ISSN 1990519X, Cell and Tissue Biology, 2011, Vol. 5, No. 2, pp. 123–126. © Pleiades Publishing, Ltd., 2011. Original Russian Text © O.A. Fedorova, T.N. Moiseeva, A.G. Mittenberg, N.A. Barlev, 2011, published in Tsitologiya, Vol. 52, No. 12, 2010, pp. 1012–1015.
Recombinant Proteasome AlphaType Subunits Exhibit Endoribonuclease Activity O. A. Fedorova*, T. N. Moiseeva, A. G. Mittenberg, and N. A. Barlev Institute of Cytology, Russian Academy of Sciences, St. Petersburg, Russia *email:
[email protected] Received June 1, 2010
Abstract—26S proteasome is a multisubunit protein complex that consists of 19S regulatory and 20S catalytic subcomplexes. The primary proteasome cellular function is protein degradation. It has recently been found that, in addition to its proteolytic activities, the 20S particle also displays endoribonuclease activity mediated by two alphatype subunits, α1 and α5. In this report, we have analyzed other alphatype subunits for their ability to hydrolyze RNA. We have found that all of the recombinant subunits tested (α1, α2, α3, α4, α5, α7) exhibited endoribonuclease activity that depends on the origin of RNA and the presence of bivalent ions in the reaction. These results indicate that the endoribonuclease activity of proteasomes may play an important role in cellular RNA metabolism. Keywords: cmyc, endoribonuclease activity, mRNA, proteasomal alphatype subunits, proteasome, p53. DOI: 10.1134/S1990519X11020064
Abbreviations used: RT–PCR, reverse transcrip tion polymerase chain reaction; EDTA, ethylenedi aminetetraacetic acid; RNAase activity, endoribonu clease activity; GST, glutathione Stransferase Proteasomes are ATPdependent proteases local ized in both the cytoplasm and nuclei of most organ isms. Proteasome is usually regarded as a 26S protea some composed of a 20S core particle and two associ ated 19S regulatory complexes. The major proteasome cellular function is protein degradation by ubiquitin dependent mechanism. The core particle consists of three heptamere rings, each of which is produced by one of two subunit types, i.e., α or β. Proteasome pro teolytic centers are located on three βtype subunits, β1, β2, and β5. Subunits of the αtype ensure that the substrate has access to the proteolytic compartment of the proteasome, as well as the binding of regulatory complexes. In 1987, it was discovered that, in addition to its proteolytic activity, 20S proteasome exhibits endori bonuclease (RNase) activity that corresponds to tobacco mosaic virus RNA (Akhayat et al., 1987). Further examinations showed that 26S proteasome α1 α2 α3
also possesses RNase activity (Evteeva et al., 2000, 2003; Mittenberg et al., 2002, 2007; Toktarova et al., 2004). Proteasome RNase activity depends on the pres ence of magnesium and/or calcium bivalent ions (Mittenberg et al., 2002), as well as the phosphoryla tion state of the proteasome (Mittenberg et al., 2002; Evteeva et al., 2003) and the physiological state of the cell (Mittenberg et al., 2007; Tsimokha et al., 2007). Immunochemical investigations revealed that two proteasome subunits of the αtype are involved in RNA degradation, i.e., α5 (zeta) and α6 (iota) (Petit et al., 1997). However, no information was available on this activity in other proteasome subunits; there fore, the aim of this study was to assay the ability of αtype subunits to hydrolyze informational RNA. MATERIALS AND METHODS DNA cloning. cDNA of αtype proteasome sub units (α1, α2, α3, α4, α5, α7 were obtained by RTPCR from the total mRNA of human K562 cells using the following specific primers:
5' ATGCGGATCCGCATGTCCCGTGGTTCCAGCGCC3'/ 5' CGGAGGATCCGTTAGTCTCTCTCTGCTAGAGCAAC3' 5' ATGCGGATCCGCATGGCGGAGCGCGGGTAC3'/ 5' CGGAGGATCCGTTATGCTATGGCAGCAA3' 5' ATGCGGATCCGCATGTCTCGAAGATATGAC3'/ 5' CGGAGGATCCGCTATTTATCCTTTTCTTT3' 123
124
FEDOROVA et al.
α4 α5 α7
5' ATGCGGATCCGCATGAGCTACGACCGCGCC3'/ 5' CGGAGGATCCGTCATGATGCTTTCTTTTGTTT3' 5'ATGCAGATCTGCATGTTTCTTACCCGG3'/ 5'TGCCAGATCTGAATGTCCTTGATAACCTCT3' 5' ATGCGGATCCGCATGAGCTCAATCGGC3'/ 5' CGGAGGATCCGTTACAT ATTATCATC3'.
PCR products were cloned in a pGEX5X3 expression vector linearized with BamH1 for subse quent chimerical protein expression. Proteins were purified by affinity chromatography on glutathione sepharose (GE Healthcare, United States). Transcription in vitro. Transcription of 3'untrans lated region of cmyc mRNA was carried out with [α32P]CTP and SP6 phage RNA polymerase. p53 α1GST α2GST α3GST α4GST α5GST α7GST
K 123
123 1 2 3 1 2 3
GST
123 123 123
Fig. 1. Electrophoregram radioautography of cmyc mRNA 3'untranslated region transcribed in vitro and treated with α1GST, α2GST, α3GST α4GST, α5 GST α7GST and GST recombinant proteins. C, intact RNA; RNA treated with recombinant protein: 1—in the absence of bivalent cations; 2—in the presence of 10 mM MgCl2; 3—in the presence of 10 mM CaCl2.
mRNA was synthesized in the presence of [α32P]CTP and T3 RNA polymerase. RNA was incubated with chimerical proteins in the buffer composed of 20 mM HEPES, pH 7.6, 1 mM ATP, for 30 min at 37°C. The protein/RNA ratio was 1 : 1. Electrophoresis of RNA hydrolysates was performed under denatured conditions in 5% acrylamide gel with 7 M urea in Trisborate buffer (90 mM Trisborate, 2 mM EDTA, pH 8.3). RESULTS AND DISCUSSION It was previously shown that two αtype subunits (α1 and α5) isolated from cultured cells exhibited RNase activity (Petit et.al., 1997). However, this activ ity in other proteasome subunits was unknown. More over, the methods of isolating individual subunits from the 20S complex described in the report cited above (extraction from acrylamide gel followed by protein renaturation) suggested the possible contamination of isolated material with other proteasome subunits, as well as the incomplete recovery of the native protein structure. Therefore, here, we used the method of iso lating individual αtype subunits in the heterologous expression system of E. coli that excluded the presence of other proteasome subunits and ensured the nativity of the preparation. The application of affinity chroma tography based on glutathionesepharose interactions with recombinant chimerical proteins marked by a glutathione Stransferase (GST) fragment signifi cantly increased the purity of the examined subunits. To assay the RNase activity of purified subunits as substrates, we used p53 mRNA and 3'untranslated region of cmyc mRNA transcribed in vitro. To prevent the possible effect of GST protein on the RNase activ ity of chimerical proteins, recombinant GST isolated under the same conditions was used as a negative con trol. Electrophoresis analysis of the endonucleolysis products of the cmyc mRNA 3'untranslated region (Fig. 1) showed that all of the examined recombinant proteins are able to hydrolyze this RNA substrate, whereas p53 mRNA was found to be hydrolyzed by all subunits except α3 (Fig. 2, α3GST). RNase activity on both substrates depends on the presence of Ca2+ or Mg2+ in the reaction medium. It should be noted that GST protein does not display RNase activity (Fig. 1; Fig. 2, GST). It is important that only recombinant α1 and α5 exhibited RNAase activity in the absence of bivalent CELL AND TISSUE BIOLOGY
Vol. 5
No. 2
2011
RECOMBINANT PROTEASOME ALPHATYPE SUBUNITS α1GSTα2GST α3GST α4GST
K
1 2 3 123 1 2 3 1 2 3
α5GSTα7GST GST
123 123 123
125
of E.coli possess RNase activity. It should be empha sized that the subunit activity depends on the substrate applied and the presence of bivalent cations in the reaction mixture. What is the physiological role of RNase activity associated with proteasome αtype subunits? Accord ing to the literature data, proteasomes are involved in multiple biological processes, including the regulation of transcription (Mittenberg et al., 2008; Moiseeeva et al., 2010). Therefore, it is logic to suggest that, because proteasomes are involved in the regulation of transcription, they may exhibit RNase activity in addi tion to their proteolytic activities. ACKNOWLEDGMENTS The work was supported by the Russian Founda tion for Basic Research (project no. 100401234) and Presidium of Russian Academy of Sciences under the “Molecular and Cellular Biology” program. REFERENCES
Fig. 2. Electrophoregram radioautography of p53 mRNA transcribed in vitro and treated with α1GST, α2GST, α3GST, α4GST, α5GST, α7GST, and GST recombi nant proteins. Designations are same as in Fig. 1.
cations with the cmyc mRNA 3'untranslated region as the substrate (Fig. 1, lanes 1). Other subunits were inactive in the absence of Ca2+ or Mg2+ ions (Fig. 1, lanes 2, 3). Mg2+ ions always activate RNase activity (Fig. 1, lanes 2) whereas effect of Ca2+ ions depends on a particular subunit (Fig. 1, lanes 3). Hence, it is pos sible to conclude that all recombinant subunits we assayed hydrolyzed the cmyc mRNA 3'untranslated region, but the activity depended specifically on biva lent cations. No recombinant proteins exhibited RNase activity with p53 mRNA as the substrate in the absence of bivalent cations (Fig. 2, lanes 1). As with cmyc mRNA 3'untranslated region as substrate Mg2+ ions stimulated the activity (Fig. 2, lanes 2). Ca2+ ions dis played a selective effect on the RNase activity of recombinant subunits (Fig. 2, lanes 3). The α3 subunit did not hydrolyze RNA, even in the presence of biva lent ions (Fig. 2, α3GST). Our experiments show all αtype subunits that were fused with GST protein fragment and affinity purified CELL AND TISSUE BIOLOGY
Vol. 5
No. 2
2011
Akhayat, O., Infante, A.A., Infante, D., Martins, de S.A.C., Grossi, de S.A.M.F., and Scherrer, K., A New Type of ProsomeLike Particle, Composed of Small Cytoplasmic RNA and Multimers of a 21kDa Protein, Inhibits Protein Synthesis in vitro, Eur. J. Biochem., 1987, vol. 170, pp. 23– 33. Evteeva, I.N., Kulichkova, V.A., Obukhova, A.D., Mitten berg, A.G., Volkova, I.V., Ermolaeva, Yu.B., Toktarova, M.V., Teslenko, L.V., Gauze, L.N., and Kon stantinova, I.M., EGF Regulation of Specific Endoribonu clease Activity of 26S Proteasomes from A431 Cells: a Potential Role of Proteasomes in Control of mRNA Stabil ity, Tsitologiia, 2003, vol. 45, no. 5, pp. 488–492. Evteeva, I.N., Kulichkova, V.A., Volkova, I.V., Ermolaeva, Yu.B., Mittenberg, A.G., Teslenko, L.V., Obukhova, A.D., Penniyainen, V.A., Gauze, L.N., and Konstantinova, I.M., Novel Endoribonuclease Activity of 26S Proteasomes from A431 Cells, Tsitologiia, 2000, vol. 42, no. 7, pp. 675–680. Jarrousse, A. S., Petit, F., KreutzerSchmid, K., Gaedigk, R., and Schmid, H.P., Possible Involvement of Proteasomes (Prosomes) in AUUUAMediated mRNA Decay, J. Biol. Chem., 1999, vol. 274, pp. 22023–22028. Mittenberg, A.G., Kulichkova, V.A., Medvedeva, N.D., Penniyainen, V.A., Gauze, L.N., and Konstantinova, I.M., Properties of Endoribonuclease Activity of Proteasomes from K562 Cells. II. Analysis of Specific mRNA Nucleoly sis by Proteasomes, Tsitologiia, 2002, vol. 44, no. 4, pp. 357–363. Mittenberg, A.G., Moiseeva, T.N., and Barlev, N.A., Role of Proteasomes in Transcription and Their Regulation by Covalent Modifications, Frontieres Biosci., 2008, vol. 13, pp. 7184–7192. Mittenberg, A.G., Moiseeva, T.N., Pugacheva, I.V., Kuli chkova, V.A., Tsimokha, A.S., Gauze, L.N., and Konstan tinova, I.M., Regulation of the 26S Proteasomes’ Endori bonuclease Activity Specificity in K562 Cells Under Effect
126
FEDOROVA et al.
of Differentiation and Apoptosis Inductors, Tsitologiia, 2007, vol. 49, no. 2, pp. 142–148. Moiseeva, T.N., Mittenberg, A.G., and Barlev, N.A., The Role of Proteasomes in Transcription Regulation, Tsi tologiia, 2010, vol. 52, no. 3, pp. 195–203. Petit, F., Jarrousse, A.S., Dahlmann, B., Sobek, A., Hendil, K.B., Buri, J., Briand, Y., and Schmid, H.P., Involvement of Proteasomal Subunits zeta and iota in RNA Degradation, Biochem. J., 1997, vol. 326, pp. 93–98. Toktarova, M.V., Kulichkova, V.A., Mittenberg, A.G., Kozhukharova, I.V., Volkova, I.V., Ermolaeva, Yu.B., Peshekhonov, A.V., Ignatova, T.N., Gauze, L.N., and Kon
stantinova, I.M., Selective Effect of Inductors of Apoptosis on the Endoribonuclease Activity of 26S Proteasomes and alphaRNP Particles in K562 Cells: Possible Involvement of 26S Proteasomes and alphaRNP in the Regulation of RNA Stability, Tsitologiia, 2004, vol. 46, no. 3, pp. 283– 290. Tsimokha, A.S., Mittenberg, A.G., Kulichkova, V.A., Kozhukharova, I.V., Gause, L.N., and Konstantinova, I.M., Changes in Composition and Activities of 26S Proteasomes Under the Action of DoxorubicinApoptosis Inductor of Erythroleukemic K562 Cells, Cell Biol. Int., 2007, vol. 31, pp. 338–348.
CELL AND TISSUE BIOLOGY
Vol. 5
No. 2
2011
