Virology 255, 285–293 (1999) Article ID viro.1998.9558, available online at http://www.idealibrary.com on
RANTES, IFN-g, CCR1, and CCR5 mRNA Expression in Peripheral Blood, Lymph Node, and Bronchoalveolar Lavage Mononuclear Cells during Primary Simian Immunodeficiency Virus Infection of Macaques Arnaud Che´ret, Roger Le Grand,1 Philippe Caufour, Olivier Neildez, Franck Matheux, Fre´de´ric The´odoro, Bruno Vaslin, and Dominique Dormont CEA, Service de Neurovirologie (DSV/DRM), CRSSA, Institut Paris-Sud sur les Cytokines, B.P. 6, 92265 Fontenay aux Roses, Cedex, France Received September 4, 1998; returned to author for revision October 12, 1998; accepted December 1, 1998 Primary infection of macaques with pathogenic isolates of simian immunodeficiency virus (SIV) (as a model of HIV infection in humans) represents a unique opportunity to study early lentivirus/host interactions. We sought to determine whether there is a temporal relationship linking SIV replication and dissemination and the expression of the chemokine RANTES (regulated upon activation normal T cell expressed and secreted) and the SIV/HIV coreceptor CCR5 in different tissues during acute SIV infection of macaques. Four cynomolgus macaques were inoculated intravenously with a pathogenic primary isolate of SIVmac251. RT-PCR was used to monitor the expression of RANTES and CCR5 mRNA in fresh isolated mononuclear cells from blood, lymph node, and bronchoalveolar lavages. These expressions were compared to those of IFN-g as an indicator of the development of the immune response and to another receptor for RANTES, CCR1, which is not described as a coreceptor for SIV/HIV-1 entry. An enhancement of CCR1/CCR5 mRNA expression was noticed during primary SIVmac251 infection of macaques, mainly in tissue. In the three different compartments investigated, IFN-g and RANTES overexpression was noticed by the time of systemic viral replication containment. Our results put CCR5 and RANTES mRNA expression back in the context of inflammatory and immune responses to SIV primary infection. © 1999 Academic Press
and CCR5 interactions during HIV infection are not limited to their potential to control viral replication: RANTES is an important inflammatory mediator. RANTES is implicated in the migration of several leukocytes in different tissues (Baggiolini et al., 1997) and may participate in the extent and/or the nature of the immune response (Chensue et al., 1997; Dairaghi et al., 1998; Taub et al., 1996). It is thus difficult to predict how this chemokine influences HIV infection in a complex physiological environment. Primary HIV infection is characterized by high levels of viral replication followed by the containment of virus spread, suggesting an early efficient immune control (Daar et al., 1991). This period represents therefore a unique opportunity to investigate RANTES/CCR5 interactions with virus replication in vivo. For this purpose simian immunodeficiency virus (SIV) infection of macaques appears very attractive. SIVs are nonhuman primate lentiviruses that share genomic organization and biological properties with HIV-1 and HIV-2. Some SIV strains, like SIVmac, induce AIDS in macaques (Daniel et al., 1985; Desrosiers, 1990). Moreover, SIVmac and monocyte/ macrophage tropic strains of HIV-1 that predominate early after infection share CCR5 as coreceptor of the molecule CD4 for entry in target cells (Berger et al., 1998; Chen et al., 1997; Marcon et al., 1997) and MIP-1a, MIP-1b, and RANTES inhibit SIV infection in vitro (Cocchi et al., 1995; Wang et al., 1998). More recent findings indicate that additional chemokine receptors or related
INTRODUCTION Chemokines are a large family of proteins involved in the recruitment and activation of several cell types. They induce their biological effects by interacting with specific receptors on the surface of target cells (Baggiolini et al., 1997; Luster, 1998). Interestingly, CC chemokines MIP-1a (macrophage inflammatory protein), MIP-1b, and RANTES (regulated upon activation normal T cell expressed and secreted) are able to suppress the replication of macrophage tropic HIV strains in vitro (Cocchi et al., 1995). Their suppressive effects are likely due to the inhibition of the coreceptor function for viral entry of their natural shared receptor: the CC chemokine receptor 5 (CCR5) (Doms and Peiper, 1997). The finding that the D32 mutation on the ccr5 allele, leading to a truncated polypeptide that is not expressed on the cell surface, confers to exposed individuals a significant degree of resistance to HIV-1 infection stresses the major role of CCR5 as coreceptor for HIV-1 in vivo (Doms and Peiper, 1997). In vitro, RANTES is consistently the most effective HIV suppressor (Cocchi et al., 1995). However, the clinical relevance of this chemokine is still debated. RANTES
1 To whom correspondence and reprint requests should be addressed at Service de Neurovirologie, DSV/DRM, Commissariat a` l’Energie Atomique, B.P. 6, 92265 Fontenay aux Roses, Cedex, France. Fax: 133 1 46 54 77 26. E-mail:
[email protected].
285
0042-6822/99 $30.00 Copyright © 1999 by Academic Press All rights of reproduction in any form reserved.
CHE´RET ET AL.
286
seven-transmembrane segment receptors can function as SIV coreceptors (Hoffman and Doms, 1998). In the present work, we sought to determine whether there is a temporal relationship linking SIV infection and the expression of RANTES and CCR5 in different tissues during acute SIV infection of macaques. These expressions were compared to those of IFN-g as an indicator of the development of the immune response and another receptor for RANTES, CCR1. CCR1 is not a coreceptor for SIV/HIV-1 entry; however, it is expressed on monocytes and lymphocytes, the main target of HIV/SIV as CCR5 (Rottman et al., 1997; Su et al., 1996). Consequently, we investigated the expression of transcripts of RANTES, IFN-g, CCR1, and CCR5 in peripheral blood mononuclear cells (PBMC), lymph node mononuclear cells (LNMC), and mononuclear cells obtained after bronchoalveolar lavage (BALMC) during acute infection of macaques with a pathogenic primary isolate of SIVmac251. These analyses were performed in parallel with the evaluation of systemic virus load and T lymphocyte subset changes. RESULTS Clinical follow-up Starting on day 7 after SIV inoculation, all four animals developed a generalized lymphadenopathy. Peripheral lymphadenopathy, characterized by increases in all lymphocyte subsets within lymph nodes, is an early and sustained symptom following virus infection (Reimann et al., 1994). Systemic virological and immunological follow-up All four animals inoculated with the primary isolate of SIVmac251 became infected. Levels of SIV RNA in plasma peaked between days 12 and 19 postinoculation (p.i.) (Fig. 1A). By this time, plasma associated virus load was the lowest for monkey J122 (Fig. 1A). Circulating infectious cells were detected by the first week p.i. in the blood of monkey J495 and by the second week p.i. for the other animals: the highest titer was measured for monkey J495 by day 14 p.i. and monkey J122 was once again the animal with the lowest titer (Fig. 1B). Titers at day 21 p.i. are ,1, which is the limit of detection for this assay. Using more sensitive, but not quantitative, methods, it was possible to isolate virus from blood cells at this time (data not shown). Infection of PBMC, LNMC, and BALMC was confirmed by PCR analysis for the four animals by day 14 p.i. (data not shown). In BALMC proviral DNA remained detectable for monkeys J116, J418, and J495 throughout the study, except for monkey J122, the animal with the lowest systemic virus load (data not shown). The animals seroconverted by day 21 p.i. (Fig. 1C).
FIG. 1. Systemic parameters. (A) Viral plasma mRNA (copies/ml). (B) Blood cell associated virus load titer (TCID50). (C) SIV antibodies (optical density).
Changes in T lymphocyte subsets Statistically significant decreases in circulating CD41 and CD81 lymphocyte counts were observed on day 14 p.i. (P , 0.06) for monkeys J116, J418, and J495 (Fig. 2). At this time point, no statistically significant changes in circulating CD41 and CD81 lymphocyte counts were observed for monkey J122, the animal with the lowest systemic virus load. After day 21 p.i., monkey J116 demonstrated an increase in CD81 lymphocyte counts above preinoculation values. In lymph nodes, a modest downward trend of the percentage of CD41 lymphocytes was observed from day 7 for the four monkeys (Fig. 2). The percentage of CD81 lymphocytes remained stable for three monkeys (J116, J122, and J495). A rise of the percentage of CD81 lymphocytes was observed by day 7 for one animal (J418). Since lymphadenopathy was evident
RANTES AND CCR5 EXPRESSION DURING ACUTE SIV INFECTION
287
FIG. 2. Changes in T lymphocyte subsets. Numbers of circulating CD41 and CD81 T lymphocytes; percentages of CD41 and CD81 T lymphocytes in LNMC; percentages of CD41 and CD81 T lymphocytes among BALMC.
in these four animals, stable or weak changes in the percentages of CD41 or CD81 cells probably correspond to an absolute increase in those subsets in the peripheral lymph nodes. To assess T lymphocyte changes in the lung of macaques acutely infected with SIV, bronchoalveolar lavage (BAL) was performed. The percentage of BAL fluid recovered was approximately 75% of the injected fluid. The alveolar cellularity ranged from 50,000 to 200,000 cells per milliliter of fluid recovered. No statistically significant difference in cellularity was noticed between baseline and postinfection BAL (data not shown). To rule out potential side effects of repeated bronchoalveolar lavages, we have verified that repeated bronchoalveolar lavages in uninfected animals do not affect the percentages of CD81 and CD41 lymphocytes among BALMC even if weekly bronchoalveolar lavages were followed by two lavages a week (Che´ret et al., 1996) (data not shown). During the course of this study, the majority of BALMC recovered were macrophages (greater than 85%). Percentages of CD41 lymphocytes among BALMC remained low for all the monkeys during acute SIV infection (below 2.5%) (Fig. 2). A significant enhancement of the percentage of CD81 lymphocytes among BALMC was detected for the four monkeys, but it differed from one animal to another (Fig. 2). The percentage of CD81 lymphocytes increased substantially in the mononuclear cell population for monkeys J116, J495, and J418 by day 17 or 21 p.i. (Fig. 2). For these animals, 3 weeks after SIV inoculation, the majority of BAL lymphocytes were of the CD81 phenotype (up to 70%). Animal J122, which exhibited the lowest circulating infectious cell titers and SIV RNA plasma levels, presented only a weak increase of CD81 percentage on day 35 p.i. Therefore, enhancement of CD81 in BAL appears
to be correlated with systemic viral load as we previously suspected (Che´ret et al., 1996). Kinetics of RANTES, CCR5, CCR1, and IFN-g mRNA expression Data from the blood compartment may not accurately reflect events in lymphoid organs. Consequently, to investigate chemokine or chemokine receptor mRNA expression, our study was performed concomitantly on PBMC, LNMC, and BALMC. To prevent interindividual variations in the number of mRNA copies, we chose to compare each animal before and after inoculation, instead of comparing groups of uninfected and infected animals. From day 7 p.i. to day 35 p.i., significant enhancement of CCR5 mRNA expression was detected in BALMC in four of four animals and in PBMC in two of four monkeys. In LNMC, three of four monkeys exhibited a CCR5 mRNA overexpression (Table 1). During this same period of active viral replication, enhancement of CCR1 mRNA expression was detected in BALMC of the four animals (although it was statistically significant in only three of four) and in PBMC in two of the animals (Table 2). CCR1 mRNA expression in LNMC of monkey J122 peaked on day 14 p.i. (day 0 p.i., CCR1 mRNA/GAPDH mRNA ,0.1; day 14 p.i., CCR1 mRNA/GAPDH mRNA 5 1.2; data not shown). We have previously described that a significant increase of IFN-g mRNA expression occurred in BALMC during acute SIVmac251 infection (Che´ret et al., 1996). As expected, we confirmed a significant enhancement of IFN-g mRNA in BALMC of the four monkeys (Fig. 3). An increased expression of IFN-g mRNA was also noticed in LNMC during acute SIV infection as previously described (Zou et al., 1997). Statis-
CHE´RET ET AL.
288
TABLE 1 CCR5 mRNA Levels (as a Ratio of Receptor mRNA/GAPDH mRNA) Monkey:
J116
J122
J418
J495
PBMC
LNMC
BALMC
PBMC
LNMC
BALMC
PBMC
LNMC
BALMC
PBMC
LNMC
BALMC
Preinoculation: n: SD: Days p.i.
0.1 5 60.2
0.8 1
0.2 5 60.2
0.1 5 60.2
1.2 1
,0.1 5 60.0
0.6 2 60.6
,0.1 1
0.5 5 60.4
1.0 5 60.6
0.8 1
0.2 5 60.2
7 14 21 28 35
0.6 ,0.1 2.9 0.7 0.5
0.4 0.1
0.5 0.3 1 0.8 0.1
,0.1 1.1 ,0.1 0.5 0.1
2.0 3.0
0.5 ,0.1 ,0.1 ,0.1 1.7
0.4 ,0.1 0.4 0.8 1.0
,0.1 1.0
0.9 1.4 0.8 2.5 1.9
1.1 NT 1.1 3.0 1.6
0.1 NT
0.5 1.5 1.0 0.5 0.3
1.3
1.4
1.2
2.3
Note. Values in boldface type: P , 0.05 (receptor GAPDH ratio on days 7, 14, 21, 28, and 35 p.i. were compared to preinoculation values); preinoculation values represent the average of (n) time points tested before SIV inoculation. NT, not tested.
tically significant changes in IFN-g mRNA expression were detected in PBMC of two of the animals (Fig. 3). IFN-g mRNA levels were undetectable in the PBMC of monkey J122 before infection and weakly detectable after SIV infection (Benveniste et al., 1996). Closely related to IFN-g mRNA profiles, a statistically significant increased expression of RANTES mRNA was observed in BALMC in the four animals and in LNMC and PBMC in three animals (Fig. 3). These results emphasize the importance of a comparative study of immunological parameters in different tissues. As we previously reported (Che´ret et al., 1996, 1997), the blood compartment may not accurately reflect pathogenetic events that occur in lymphoid organs. IFN-g and RANTES overexpression was noticed in different tissues from the third week of infection on by the time of containment of virus replication as assessed by plasma SIV RNA quantification; these overexpressions occurred earlier in BALMC than in PBMC. Increased IFN-g and RANTES expression closely paral-
leled a marked increase in the percentages of CD81 T lymphocytes in BALMC. DISCUSSION Acute infection of macaques with pathogenic isolates of SIV as a model of HIV infection of humans represents a unique opportunity to study early lentivirus/host interactions (Benveniste et al., 1996; Lifson et al., 1997). Infection of macaques with the macrophage tropic SIVmac251 permits simultaneous experimental investigations not only at the systemic level but also locally in each of the target organs of lentiviruses. This seems particularly relevant in the study of the in vivo role of cytokines and chemokines, which are likely to contribute to HIV control and/or pathogenesis by autocrine and/or paracrine interactions. To clarify the involvement of the chemokine RANTES and its receptor CCR5 in the early control of viral replication as well as their contribution to
TABLE 2 CCR1 mRNA Levels (as a Ratio of Receptor mRNA/GAPDH mRNA) Monkey:
J116
J122
J418
J495
PBMC
BALMC
PBMC
BALMC
PBMC
BALMC
PBMC
BALMC
Preinoculation: n: SD: Days p.i.
0.8 5 61.1
0.3 5 60.2
1.2 5 60.6
1.6 5 60.3
,0.1 2 60.0
,0.1 5 60.1
0.6 5 60.5
1.1 5 60.5
7 14 21 28 35
1.4 ,0.1 2.1 0.6 3.6
0.5 0.6 1.2 1.3 0.5
2.6 5.4 2.8 2.8 5.3
1.0 2.0 0.9 0.8 1.2
0.4 1.1 0.7 0.9 1.6
0.1 0.7 ,0.1 0.3 ,0.1
0.9 NT ,0.1 0.7 2.5
0.1 1.5 0.6 1.3 1.3
Note. Values in boldface type: P , 0.05 (receptor GAPDH ratio on days 7, 14, 21, 28, and 35 p.i. were compared to preinoculation values); preinoculation values represent the average of (n) time points tested before SIV inoculation. NT, not tested.
RANTES AND CCR5 EXPRESSION DURING ACUTE SIV INFECTION
289
FIG. 3. IFN-g and RANTES mRNA levels (as a ratio of cytokine mRNA/GAPDH mRNA). *P , 0.05 (cytokine mRNA/GAPDH mRNA ratio on days 7, 14, 17, 21, 28, and 35 were compared to preinoculation values). Preinoculation value represents the average of time points tested before SIV inoculation.
immunological or inflammatory processes during acute HIV infection, we simultaneously investigated the early events taking place in the lung, lymph node, and blood of macaques inoculated intravenously with a pathogenic isolate of SIVmac251. We demonstrated that primary infection is characterized by an enhancement of CCR1/ CCR5 mRNA expression in BALMC, LNMC, and to a lesser extent in PBMC. IFN-g and RANTES mRNA levels increased at late times after infection in these different compartments by the time of the containment of systemic viral load. This study highlights the particular interest of studying peripheral lymphoid organs to investigate chemokine and chemokine receptor expression. The increase in the percentage of CD81 T cells in different tissues that we and others have observed during acute SIV infection by the time of seroconversion is less marked in PBMC and LNMC than in BALMC. It indicates the early recruitment of immunocompetent cells to the tissular compartment during primary lentivirus infection (Che´ret et al., 1996; Reimann et al., 1994; Rosenberg et al., 1997). Mechanisms that cause transvascular migration of leukocytes in specific tissues during SIV/HIV infection are not well understood. High levels of cytokines in plasma (Rosenberg et al., 1997) and induction of adhesion molecules on the leukocyte surface (Birdsall et al., 1997) have been implicated, suggesting a major role played by chemokines and their Gprotein-coupled receptors (Baggiolini et al., 1997). In our experiment, from day 7 p.i. to day 35 p.i., we observed a significant overexpression of CCR1 and CCR5 mRNA. Both these chemokine receptors are expressed on monocytes, CD81 and CD41 lymphocytes (Rottman et al., 1997; Wu et al., 1996; Wu et al., 1997b). The levels and
kinetics of CCR5 mRNA varied among animals, the compartment investigated, and time points. The wide range of variability of CCR5 cell surface expression is well documented among humans (Ostrowski et al., 1998; Wu et al., 1997b). It is of concern that mRNA levels may not totally reflect protein synthesis, excretion, or surface expression. However, Moriuchi et al. (1997a) recently reported the link between up-regulation of the CCR5 promoter and cell surface expression of the molecule. Furthermore, leukocyte responses to chemokines are known to correlate with their receptor mRNA expression (Loetscher et al., 1996). Interestingly, CCR5 is expressed in a cell subset thought to represent previously activated/memory T cells, which exhibit the highest transendothelial chemotactic potential (Bleul et al., 1997; Loetscher et al., 1996). The CCR mRNA overexpression that we detected mainly in LNMC and BALMC may strengthen the hypothesis that during SIV primary infection, by up-regulating CCR, immune cells migrate into infected tissue compartments. Our results confirm and extend previous data suggesting the recruitment of CCR51 cells to inflammatory sites and the early activated/memory state of immune T cells during HIV/SIV infection (Cossarizza et al., 1995; Qin et al., 1998; Reimann et al., 1994; Rottman et al., 1997). The molecular events responsible for increased mRNA expression of CCR5 that we detected during primary infection are unknown. It is unlikely that CCR5 mRNA overexpression is exclusively related to intense SIV replication, since statistically significant values have been noticed as soon as day 7 p.i. before peaks of systemic viral load or at late times of infection after the apparent control of replication. Variation among time points highlights the complexity of
290
CHE´RET ET AL.
chemokine receptor expression regulation. Nevertheless, changes in CCR5 levels may not be linked to the “coreceptor function” of CCR5 since mRNA expression of CCR1, a receptor not used for SIV entry, was also increased during acute SIV infection. Taken together, CCR1 and CCR5 mRNA overexpression strengthens the hypothesis that, as early as primary infection, perturbations of chemokine receptor expression take place in an inflammatory and immune network (Gerard et al., 1997; Ostrowski et al., 1998). We and others have already demonstrated that primary SIV infection of macaques is characterized by an increased production of proinflammatory mediators (Che´ret et al., 1996, 1997; Zou et al., 1997). In addition, CCR5 is a coreceptor for SIV/HIV entry (Chen et al., 1997; Marcon et al., 1997) and its overexpression may therefore illustrate an increased susceptibility to infection of monocytes and CD41 T lymphocytes and facilitate tissue dissemination of infected cells (Rottman et al., 1997; Wu et al., 1997b). This close relationship between viral infection and dissemination is strengthened by the observation that CD41 T cell trafficking may be induced by the SIV/HIV envelope itself via CCR5 (Weissman et al., 1997). In vitro, CCR5 appears responsible for most of the chemotactic activities of the CC chemokine RANTES on activated T cells (Wu et al., 1997a). RANTES is mainly chemotactic for monocytes and CD41 T memory cells, although CD81 T cell migration toward this chemokine has also been reported (Murphy et al., 1994; Schall et al., 1990). We detected RANTES mRNA overexpression for the four monkeys in different tissues from the third week of infection. Our study therefore suggests the potential of lymphoid tissues to induce sequestration of circulating cells as well as the role played by RANTES in leukocyte trafficking during acute SIV infection. The close link reported between RANTES mRNA expression and increased CD81 T cell percentages in BALMC suggests that CD81 lymphocytes are the main source of this chemokine in BALMC (Conlon et al., 1995). However, several other cells including CD41 T cells and macrophages are also able to produce this chemokine (Moriuchi et al., 1997b). In this work, we also reported a close in vivo relationship between IFN-g and RANTES mRNA expression. This association agrees fully with other studies showing the induction of RANTES by IFN-g (Chensue et al., 1997; Marfaing-Koka et al., 1995; Matsukura et al., 1998); however, we are aware that several other factors may be involved (Moriuchi et al., 1997b). RANTES and IFN-g concomitant overexpressions argue in favor of the role of RANTES in the early immune control of SIV/HIV infection. During the first days of SIV infection, RANTES may contribute to the local proliferation and activation of T cells, favoring therefore the cytotoxic antiviral response (Dairaghi et al., 1998; Hadida et al., 1998; Taub et al., 1996). In addition, in vitro, RANTES is consistently the most effective HIV and SIV suppressor (Cocchi et al.,
1995; Wang et al., 1998) and has been described to inhibit HIV-1 replication in human alveolar macrophages (Coffey et al., 1997) and in monocyte-derived macrophages (Verani et al., 1997; Wagner et al., 1998). Therefore, the increased expression of RANTES mRNA after the peak of high virus load may suggest the contribution of an early inhibition of HIV/SIV replication in tissues by this chemokine to the multifactorial control of the overall viral burden assessed by plasma viral RNA (Lifson et al., 1997). Our present experiment provides evidence that RANTES and CCR5 responses are included in the broad immune activation and the inflammatory state of SIV/HIV primary infection. The RANTES and CCR mRNA overexpressions that we detected highlight the plurality of chemokines and their cellular receptor biological effects with regard to their implication in viral dissemination and the development of an efficient antiviral immune response during primary infection (Bonecchi et al., 1998; Rottman et al., 1997). Therapy based on a derivative of RANTES lacking proinflammatory properties as well as blocking cell surface CCR5 expression during the first days of HIV infection has been proposed (ArenzanaSeisdedos et al., 1996; Simmons et al., 1997; Yang et al., 1997). Our results underscore the fact that chemokines and their receptors operate as part of a delicately balanced network of cytokines and other inflammatory and immune mediators: interfering with their functions in vivo needs further investigation. MATERIALS AND METHODS Animals and virus Four female cynomolgus monkeys (Macaca fascicularis), weighing 2.5 to 3.5 kg, were imported from Mauritius Island for this study. Animals were housed in single cages within Level 3 biosafety facilities in accordance with EC guidelines for primate experiments (“Journal Officiel des Communaute´s Europe´ennes”, L358, december 18, 1986). During handling, the monkeys were always anesthetized with ketamine (Imalge`ne, Rhoˆne-Me´rieux, France). A cell-free pathogenic SIVmac251 stock for in vivo experiments was kindly provided by Dr. A. M. Aubertin (Laboratoire de Virologie, Universite´ Louis Pasteur, Strasbourg, France). Virions were obtained from a cellfree supernatant of infected rhesus PBMC. These cells were infected in vitro with a culture supernatant obtained from a coculture of rhesus PBMC and a spleen homogenate from a rhesus macaque infected with SIVmac251 (provided by Dr. R. C. Desrosiers, New England Regional Primate Center, Southborough, MA). Monkeys were inoculated in the saphenous vein with 4 AID50 (50% animal infectious dose). SIVmac251 is a well-known macrophage tropic strain (Ringler et al., 1989). We have verified the ability of our primary isolate to replicate in simian
RANTES AND CCR5 EXPRESSION DURING ACUTE SIV INFECTION
peripheral monocytes/macrophages as well as alveolar macrophages (unpublished data). Blood, lymph node, and bronchoalveolar lavage sample collection Blood samples were collected for hematological, virological, and immunological analyses at 2- to 3-day intervals. Peripheral lymph nodes (axillary or inguinal) were removed before the experimental inoculation (day 0) and at 7, 14, and 35 days p.i. PBMC and LNMC were separated by standard density gradient centrifugation (MSL, Eurobio, Les Ulis, France). BAL was performed after local anesthesia with lignocaine (Xylovet, Sanofi, France). Lavages were performed by instilling four to five aliquots of 20 ml of warm 0.9% sterile saline solution through an endotracheal tube. The BAL fluids were collected by immediate gentle aspiration after each aliquot and pooled in a sterile heparinate lithium container. Five bronchoalveolar lavages were performed at weekly intervals before SIV inoculation. After SIV inoculation, lavages were done on days 7, 14, 17, 21, 28, and 35 p.i. BAL samples were centrifuged at 350 g for 10 min. The cells were washed with phosphate-buffered saline (PBS) and mononuclear cells were separated by standard density gradient centrifugation. Detection of circulating virions SIV RNA levels in plasma samples were measured by using the Chiron branched-DNA assay (Chiron Reference Testing Laboratory, Amsterdam, The Netherlands). Detection of blood infectious cells The assay for detection of infectious cells in blood was performed using isolated PBMC separated by a Ficoll gradient as described previously (Che´ret et al., 1996). Threefold dilutions of 150,000 monkey cells were cocultivated for 14 days in triplicate in 96-well flat-bottomed microplates with 125,000 CEMX174 cells. Detection of anti-SIV IgG in plasma by ELISA Anti-SIV plasma reactivity was determined as previously described (Che´ret et al., 1996), using an HIV-2 antigen detection assay (Elavia II kit; Sanofi Diagnostics Pasteur, Marnes-la-Coquette, France). T lymphocyte subset determination PBMC, LNMC, and BALMC were analyzed by flow cytometry using a direct immunofluorescence assay to determine the percentages of CD41 and CD81 lymphocytes. Three hundred thousand cells were maintained at 4°C for 30 min with anti-CD4 monoclonal antibody (CD4 leu-3a PE, Becton Dickinson, Mountain View, CA) plus anti-CD8 monoclonal antibody (CD8 leu-2a FITC, Becton Dickinson) in the same sample or irrelevant isotype-
291
matched control antibodies (IgG1-FITC, IgG1-PE Immunotech, Marseille, France). Cells were then washed two times with 2 ml of 3% fetal calf serum in PBS and fixed in formaldehyde (CellFIX, Becton Dickinson). The frequency of each cell subset was calculated using CellQuest software (Becton Dickinson) on a FACScan cytometer (Becton Dickinson). RT-PCR The RT-PCR assay was performed as previously described (Benveniste et al., 1996) using 2 3 106 fresh isolated monkey PBMC, LNMC, or BALMC. Briefly, cell pellets were homogenized with 300 ml RNAble (Eurobio, Les Ulis, France) in a 1.5-ml microfuge tube. Thirty microliters of chloroform was then added. After vigorous vortexing, the mixture was centrifuged and the aqueous phase transferred to another microfuge tube containing 3 mg yeast tRNA (as a carrier) and an equal volume of isopropanol. RNA was recovered by 3 h of precipitation at 220°C and then washed in 70% ethanol. After 1 h of treatment at room temperature with 10 U RNase-free DNase (Boehringer GmbH, Mannheim, Germany) in 20 ml buffer containing recombinant RNase inhibitor (Clonetech, Palo Alto, CA), RNA was subjected to another phenol extraction (Aqua phenol, Appligene, Illkirch, France). After vigorous vortexing, the mixture was centrifuged and the aqueous phase transferred to a microfuge tube containing yeast tRNA and an equal volume of isopropanol. RNA was recovered by overnight precipitation at 4°C and then washed in 70% ethanol. Total RNA was subjected to first-strand cDNA synthesis for 1 h at 42°C in a 30-ml reaction volume containing 0.25 M Tris–HCl, pH 8.3, 0.375 M KCl, 15 mM MgCl2, 30 U recombinant RNase inhibitor (Clontech), a 30 mM concentration of each dNTP, 0.3 mg of oligo(dT)12-18 (Sigma, St. Louis, MO), and 150 U Moloney murine leukemia virus reverse transcriptase (Gibco BRL, Grand Island, NY). After completion of first-strand synthesis, the reaction mixture was diluted with distilled water. Five microliters of this dilution was used for each PCR. The PCR mixture (in a volume of 50 ml) contained 10 mM of each dNTP, 100 ng of each specific primer, buffer as supplied by the manufacturer, and 0.5 U Taq polymerase (Appligene, Illkirch, France). Primer sequences of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), IFN-g, RANTES, CCR1, and CCR5 were GAPDH-59, ACCACCATGGAGAAGGCTGG; GAPDH-39, CTCAGTGTAGCCCAGGATGC, IFN-g-59, ATGAAATATACAAGTTATATCTTGGCT, IFN-g-39, GGAATTCACTGGGATGCTCTTCGACCTCGA; RANTES-59, TCATTGCTACTGCCCTCTGC; RANTES-39, CGTCGTGGTCAGAATCTGGG; CCR1-59, GCGGATCCCAAAGTCCCTTGGAACCAGAG; CCR1-39, GGTCTAGACAGGCCACCATTACATTCCCT; CCR5-59, CCTGGCTGTCGTCCATGCTG; CCR5-39, CTGATCTAGAGCCATGTGCACAACTCT. PCRs were performed in a Crocodile II thermocycler (Appligene, Illkirch, France) with denatur-
CHE´RET ET AL.
292
ation at 94°C for 45 s; primer annealing at 58°C for 1 min for RANTES, 60°C for 2 min for GAPDH and IFN-g, 62°C for 2 min for CCR1 and CCR5; and extension at 72°C for 1 min. GAPDH was amplified for 28 cycles, RANTES and CCR1 for 38 cycles, CCR5 for 40 cycles, and IFN-g for 42 cycles. Eight microliters of amplification mixtures was electrophoresed on a 1.5% agarose gel and PCR products were detected by ethidium bromide staining. The signal was quantified using N.I.H. 1.52. (Wayne Rasband software). Results were expressed as the ratio of the signal obtained from each cytokine, chemokine, or receptor mRNA to the signal obtained from GAPDH mRNA. Statistical analysis The Wilcoxon rank test was used to evaluate the statistical significance of circulating CD81 and CD41 cell decreases on day 14 p.i. Absolute numbers of circulating CD41 and CD81 T cells on day 14 p.i. were compared to four preinoculation values (Statview; Abacus Concept, Berkeley, CA). The Wilcoxon rank test was used to evaluate the statistical significance of the cytokine, chemokine, or receptor mRNA/GAPDH mRNA ratio in PBMC or BALMC on days 7, 14, 17, 21, 28, and 35 p.i. compared to five preinoculation values (compared to two values for the PBMC ratio of monkey J418) (Statview; Abacus Concept). ACKNOWLEDGMENTS We thank D. Renault, P. Pochard, J. C. Wilk, and R. Rioux for technical assistance. This work was supported by the Agence Nationale de Recherches sur le SIDA (ANRS, Paris, France), the Association Ensemble contre le SIDA (Paris, France), the Centre de Recherches du Service de Sante´ des Arme´es (CRSSA, La Tronche, France), the Association pour la Recherche en Neurovirologie (ARN, Griselles, France), and the Commissariat a` l’Energie Atomique (CEA, Fontenay aux Roses, France).
REFERENCES Arenzana-Seisdedos, F., Virelizier, J. L., Rousset, D., Clark-Lewis, I., Loestscher, P., Moser, B., and Baggiolini, M. (1996). HIV blocked by chemokine antagonist. Nature 383, 400. Baggiolini, M., Dewald, B., and Moser, B. (1997). Human chemokines: An update. Annu. Rev. Immunol. 15, 675–705. Benveniste, O., Vaslin, B., Le Grand, R., Che´ret, A., Matheux, F., The´odoro, F., Cranage, M. P., and Dormont, D. (1996). Comparative interleukin (IL)-2/interferon (IFN)-g and IL-4/IL-10 responses during acute infection of macaques inoculated with attenuated nef-truncated or pathogenic SIVmac251 virus. Proc. Natl. Acad. Sci. USA 93, 3658–3663. Berger, E. A., Doms, R. W., Fenyo¨, E. M., Korber, B. T. M., Littman, D. R., Moore, J. P., Sattentau, Q. J., Schuitemaker, H., Sodroski, J., and Weiss, R. A. (1998). A new classification for HIV-1. Nature 391, 240. Birdsall, H. H., Trial, J. A., Lin, H. J., Green, D. M., Sorrentino, G. W., Siwak, E. B., De Jong, A. L., and Rossen, R. D. (1997). Transendothelial migration of lymphocytes from HIV-1-infected donors: A mechanism for extravascular dissemination of HIV-1. J. Immunol. 158, 5968– 5977. Bleul, C. C., Wu, L., Hoxie, J. A., Springer, T. A., and Mackay, C. R. (1997). The HIV coreceptors CXCR4 and CCR5 are differentially expressed
and regulated on human T lymphocytes. Proc. Natl. Acad. Sci. USA 94, 1925–1930. Bonecchi, R., Bianchi, G., Panina Bordignon, P., D’Ambrosio, D., Lang, R., Borsatti, A., Sozzani, S., Allavena, P., Gray, P. A., Mantovani, A., and Sinigaglia, F. (1998). Differential expression of chemokine receptors and chemotactic responsiveness of type 1 T helper cells (Th1s) and Th2s. J. Exp. Med. 187, 129–134. Chen, Z., Zhou, P., Ho, D. D., Landau, N. R., and Marx, P. A. (1997). Genetically divergent strains of simian immunodeficiency virus use CCR5 as a coreceptor for entry. J. Virol. 71, 2705–2714. Chensue, S. W., Warmington, K., Ruth, J. H., Lukacs, N., and Kunkel, S. L. (1997). Mycobacterial and schistosomal antigen-elicited granuloma formation in IFN-g and IL-4 knockout mice: Analysis of local and regional cytokine and chemokine network. J. Immunol. 159, 3565– 3573. Che´ret, A., Caufour, P., Le Grand, R., The´odoro, F., Boussin, F., Vaslin, B., and Dormont, D. (1997). Macrophage inflammatory protein-1a mRNA expression in mononuclear cells from different tissues during acute simian immunodeficiency virus strain mac251 infection of macaques. AIDS 11, 257–258. Che´ret, A., Le Grand, R., Caufour, P., Dereuddre-Bosquet, N., Matheux, F., Neildez, O., The´odoro, F., Maestrali, N., Benveniste, O., Vaslin, B., and Dormont, D. (1996). Cytokine mRNA expression in mononuclear cells from different tissues during acute SIVmac251 infection of macaques. AIDS Res. Hum. Retroviruses 12, 1263–1272. Cocchi, F., DeVico, A. L., Garzino-Demo, A., Arya, S. K., Gallo, R. C., and Lusso, P. (1995). Identification of RANTES, MIP-1a, and MIP-1b as the major HIV-suppressive factors produced by CD81 T cells. Science 270, 1811–1815. Coffey, M. J., Woffendin, C., Phare, S. M., Strieter, R. M., and Markovitz, D. M. (1997). RANTES inhibits HIV-1 replication in human peripheral blood monocytes and alveoar macrophages. Am. J. Physiol. 272, L1025–L1029. Conlon, K., Lloyd, A., Chattopadhyay, U., Lukacs, N., Kunkel, S., Schall, T., Taub, D., Morimoto, C., Osborne, J., Oppenheim, J., Young, H., Kelvin, D., and Ortaldo, J. (1995). CD81 and CD45RA1 human peripheral blood lymphocytes are potent sources of macrophage inflammatory protein 1a, interleukin-8 and RANTES. Eur. J. Immunol. 25, 751–756. Cossarizza, A., Ortolani, C., Mussini, C., Borghi, V., Guaraldi, G., Mongiardo, N., Bellesia, E., Franceshini, M. G., De Rienzo, B., and Franceschi, C. (1995). Massive activation of immune cells with an intact T cell repertoire in acute human immunodeficiency virus syndrome. J. Infect. Dis. 172, 105–112. Daar, E. S., Moudgil, T., Meyer, R. D., and Ho, D. D. (1991). Transient high levels of viremia in patients with primary human immunodeficiency type 1 infection. N. Engl. J. Med. 324, 961–964. Dairaghi, D. J., Soo, K. S., Oldham, E. R., Premack, B. A., Kitamura, T., Bacon, K. B., and Schall, T. J. (1998). RANTES-induced T cell activation correlates with CD3 expression. J. Immunol. 160, 426–433. Daniel, M. D., Letvin, N. L., King, N. W., Kannagi, M., Sehgal, P. K., Kanki, P. K., Essex, M., and Desrosiers, R. C. (1985). Isolation of a T-cell tropic HTLV-III-like retrovirus from macaques. Science 228, 1200– 1204. Desrosiers, R. C. (1990). The simian immunodeficiency viruses. Annu. Rev. Immunol. 8, 557–578. Doms, R. W., and Peiper, S. C. (1997). Unwelcomed guests with master keys: How HIV uses chemokine receptors for cellular entry. Virology 235, 179–190. Hadida, F., Vieillard, V., Autran, B., Clark-Lewis, I., Bagglioni, M., and Debre´, P. (1998). HIV-specific T cell cytotoxicity mediated by RANTES via the chemokine receptor CCR3. J. Exp. Med. 188, 609–614. Hoffman, T. L., and Doms, R. W. (1998). Chemokines and receptors in HIV/SIV–host interactions. AIDS 12, S17–S26. Gerard, C., Frossart, J. L., Bhatia, M., Saluja, A., Gerard, N. P., Lu, B., and Steer, M. (1997). Targeted disruption of the b-chemokine receptor
RANTES AND CCR5 EXPRESSION DURING ACUTE SIV INFECTION CCR1 protects against pancreatitis-associated lung injury. J. Clin. Invest. 100, 2022–2027. Lifson, J. D., Nowak, M. A., Goldstein, S., Rossio, J. L., Kinter, A., Vasquez, G., Wiltrout, T. A., Brown, C., Schneider, D., Wahl, L., Lloyd, A. L., Williams, J., Elkins, W. R., Fauci, A. S., and Hirsch, V. M. (1997). The extend of early viral replication is a critical determinant of the natural history of simian immunodeficiency virus infection. J. Virol. 71, 9508–9514. Loetscher, P., Seitz, M., Baggiolini, M., and Moser, B. (1996). Interleukin-2 regulates CC chemokine receptor expression and chemotactic responsiveness in T lymphocytes. J. Exp. Med. 184, 569–577. Luster, A. D. (1998). Chemokines—Chemotactic cytokines that mediate inflammation. N. Engl. J. Med. 338, 436–445. Marcon, L., Choe, H., Martin, K. A., Farzan, M., Ponath, P. D., Wu, L., Newman, W., Gerard, N., Gerard, C., and Sodroski, J. (1997). Utilization of C-C chemokine receptor 5 by the envelope glycoproteins of a pathogenic simian immunodeficiency virus, SIVmac239. J. Virol. 71, 2522–2527. Marfaing-Koka, A., Devergne, O., Gorgone, G., Portier, A., Schall, T. J., Galanaud, P., and Emilie, D. (1995). Regulation of the production of the RANTES chemokine by endothelial cells: Synergistic induction by IFN-g plus TNF-a and inhibition by IL-4 and IL-13. J. Immunol. 154, 1870–1878. Matsukura, S., Kokubu, F., Tomita, T., Tokunaga, H., Kadokura, M., Yamamoto, T., Kuroiwa, Y., Ohno, T., Suzaki, H., and Adachi, M. (1998). Expression of RANTES by normal airway epithelial cells after influenza virus A infection. Am. J. Respir. Cell Mol. Biol. 18, 255–264. Moriuchi, H., Moriuchi, M., and Fauci, A. S. (1997a). Cloning and analysis of the promoter region of CCR5, a coreceptor for HIV-1 entry. J. Immunol. 159, 5441–5449. Moriuchi, H., Moriuchi, M., and Fauci, A. S. (1997b). Nuclear factor-kB potently up-regulates the promoter activity of RANTES, a chemokine that blocks HIV infection. J. Immunol. 158, 3483–3491. Murphy, W. J., Taub, D. D., Anver, M., Conlon, K., Oppenheim, J. J., Kelvin, D. J., and Longo, D. L. (1994). Human RANTES induces the migration of human T lymphocytes into peripheral tissues of mice with severe combined immune deficiency. Eur. J. Immunol. 94, 1823–1827. Ostrowski, M. A., Justement, S. J., Catanzaro, A., Hallahan, C. A., Ehler, L. A., Mizell, S. B., Kumar, P. N., Mican, J. A., Chun, T. W., and Fauci, A. S. (1998). Expression of chemokine receptors CXCR4 and CCR5 in HIV-1-infected and uninfected individuals. J. Immunol. 161, 3195– 3201. Qin, S., Rottman, J. B., Myers, P., Kassam, M., Weinblatt, M., Loetscher, M., Koch, A. E., Moser, B., and Mackay, C. R. (1998). The chemokine receptors CXCR3 and CCR5 mark subsets of T cells associated with certain inflammatory reactions. J. Clin. Invest. 101, 746–754. Reimann, K. A., Tenner-Racz, K., Racz, P., Montefiori, D. C., Yasutomi, Y., Lin, W., Ransil, B. J., and Letvin, N. L. (1994). Immunopathogenic events in acute infection of rhesus monkeys with simian immunodeficiency virus of macaques. J. Virol. 68(4), 2362–2370. Ringler, D. J., Wyand, M. S., Walsh, D. G., MacKey, J. J., Sehgal, P. K., Daniel, M. D., Desrosiers, R. C., and King, N. W. (1989). The productive infection of alveolar macrophages by simian immunodeficiency virus. J. Med. Primatol. 18, 217–226. Rosenberg, Y. J., Cafaro, A., Brennan, T., Greenhouse, J. G., Villinger, F., Ansari, A. A., Brown, C., McKinnon, K., Bellah, S., Yalley-Ogunro, J., Elkins, W. R., Gartner, S., and Lewis, M. G. (1997). Virus-induced cytokines regulate circulating lymphocyte levels during primary SIV infections. Int. Immunol. 9, 703–712.
293
Rottman, J. B., Ganley, K. P., Williams, K., Wu, L., Mackay, C. R., and Ringler, D. J. (1997). Cellular localization of the chemokine receptor CCR5: Correlation to cellular targets of HIV-1 infection. Am. J. Pathol. 151, 1341–1351. Schall, T. J., Bacon, K., Toy, K. J., and Goeddel, D. V. (1990). Selective attraction of monocytes and T lymphocytes of the memory phenotype by cytokine RANTES. Nature 347, 669–671. Simmons, G., Clapham, P. R., Picard, L., Offord, R. E., Rosenkilde, M. M., Schwartz, T. W., Buser, R., Wells, T. N. C., and Proudfoot, A. E. I. (1997). Potent inhibition of HIV-1 infectivity in macrophages and lymphocytes by a novel CCR5 antagonist. Science 276, 276–279. Su, S. B., Mukaida, N., Wang, J. B., Nomura, H., and Matsushima, K. (1996). Preparation of specific polyclonal antibodies to a C-C chemokine receptor, CCR1, and determination of CCR1 expression on various type of leukocytes. J. Leukocyte Biol. 60, 658–666. Taub, D. D., Ortaldo, J. R., Turcovski-Corrales, S. M., Key, M. L., Longo, D. L., and Murphy, W. J. (1996). b chemokines costimulate lymphocyte cytolysis, proliferation, and lymphokine production. J. Leukocyte Biol. 59, 81–89. Verani, A., Scarlatti, G., Comar, M., Tresoldi, E., Polo, S., Giacca, M., Lusso, P., Siccardi, A. G., and Vercelli, D. (1997). C-C chemokines released by lipopolysaccharide (LPS)-stimulated human macrophages suppress HIV-1 infection in both macrophages and T cells. J. Exp. Med. 185, 805–816. Wagner, L., O Yang, O., Garcia-Zepeda, E. A., Ge, Y., Kalams, S. A., Walker, B. D., Pasternack, M. S., and Luster, A. D. (1998). b-Chemokines are released from HIV-1-specific cytolytic T-cell granules complexed to proteoglycans. Nature 391, 908–911. Wang, Y., Tao, L., Mitchell, E., Bogers, W. M. J. M., Doyle, C., Bravery, C., Bergmeier, L. A., Kelly, C. G., Heeney, J. L., and Lehner, T. (1998). Generation of CD8 suppressor factor and b chemokines, induced by xenogeneic immunization, in the prevention of simian immunodeficiency virus infection in macaques. Proc. Natl. Acad. Sci. USA 95, 5223–5228. Weissman, D., Rabin, R. L., Arthos, J., Rubbert, A., Dybul, M., Swofford, R., Venkatesan, S., Farber, J. M., and Fauci, A. S. (1997). Macrophagetropic HIV and SIV envelope proteins induce a signal through the CCR5 chemokine receptor. Nature 389, 981–985. Wu, L., LaRosa, G., Kassam, N., Gordon, C. J., Heath, H., Ruffing, N., Chen, H., Humblias, J., Samson, M., Parmentier, M., Moore, J. P., and Mackay, C. R. (1997a). Interaction of chemokine receptor CCR5 with its ligands: Multiple domains for HIV-1 gp120 binding and a single domain for chemokine binding. J. Exp. Med. 186, 1373–1381. Wu, L., Paxton, W. A., Kassam, N., Ruffing, N., Rottman, J. B., Sullivan, N., Choe, H., Sodrosky, J., Newman, W., Koup, R. A., and Mackay, C. R. (1997b). CCR5 levels and expression pattern correlate with infectability by macrophage-tropic HIV-1, in vitro. J. Exp. Med. 185, 1681– 1691. Yang, A. G., Bai, X., Huang, X. F., Yao, C., and Chen, S. Y. (1997). Phenotypic knockout of HIV type 1 chemokine coreceptor CCR-5 by intrakines as potential therapeutic approach for HIV-1 infection. Proc. Natl. Acad. Sci. USA 94, 11567–11572. Zou, W., Lackner, A. A., Simon, M., Durand-Gasselin, I., Galanaud, P., Desrosiers, R. C., and Emilie, D. (1997). Early cytokine and chemokine gene expression in lymph nodes of macaques infected with simian immunodeficiency virus is predictive of disease outcome and vaccine efficacy. J. Virol. 71, 1227–1236.
