Desportes, I. 1985. Diarrhea and malabsorption in acquired immune deficiency syndrome: a study of four cases with special emphasis on opportunistic protozoan infestation. Gut, 26: 179-187.

209

10. Torres-Ruiz, R. A. & Hemleben, V. 1991. Use of ribosomal DNA spacer probes to distinguish cultivars of Cucurbita pep0 L. and other Cucurbitaceae. Euphytica, 53: 1 1-1 7. 1 1. Swofford, D. 1993. PAUP User’s Manual. Version 3. I . I . Illinois Natural History Survey, Champaign-Urbana, Illinois. 12. Vossbrinck, C. R., Baker, M. D., Didier, E. S., Debrunner-Vossbrinck, B. A., and Shadduck, J. A. 1993. Ribosomal DNA sequences of Encephalitozoon hellem and Encephalitozoon cuniculi: species identification and phylogenetic construction. 1993. J. Euk. Microbiol., 40: 354-362. 13. Vossbrinck, C. R. & Woese, C. R. 1989. Eukaryotic ribosomes that lack a 5 . 8 s RNA. Nature, 320:287-288. 14. Vossbrinck, C. R. & Nanney, D. L. 1989. Ciliate evolution: the ribosomal phylogenies of the tetrahymenine ciliates. J. Mol. Evol., 28: 427-44 I . 15. Vossbrinck, C. R. & Friedman, S. 1989. A 28s ribosomal RNA phylogeny of certain cyclorrhapous Diptera based on a hypervariable region. Syst. Entomol., 14:417-431. 16. Vossbrinck, C. R., Maddox, J . V., Friedman, D., DebrunnerVossbrinck, B. A., & Woese, C. R. 1987. Ribosomal RNA sequence suggests microsporidia are extremely ancient eukaryotes. Nature. 326: 41 1-414. 17. Wittner, M., Tanowitz, H. B. and Weiss, L. M. 1993. Parasitic infections in AIDS: cryptosporidiosis, isosporiasis, microsporidiosis and cyclosporiasis. Infect. Dis.Clin. N. Amer., 7569-586. 18. Zhu, X., Tanowitz, H. B., Wittner, M., Cali, A. & Weiss, L. M. 1993. Ribosomal RNA sequences of Enterocytozoon bieneusi and its potential diagnostic role. J. Infect. Dis. 168: 1570-1 575. 19. Zhu, X., Tanowitz, H. B., Wittner, M., Cali, A. & Weiss, L. M. 1993. Nucleotide sequence of the small ribosomal RNA of Encephalitozoon cuniculi. Nucl. Acids Res., 21: I3 15. 20. Zhu, X., Tanowitz, H. B., Wittner, M., Cali, A. & Weiss, L. M. 1993. Nucleotide sequence of the small ribosomal RNA of Ameson michaelis. Nucl. Acids Rex, 21 ~ 3 8 9 5 . 21. Zhu, X., Tanowitz, H. B., Wittner, M., Cali, A. & Weiss, L. M. 1993. Nucleotide sequence of the small ribosomal RNA of Septum intestinalis. Nucl. Acids Res., 21 :4846. 22. Woese, C. R., Gutell, R. R., Gupta, R. and Noller, H. F. 1983. Detailed analysis of the higher-order structure of 16s-like ribosomal ribonucleic acids. Microbiol. Rev., 41:62 1-669.

Received 8-26-93, 11-29-93: accepted 12-03-93