Receptor-Ck regulates giardia encystation process

Molecular and Cellular Biochemistry 225: 167–169, 2001. © 2001 Kluwer Academic Publishers. Printed in the Netherlands.

167 Short communication

Receptor-Ck regulates giardia encystation process D. Kaul,1 R. Rani1 and R. Sehgal2 Departments of 1Experimental Medicine and Biotechnology; 2Department of Parasitology, Post Graduate Institute of Medical Science and Research, Chandigarh, India Received 6 February 2001; accepted 19 June 2001

Abstract The study addressed to resolve the mechanism involved in cholesterol-dependent regulation of giardia encystation process, revealed that (a) the trophozoites have the ability to express genes coding for receptor-Ck and sterol element binding protein (SREBP); (b) inhibition of cholesterol dependent activation of receptor-Ck results in the upregulation of CWP-1 gene expression leading to encystation process. Based upon these findings, we propose that receptor-Ck dependent signalling is responsible for the regulation of giardia encystation process by cholesterol. (Mol Cell Biochem 225: 167–169, 2001) Key words: cholesterol, receptor-Ck, SREBP, CWP1 gene, giardia

Introduction Giardia lamblia belongs to a primitive lineage within eukaryotic domain, and its differentiation into cysts may represent an adaptive response that eukaryotes developed early in evolution to survive harmful environmental factors [1, 2]. On the basis of morphological, immunological and biochemical criteria, it was recently demonstrated that cholesterol deprivation is necessary and sufficient to induce giardia encystation process [3]. Although it was established that cholesterol-dependent down-regulation of encystation-specific CWP-1 gene expression contributed to the inhibition of giardia encystation process [3, 4], the molecular mechanism involved in cholesterol-dependent encystations process remains undefined because of two inherent anomalies: (a) giardia is unable to express the apoprotein ‘B’-specific LDL receptor [2]; (b) it is unable to synthesize cholesterol de novo despite the fact that initial steps of the mevalonate pathway are present in this organism [2]. The fact that cholesterol is a hydrophobic molecule which resides in lipoproteins and cell membranes, raised two fundamental questions: (a) how does the cell sense the level of cholesterol? (b) how is this cholesterolspecific signalling transmitted to the nucleus for the regulation of various genes? Recent studies directed to resolve these questions, led to the discovery of a novel cell surface cho-

lesterol-sensor designated as receptor-Ck which was not only shown to be ubiquitously present in various human organs but also (through its signalling pathway) regulated various genes involved in cholesterol homeostasis (HMGCoA synthase; HMGCoA reductase; apo ‘B’-specific LDL-receptor), cell growth (cyclin ‘D’; C-fos; C-myc; p27 etc.); cell death (Bcl-2) through a 47 kDa transcription factor (derived from the cleavage of 125 kDa SREBP) having affinity for genomic sterol regulatory element (SRE) sequence as well as other through other transcription factors [5–9). Based upon these findings, the present study was addressed to understand two specific issues: (a) whether or not giardia has the genes coding for receptor-Ck and SREBP? (b) if yes, how activation/ deactivation of cholesterol-specific receptor-Ck influences the giardia encystation process?

Materials and methods Giardia intestinalis trophozoites [BRIS/83/HEPU/106(10)] were cultured axenically at 37°C in Diamond’s medium TY1S-33 containing 10% horse serum. Protein extract of these cultured trophozoites, was subject to SDS-PAGE followed by Western blotting procedure [7, 8]. Subsequently these blots were probed with antibodies specific for SREBP and

Address for offprints: D. Kaul, Department of Experimental Medicine and Biotechnology, Post Graduate Institute of Medical Science and Research, Chandigarh - 160 012, India

168

a

receptor-Ck using immunodetection procedure reported earlier [7–9]. In order to understand how receptor-Ck influences the encystation process, two types of experiments were designed: 1. Trophozoites were cultured to confluence in TY1-S-33 medium in 10-ml glass tubes for 72 h, typically yielding a cell density of about 1.2 ´ 106 cells/ml. The media from monolayer cultures were decanted and replaced with fresh medium containing 5% horse serum coupled with either cholesterol (50 µg/ml) or cholesterol (50 µg/ml) + antibody against receptor-Ck. These cultures were incubated at 37°C for up to 48 h. At the end of 48 h incubation time, the number of water-resistant cysts from the supernatant medium as well as their viability was determined by fluorescein diacetate/ propidium iodine staining [3]. 2. Giardia trophozoites were exposed to medium containing either cholesterol or cholesterol + antibody specific for receptor-Ck for up to 6 h. Total cellular RNA was extracted by using standard method [11] and the integrity of RNA from each sample was verified by electrophoretic size separation in 1% ethidium-bromide stained agarose-gels, cDNA was synthesised using random primers and MMLV reverse transcriptase [11, 12]. CWP1 cDNA was emplified using oligonucleotide primers [ATGATGCTCGCTCTCCTTGC and CAGGTGCAAATAGACTCTCC] for 23 cycles (94°C for 45 sec, 60°C for 45 sec, 72°C for 90 sec). Reaction products were resolved on 2% ethidium bromide-stained agarose gels.

Results Immunodetection analysis of trophozoites revealed the presence of genes coding for SREBP and receptor-Ck (Fig. 1). Transcriptional expression of CWP-1 gene could not be de-

b

c

d

e

CWP1 →

← GAPDH

Fig. 2. Transcriptional expression CWP1 gene in giardia trophozoites exposed to medium containing either cholesterol (a) or cholesterol + antibody to receptor-Ck for 3 h (b) and 6 h (c). The PCR controls (d, e). GAPDH gene used as invariant control.

tected in trophozoites exposed to cholesterol (Fig. 2a). However, when these trophozoites were cultured in the presence of cholesterol coupled with antibody (specific for receptorCk) for up to 6 h, the transcription expression of CWP-1 gene was detected (Figs 2b and 2c). Steady-state level of CWP1 mRNA was observed from 3 h onwards. At 48 h, 58% trophozoites differentiated into cysts with 100% viability in cultures to which antibody-specific for receptor-Ck was added (Table 1). These results unambiguously reveal that cholesterol-dependent regulation of CWP-1 gene within giardia as well as its encystations process, is mediated through activation/deactivation of receptor-Ck.

Discussion SR

P EB

Re

p ce

to

rC

k

← 69 kDa 47 kDa →

Fig. 1. Translational expression of genes coding for receptor-Ck and SREBP in giardia intestinalis trophozoites.

Compelling evidence [3] supports the view that cholesterol starvation is necessary and sufficient for giardia trophozoites

Table 1. Receptor-Ck-dependent regulation of giardia encystation process Exposure to

Total cysts × 105/ml

%

Viable cysts %

TYI-S-33 Medium + 5% HS + cholesterol (50 µg/ml)

–

–

–

57.9

100

TYI-S-33 Medium + 3.6 ± 0.1 5% HS + cholesterol (50 µg/ml) + Ab*-RCk

HS – horse serum; Ab*-RCk – antibody to receptor Ck.

169 to differentiate into environmentally resistant cysts. During encystations in vitro, steady-state levels of CWP1 transcripts increases to a maximum nearly 140 times that observed in non-encysting trophozoites [2]. In trophozoites, transcription of CWP1 gene is repressed in the presence of cholesterol whereas sterol depletion leads to increased transcription [2]. Since giardia is unable to synthesize cholesterol de novo and several lines of evidence suggest that giardia does not process apo ‘B’-specific LDL receptor to take up cholesterol from the medium [2], the existence of receptor-Ck in giardia parasite assumes importance in defining the mechanism through which cholesterol exerts its influence upon encystations process. Based upon the findings reported here, we propose that cholesterol-dependent activation of receptor-Ck gives rise to signalling pathway ([6, 9] Fig. 1) which in turn, down-regulates the CWP1 gene transcription leading to the inhibition of encystations process. However more experiments are needed in order to resolve the interrelationship between receptor-Ck-dependent signalling, proteolytic maturation of SREBP and transcription of CWP1 gene responsible for giarda encystations process. The findings reported here attempt to explain, for the first time, two vital issues: (a) how giarda senses the level of cholesterol in the environment? (b) how this sensing mechanism regulates CWP1 gene involved in the encystations process?

References 1. Gillin FD, Reiner DS, McCafery JM: Cell biology of primitive eukaryote giardia lambia. Annu Rev Microbiol 50: 679–705, 1996 2. Lujan HD, Mowatt MR, Nash TE: Mechanisms of giardia lambia differentiation into cysts. Microbiol Mol Biol Rev 61: 294–304, 1997 3. Lujan HD, Mowatt MR, Byrd GG, Nash TE: Cholesterol starvation induces differentiation of the intestinal parasite giardia lambia. Proc Natl Acad Sci USA 93: 7628–7633, 1996 4. Mowatt MR, Lujan HD, Colten JB, Bowers B, Yee J, Nash TE: Developmentally regulated expression of a giardia lambia cyst wall protein gene. Mol Microbiol 15: 955–963, 1995 5. Kaul D: Do human platelets possess LDL-receptor specific for apoprotein ‘B’ or cholesterol? Curr Sci 65: 883–886, 1993 6. Kaul D: Receptor-Ck and leukemogenesis. Leuk Res 22: 389–394, 1998 7. Kaul D, Kaur M: Receptor-Ck regulates the expression of cyclin-dependent kinase inhibitors. Mol Cell Biochem 200: 183–186, 1999 8. Kaur M, Kaul D, Sobti RC: Receptor-Ck dependent regulation of genes involved in the cell cycle. Mol Cell Biochem 181: 137–142, 1998 9. Kaul D, Khosla VK: Molecular basis of ‘cholesterol feedback lesion’ in CNS tumors. Neurology India 48: 174–177, 2000 10. Borcham PFL, Phillips RE, Shepherd RW: Altered uptake of metronidazole in vitro by stocks of giardia intestinalis with different drug sensitivities. Trans R Soc Trop Med Hyg 82: 104–106, 1988 11. Goel R, Singh J, Kaul D: Receptor-Ck dependent signalling regulates LDL-receptor gene transcription. Mol Cell Biochem 169: 79–83, 1997 12. Xu D, Grubder A, Bjorkholm M, Peterson C, Pisa P: Suppression of telomerase reverse transcriptase (hTER) expression in differentiated HL60 cells: Regulatory mechanisms. Brit J Cancer 80: 1156–1161, 1999

170