Quantification of Epstein-Barr Virus–DNA Load in Lung Transplant Recipients: A Comparison of Plasma versus Whole Blood

CHAPTER

5

Quantification of Epstein-Barr virus-DNA load in lung transplant recipients: a comparison of plasma versus whole blood

NA Bakker1 EAM Verschuuren2 NJGM Veeger3 W van der Bij2 GW van Imhoff1 CGM Kallenberg4 BG Hepkema5

Department of Haematology1, Pulmonary Diseases2, Epidemiology3, Clinical Immunology4 Pathology and Laboratory Medicine5, University Medical Centre Groningen, University of Groningen, The Netherlands

Submitted

ABSTRACT Background: Monitoring of EBV-DNA load is frequently applied for the identification of patients at risk for posttransplant lymphoproliferative disease (PTLD). EBV-DNA can be measured in different compartments; plasma and whole blood. Which of these compartments is preferable to determine EBV-DNA load is still a matter of debate. Methods: We compared levels of EBV-DNA in whole blood and plasma using a real time TaqMan PCR assay in 100 consecutive paired whole blood and plasma samples from 25 lung and heart-lung transplant recipients with detectable whole blood EBVDNA load (> 2.000 copies/ml). Results: A correlation (r squared) of 0.58 (P < 0.001) was observed between both measurements. Of all positive whole blood samples (>2.000 copies/ml), only 17 samples (18%) were also positive in plasma. Conclusions: These results indicate that whole blood, by virtue of its sensitivity, rather than plasma may be the preferable specimen for the detection of EBV-DNA in lung transplant recipients.

76

Post-transplant lymphoproliferative disease (PTLD) encompasses a heterogeneous group of diseases, ranging from Epstein-Barr virus (EBV) driven polyclonal proliferation resembling infectious mononucleosis to monomorphic proliferations which may be indistinguishable from aggressive types of lymphoma such as diffuse large B-cell lymphoma. Generally, PTLD is considered an iatrogenic complication of immunosuppression after transplantation, leading to a decrease in EBV specific Tcells, which, in turn, may lead to uncontrolled proliferation of EBV infected B-cells. Incidence varies significantly between different types of organ transplants, with the highest incidences (5-20%) found after lung and small bowel transplantation. Monitoring of Epstein-Barr virus (EBV)-DNA load in transplant recipients by quantitative PCR (qPCR) is frequently applied for the identification of patients at risk for PTLD1-3. Over the last years, attention has been focused on these PCR-based approaches for early (i.e., prior to clinical presentation) diagnosis of PTLD. In addition, pre-emptive reduction of immunosuppression based on EBV-DNA load has been shown to lead to a decrease in PTLD incidence in paediatric liver transplant recipients4. EBV-DNA can be measured in plasma, peripheral blood mononuclear cells (PBMCs) and whole blood. It has already been shown that there is a strong correlation between the EBV-DNA load measured in whole blood by TaqMan PCR and in PBMCs by competitive (c)PCR, indicating that the former method appears to be an acceptable alternative to the latter5. This is important, because qPCR is less time consuming than cPCR, thereby allowing a more rapid clinical decision based on EBVDNA load measurements. The correlation between EBV-DNA load as measured in plasma or whole blood is not clear yet. Both methods are frequently applied and no consensus has been reached which compartment is preferable to determine EBVDNA load6-8. A study by Wadowsky et al. showed a correlation of 0.71 between both measurements in 59 tested samples from 44 paediatric transplant recipients9. One could argue that there is an underestimation of EBV-DNA load in plasma as whole blood contains all EBV-DNA (i.e., cell free and cell associated), whereas plasma contains only cell free virus. As data are far from conclusive, our aim was to compare the capacity of both measurements to detect EBV-DNA. METHODS Samples Between January 2004 and May 2005, we prospectively collected all plasma samples from lung and heart-lung transplant recipients with detectable whole blood EBV-DNA loads (> 2000 copies/ml). A total of one hundred consecutive plasma samples (stored at −80°C until testing) from 25 lung and heart-lung transplant recipients was collected and available for testing. Six plasma samples were excluded from analysis because of haemolysis.

77

5 EBV-DNA load in plasma and whole blood

INTRODUCTION

DNA purification and PCR assay The BioRobot EZ1 Robotic workstation was used for automated DNA purification (The EZ1 Virus Card for plasma, the EZ1 DNA Blood Card for whole blood). DNA was extracted from 200-μl portions of plasma and whole blood, and eluted in 100μl and 200μl of buffer AE, respectively. For the TaqMan PCR assay a primer-probe set for EBNA-1 was used; the nucleotide sequences (5′→3′) were as follows: upstream primer, CCGGTGTGTTCGTATATGG; downstream primer, AAAGGGGAGACGACTCAATG; and minor groove binding (MGB) probe, CTATTCCACAATGTCGTCTTA, designed with Primer express software version 1.5 (PE Biosystems, Nieuwerkerk aan de IJssel, The Netherlands). For the PCR, the ABI prism 7900 HT-RealTime-PCR system (384 wells) was used. Samples of 10 μl plasma and whole blood were used as input in the PCR, while 10 μl of exogenous internal positive control mix (Applied Biosystems, California, US ) was used as a template to identify possible inhibition of the PCR. The concentration of EBV-DNA was determined from a reference standard quantified by electron microscopy (ABI Advanced Biotechnologies Incorporated, Columbia, US). The viral load in plasma as well as in whole blood was expressed as the number of copies per millilitre. Each sample was tested in fourfold and EBV DNA load was expressed as the mean of these four samples. The lower detection limit of our assay was a cycle threshold of around 35, which corresponds to 2.000 copies/ml in whole blood and, because of a concentration step, 1.000 copies/ml in plasma. Plasma EBV-DNA load levels below this lower limit of detection were coded as 1.000 copies/ml in order to compare plasma levels with whole blood levels. RESULTS Patients and samples Patient characteristics and results of EBV-DNA load measurements are shown in table 1. Median number of EBV-DNA load measurements in the 25 lung transplant patients was 4 (range 1-8). Five patients were EBV seronegative prior to transplantation. Of all positive samples in whole blood, only 17 samples (18 %) were detectable when measured in plasma. Of the first positive samples in whole blood obtained from these 25 patients, only 4 (16 %) samples were detected in plasma. These positive samples measured in plasma included the two highest EBV-DNA load values measured in whole blood (patient 7&11). Correlation between plasma and whole blood levels None of the samples inhibited the amplification of the internal positive control in the TaqMan PCR assay. When analysing all samples together, a correlation of 0.58 (p < 0.001) was observed (figure 1). When comparing the correlation between values positive in whole blood as well as in plasma (>1000 copies/ml), a correlation of 0.49 (p < 0.001) was observed (figure 2). 78

1

female female female male female male male male female male male female female male male female male male female male male male female female female

At Tx2 36 20 43 23 56 54 13 35 39 27 8 23 33 53 56 55 57 22 57 59 43 9 49 52 62

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25

Uni vs bilateral bil bil bil bil uni uni bil bil uni bil bil bil bil uni bil bil uni bil bil bil bil bil bil uni bil

Type of Tx

5 2 1 2 3 7 5 2 6 4 5 3 3 2 3 5 1 3 5 4 4 8 5 4 2

Number of measurements WB3 5 2 11 5 4 13 98 14 9 3 92 3 4 3 6 4 2 3 8 5 4 2 5 8 13

P4 0 0 0 0 0 5 11 0 0 0 16 0 0 0 0 0 0 2 0 0 0 0 0 0 0

First measurement

EBV-DNA load in plasma and whole blood

Pre-transplant pos pos pos pos pos pos neg neg pos pos neg neg pos pos pos pos pos pos pos pos pos neg pos pos pos

EBV status recipient

x1000 copies/ml, 2transplantation, 3whole blood, 4plasma

Gender

Age

Patient

Table 1 Patient characteristics and EBV measurements1

WB 5 3 11 5 10 22 98 14 17 5 1800 8 4 3 6 8 2 7 67 5 4 75 5 8 54

P 0 0 0 0 0 5 11 0 2 1 58 0 0 0 0 0 0 2 3 0 0 11 0 0 17

Highest level

5

79

Figure 1 Correlation of EBV-DNA load in plasma and whole blood samples (n=94 pairs) measured by TaqMan PCR. Plasma EBV-DNA load levels below the lower limit of detection (1000 copies/ml) were coded as 1.000 copies/ml.

Figure 2 Correlation of EBV-DNA load in plasma and whole blood of all samples tested positive in whole blood as well as in plasma (n=17).

DISCUSSION This study aimed to compare EBV-DNA load measured in whole blood with that in plasma. Only 17% percent of all positive samples in whole blood were detectable in plasma, while the correlation of 0.58 between both measurements was even lower 80

81

5 EBV-DNA load in plasma and whole blood

than reported by Wadowsky et al.9. Taken into account the lower detection limit of our assay (>1000 copies/ml and > 2000 copies/ml in plasma and whole blood, respectively) we can, however, not exclude that with the use of a more sensitive detection assay (e.g. reliable detection of >50 copies/ml) more plasma samples would have been positive. The current literature does not identify which type of specimen is superior for EBV-DNA load monitoring. Some publications suggest the potential utility of plasma specimens to identify the patient at risk for PTLD6;10-12. Our results, however, suggest that it may be advantageous to monitor EBV-DNA load in whole blood rather than in plasma as in the large majority of all samples tested, EBV-DNA load was below cut-off value in plasma. During the period in which we collected whole blood and plasma samples we intervened (tapering of immunosuppression) when patients had two consecutive specimens with elevated EBV-DNA loads with the last measurement exceeding 10.000 copies/ml as measured in whole blood. As this policy led to only one patient (#25) ultimately developing PTLD, it is not possible to assess the positive predictive value of plasma and whole blood samples for the development of PTLD. However, our results indicate that if plasma had been used as the leading specimen for decision making, many patients would have been withholding clinical intervention, which is tapering of immunosuppression. This approach seems useful, because we previously showed that whole blood EBV-DNA load in these lung transplant recipients can be used to both predict and diagnose PTLD, and strongly correlates with changes in the immune status of the patient1. Our observations further indicate that the elevated EBV-DNA load in these patients can be attributed mainly to the cellular compartment of the blood, directly reflecting proliferation of latently infected B cells, with little or no lytic viral replication and associated release of virion DNA. This confirms the results of Stevens et al, who already speculated on the poor diagnostic and predictive values of tests with serum and plasma samples as clinical specimens for the development of PTLD7. There is a limitation to this study relating to the selection of the samples; only samples with positive EBV-DNA load as measured in whole blood were included. Hypothetically, samples negative in whole blood could be positive in plasma. However, given the results of our study, this seems very unlikely as 95% of all positive plasma samples had lower EBV-DNA loads than measured in whole blood. This indicates that even when EBV-DNA load is detectable in plasma, a large discrepancy with respect to quantitative values is present when comparing measurements in whole blood and plasma, indicating that the large majority of all EBV-DNA is still cell-bound during EBV reactivation. Given our results and the considerations mentioned above, we conclude that whole blood rather than plasma is the preferable specimen for the detection of EBVDNA in lung transplant recipients.

References

1.

Stevens SJ, Verschuuren EA, Pronk I, van der Bij W, Harmsen MC, The TH et al. Frequent monitoring of Epstein-Barr virus DNA load in unfractionated whole blood is essential for early detection of posttransplant lymphoproliferative disease in high-risk patients. Blood 2001;97:1165-71.

2.

Riddler SA, Breinig MC, McKnight JL. Increased levels of circulating Epstein-Barr virus (EBV)-infected lymphocytes and decreased EBV nuclear antigen antibody responses are associated with the development of posttransplant lymphoproliferative disease in solidorgan transplant recipients. Blood 1994;84:972-84.

3.

Savoie A, Perpete C, Carpentier L, Joncas J, Alfieri C. Direct correlation between the load of Epstein-Barr virus-infected lymphocytes in the peripheral blood of pediatric transplant patients and risk of lymphoproliferative disease. Blood 1994;83:2715-22.

4.

Lee TC, Savoldo B, Rooney CM, Heslop HE, Gee AP, Caldwell Y et al. Quantitative EBV viral loads and immunosuppression alterations can decrease PTLD incidence in pediatric liver transplant recipients. Am.J.Transplant. 2005;5:2222-8.

5.

Stevens SJ, Verschuuren EA, Verkuujlen SA, Van Den Brule AJ, Meijer CJ, Middeldorp JM. Role of Epstein-Barr virus DNA load monitoring in prevention and early detection of posttransplant lymphoproliferative disease. Leuk.Lymphoma 2002;43:831-40.

6.

Limaye AP, Huang ML, Atienza EE, Ferrenberg JM, Corey L. Detection of Epstein-Barr virus DNA in sera from transplant recipients with lymphoproliferative disorders. J.Clin.Microbiol. 1999;37:1113-6.

7.

Stevens SJ, Pronk I, Middeldorp JM. Toward standardization of Epstein-Barr virus DNA load monitoring: unfractionated whole blood as preferred clinical specimen. J.Clin.Microbiol. 2001;39:1211-6.

8.

Fafi-Kremer S, Brengel-Pesce K, Bargues G, Bourgeat MJ, Genoulaz O, Seigneurin JM et al. Assessment of automated DNA extraction coupled with real-time PCR for measuring Epstein-Barr virus load in whole blood, peripheral mononuclear cells and plasma. J.Clin. Virol. 2004;30:157-64.

9.

Wadowsky RM, Laus S, Green M, Webber SA, Rowe D. Measurement of Epstein-Barr virus DNA loads in whole blood and plasma by TaqMan PCR and in peripheral blood lymphocytes by competitive PCR. J.Clin.Microbiol. 2003;41:5245-9.

10.

Wagner HJ, Wessel M, Jabs W, Smets F, Fischer L, Offner G et al. Patients at risk for development of posttransplant lymphoproliferative disorder: plasma versus peripheral blood mononuclear cells as material for quantification of Epstein-Barr viral load by using real-time quantitative polymerase chain reaction. Transplantation 2001;72:1012-9.

11.

Baldanti F, Grossi P, Furione M, Simoncini L, Sarasini A, Comoli P et al. High levels of EpsteinBarr virus DNA in blood of solid-organ transplant recipients and their value in predicting posttransplant lymphoproliferative disorders. J.Clin.Microbiol. 2000;38:613-9.

12.

Gridelli B, Spada M, Riva S, Colledan M, Segalin A, Lucianetti A et al. Circulating Epstein-Barr virus DNA to monitor lymphoproliferative disease following pediatric liver transplantation. Transpl.Int. 2000;13 Suppl 1:S399-S401.

82

EBV-DNA load in plasma and whole blood

5

83

84