Curr Microbiol DOI 10.1007/s00284-014-0632-6
The DosR Dormancy Regulator of Mycobacterium tuberculosis Stimulates the Na+/K+ and Ca2+ ATPase Activities in Plasma Membrane Vesicles of Mycobacteria Paola A. Pulido • Lorena Novoa-Aponte Nicola´s Villamil • Carlos Y. Soto
•
Received: 14 March 2014 / Accepted: 30 April 2014 Ó Springer Science+Business Media New York 2014
Abstract The latency global regulator DosR regulon of Mycobacterium tuberculosis, which is stimulated by hypoxia, comprises approximately fifty genes including ctpF (Rv1997), which encodes a putative alkali/alkaline earth ion transporter of the plasma membrane. In this work, the influence of hypoxia and M. tuberculosis DosR on the ATPase activity of mycobacterial plasma membrane was assessed. We performed bioinformatic analyses which indicated that the pma1 gene product is the M. smegmatis ortholog of the M. tuberculosis cation transporter CtpF. In addition, a possible Na?, K? and/or Ca2? pumping mediated by Pma1 was also predicted. Enzymatic analyses indicated that the basal ATPase activity of plasma membrane vesicles from M. smegmatis cells cultured under hypoxia and over-expressing DosR, decreased 30 and 40 % respectively in comparison to oxygenated cells. In contrast, the specific Na?/K? and Ca2? ATPase activities of the plasma membrane increased 2.8- and 3.5-fold, respectively, under hypoxia, similar to that observed for cells over-expressing the DosR regulator. In agreement, RT-
Electronic supplementary material The online version of this article (doi:10.1007/s00284-014-0632-6) contains supplementary material, which is available to authorized users. P. A. Pulido L. Novoa-Aponte N. Villamil C. Y. Soto (&) Chemistry Department, Faculty of Sciences, Universidad Nacional de Colombia, Carrera 30 # 45-03, Ciudad Universitaria, Bogota´, Colombia e-mail:
[email protected] Present Address: N. Villamil Departamento de Microbiologia, Instituto de Cieˆncias Biome´dicas, Universidade de Sa˜o Paulo, Av. Prof. Lineu Prestes 1374, Sa˜o Paulo, SP CEP 05508-900, Brazil
qPCR experiments demonstrated that the transcription level of the pma1 gene increased under hypoxia at levels similar to that of M. smegmatis cells over-expressing the M. tuberculosis DosR regulator. The entire findings suggest that hypoxia stimulates Na?/K? and Ca2? ATPase activities in the mycobacterial plasma membrane, and this is possibly mediated by the dormancy regulator DosR.
Introduction Mycobacterium tuberculosis, the etiologic agent of tuberculosis (TB), is one of the most important pathogens worldwide. According to the World Health Organization, 8.7 million new cases and 1.4 million deaths were caused by TB in 2011 [39]. In approximately 90 % of infected individuals, the tubercle bacilli persist in a physiological state known as latency, which is a metabolic state without clinical manifestations of TB. M. tuberculosis that is confined in latent lesions, or granulomas, survives against hostile conditions such as hypoxia, starvation and reactive oxygen and nitrogen species [11, 19]. Nowadays, the identification of new therapeutic targets is essential for the development of novel drugs against latent TB; in this context, antimicrobials targeting proteins belonging to the cell membrane are of special interest because they avoid problems related to permeating the plasma membrane [9, 18, 24, 36]. The global dormancy regulator DosR of mycobacteria is part of an unusual two-component system DosR–DosS– DosT that is conserved in all mycobacterial species, except for M. leprae [13]. This regulatory system is involved in the M. tuberculosis persistence in granulomas [4] and mediates the transcription of genes in response to
123
P. A. Pulido et al.: The DosR Dormancy Regulator
low-oxygen tension to preserve the redox balance and adequate ATP levels [21]. Microarray analyses have suggested that DosR regulates the expression of approximately 50 genes of M. tuberculosis, including ctpF (Rv1997), which encodes a putative alkali/alkaline earth ion transporter of the plasma membrane [3, 27]. The disruption of DosS produced only limited effects on the survival of tubercle bacilli in hypoxic conditions, which suggested the existence of a second paralog histidine kinase, DosT, that complemented the function of DosS [30]. According to different analyses, it was demonstrated that DosT of M. tuberculosis can be functionally substituted for M. smegmatis DosS [15] that allow the functional expression of M. tuberculosis DosR in M. smegmatis cells. Under hypoxic conditions, M. smegmatis DosR–DosS positively regulates a 31-gene cluster that includes msmeg_3926 (pma1), which encodes a putative cation transporter of the plasma membrane [6]. Metal ion transport in bacteria is performed by enzymatic systems that include ATP binding cassettes (ABC transporters), metal ion/H?-antiporters and P-type ATPases, which maintain the cell homeostasis [1]. Particularly, P-type ATPases simultaneously hydrolyse ATP and transport ions across plasma membranes against electrochemical gradients [26]. In silico analyses were recently performed showing that the M. tuberculosis ctpF gene product possesses transmembrane segments and conserved motifs that are common to Na?, K?, Ca2?, H? or Mg2? ATPases [24]. Taking into account that DosR regulates the expression of the ctpF gene in M. tuberculosis cells, a plausible correlation between hypoxia, DosR, and alkali/alkaline earth ion transport in the mycobacterial plasma membrane can be suggested.
Table 1 Bacterial strains, plasmids and primers used for amplification, cloning, over-expression and RT-qPCR analyses of the dosR gene Description
Source
M. tuberculosis H37Rv
Reference virulent strain
ATCC 27294
M. smegmatis mc2155
Efficiently transformable strain
ATCC 700084
E. coli BL21
pET15b compatible expression host
Novagen
Strains
Vectors and plasmids pGEM-T easy vector pMV261
E. coli cloning vector for PCR fragments, Ampr E. coli/mycobacteria shuttle vector, Kmr
Promega
pDosR
dosR gene cloned into pGEM-T easy vector, Ampr
This study
pDosR1
dosR gene cloned into pMV261 vector, Kmr
This study
DosR1
ttgggaagggatcccctggt (BamHI site)
This study
DosR2
cgtgtgctgcagtggacgc (PstI site)
This study
Pma-RT-Dir
ggcggacgacaacttcgcca
This study
Pma-RT Rev
ccacagcacctgtgcgggag
This study
RTsigAdir
cctacgctacgtggtggatt
This study
RTsigArev
tggatttccagcaccttctcc
This study
[34]
Primers (50 -30 )
Restriction enzyme recognition sites are indicated and underlined for each primer
cultured in LB broth or on LB agar plates, was used as the host for plasmids construction. dosR Cloning and Expression
Materials and Methods Bacterial Strains and Growth Conditions The bacterial strains that were used in this work are shown in Table 1. Mycobacteria were grown at 37 °C with agitation (oxygenated cells) in Middlebrook 7H9 supplemented with ADC (Sigma-Aldrich, Switzerland) and glycerol 0.05 % v/v until an OD600 of 0.3 when used for electroporation experiments, and an OD600 of 0.4 was used when extracting the mycobacterial plasma membrane. Hypoxic mycobacterial cultures (10 ml) were grown at 37 °C for 7 days in tightly sealed, screw-cap tubes without agitation, as reported previously [38]. For DosR overexpression in M. smegmatis, mycobacterial cells transformed with the pDosR1 recombinant plasmid were grown under oxygenated conditions at 37 °C with agitation until OD600 of 0.4; then, the cells were subsequently incubated at 45 °C for 30 min. Escherichia coli BL21 (Table 1),
123
Mycobacterium tuberculosis genomic DNA was isolated as reported previously [33]. The dosR gene was amplified from genomic DNA of M. tuberculosis H37Rv using PCR and the DosR1 and DosR2 primers (Table 1), and ligated into the pGEM-T Easy Vector (Promega Corporation, Madison, USA) to obtain pDosR recombinant plasmid. Then, the dosR gene was subcloned into the pMV261 vector [34] to obtain pDosR1 (Table 1). pDosR1 was sequenced and electroporated into M. smegmatis mc2155 cells. Finally, DosR recombinant protein was induced as described previously [42], using M. smegmatis cells transformed with the pMV261 vector as a control. Mycobacterial Plasma Membrane Isolation Mycobacterial plasma membranes were isolated using a previously reported protocol [5] with modifications. In brief, mycobacterial cells were resuspended in MOPS buffer (10 mM MOPS, 1 mM EDTA and 0.3 mM
P. A. Pulido et al.: The DosR Dormancy Regulator
phenylmethylsulfonyl fluoride, pH 7.4) and lysed in a Mini Beadbeater-16 (Biospec, USA) for 8 min. Mycobacterial cell walls were then isolated by centrifugation at 25,0009g for 30 min. The supernatants containing the plasma membranes were centrifuged at 100,0009g for 90 min, and the resulting pellets, which included the plasma membrane fraction, were then frozen at -80 °C in 0.1 ml aliquots of pH 7.4 buffer containing 10 mM MOPS and 248 mM sucrose until further use. The protein concentration was determined using the Bradford-Zor-Selinger method [8] and fraction V of bovine serum albumin as a standard.
qPCR analysis of the pma1 gene using the Express SYBRÒ Green ER TM Universal qPCR Super Mix kit (Invitrogen, USA) and a CFX-96 termocycler (Biorad, USA). For relative quantification, transcription of pma1 was normalised to the mean value of the expression of the sigA gene, using the primers RTsigAdir and RTsigArev (Table 1). Reactions were performed in duplicate in three independent experiments; differences between the experimental data were compared using Student’s t test, and data were accepted as significantly different if P \ 0.05.
Basal and Ion-Specific ATPase Activities of Plasma Membrane Vesicles
Probabilistic profiles based on hidden Markov models (HMM) and representing the sequence conservation of P-type ATPases were used to identify metal cation transporters of the M. smegmatis mc2155 strain. The HMM that were used were constructed as previously reported [24]. To identify a possible ortholog of the CtpF protein in M. smegmatis mc2155, a Blastp analysis was conducted using the M. tuberculosis H37Rv CtpF amino acid sequence as query. The amino acid sequences of the two P-type ATPases under study, M. smegmatis mc2155 Pma1 (A0QZ77) and M. tuberculosis H37Rv CtpF (P63687); the alpha subunits of three Na?/K? ATPases from Sus scrofa (P05024; PDB: 3B8E), Homo sapiens (P05023) and Drosophila melanogaster (P13607); and three Ca2? ATPases from Bos taurus (Q0VCY0; PDB: 3TLM), Rattus norvegicus (P11507-2) and Bacillus subtilis (O34431) were retrieved from the Uniprot database. The transmembrane segments (TMS) of these eight P-type ATPases were aligned using the ClustalW2 tool (Gonnet weight matrix with default options). Amino acids involved in the cation binding sites of Ca2? and Na?/K? ATPases were assigned using information of site-directed mutagenesis studies [2, 10, 16, 22, 25, 28, 41].
The ATPase activity of the plasma membrane vesicles was determined by quantifying the Pi release using the Fiske– Subbarow method [12] according to the recommendations of Kobayashi [17]. Enzymatic reactions (200 ll) were carried out in pH 7.4 incubation buffer (10 mM MOPS, 4 mM MgCl2 and 3 mM EGTA) containing 40 lg/ml of mycobacterial plasma membrane fractions. To estimate the basal ATPase activity, the reactions were initiated by the addition of 3 mM Na2-ATP and stopped after samples were incubated at 37 °C for 30 min by the addition of stop solution containing 2.0 % sulphuric acid, 0.5 % ammonium molybdate, 0.5 % ascorbic acid and 0.5 % SDS. The OD690 nm of samples was measured using an iMarkTM Microplate Absorbance Reader 168-1135 (Bio-Rad, USA). To determine the specific Na?/K? and Ca2? ATPase activities, the reaction buffer was separately supplemented with 20 mM KCl/120 mM NaCl and 30 lM CaCl2. Differences between the ATPase activity that was stimulated by ions and the basal activity corresponded to the specific Na?/K? and Ca2? ATPase activities. To establish the proportion of P-type ATPase activity on plasma membrane vesicles, the enzymatic reactions were separately supplemented with 0.1 mM of the specific inhibitor vanadate. Reactions were assessed in duplicate from three independent experiments, and enzymatic activity was reported as U/mg (lmol of Pi released/mg of protein/min).
Bioinformatic Analyses
Results and Discussion Pma1 Could be the M. smegmatis Ortholog of the M. tuberculosis Alkali/Alkaline Earth Cation Transporter CtpF
RNA Isolation and RT-qPCR Analysis For RNA isolation, M. smegmatis cultures under oxygenated and hypoxic conditions were resuspended with TRIzolÒ (Invitrogen, USA) and broken in a Mini-Bead Beater (BioSpec, USA). RNA was purified with chloroform and isopropanol, and its integrity was evaluated in an agarose gel. cDNA libraries were constructed from 1 lg of RNA that was previously treated with DNase I. The primers Pma-RT-Dir and Pma-RT-Rev (Table 1) were used for RT-
Recent bioinformatic analyses indicated that the M. tuberculosis complex contains 12 P-type ATPases that are involved in ion transport [24]. This unusually high number of transporters suggests that they may play a pivotal role in the ability of tubercle bacilli to survive inside macrophages, where mycobacteria face high levels of toxic metals. According to the HMM analysis that we performed, six proteins that were annotated as A0R277, A0R542, A0R3A7, A0R396, A0R3Y2 and A0QZ77 in the Uniprot
123
P. A. Pulido et al.: The DosR Dormancy Regulator
Fig. 1 Multiple alignments of the transmembrane segments 4–9 of M. smegmatis Pma1, M. tuberculosis CtpF and characterized P-type ATPases (CaBt: Ca2? ATPase of Bos taurus—Q0VCY0; CaBs: Ca2? ATPase of Bacillus subtilis—O34431; CaRn: Ca2? ATPase of Rattus norvegicus—P11507-2; NaKHs: Na?/K? ATPase of Homo sapiens— P05023; NaKDm: Na?/K? ATPase of Drosophila melanogaster— P13607; and NaKSs: Na?/K? ATPase of Sus scrofa—P05024). The
conserved residues of the Na?/K? ATPases are indicated with asterisks; the amino acids that are possibly involved in the coordination of the Ca2? ions in Ca2? ATPases are shown with an inverted filled triangle; and residues that are important for the cation affinity of both, Ca2? ATPases an Na?/K? ATPases are noted with an down arrow
TrEMBL database are transporters of metallic cations in the M. smegmatis mc2155 proteome. The scores that were obtained in the HMM analyses also suggested that A0QZ77 is most likely an alkali/alkaline earth cation transporter in M. smegmatis (Online Resource 1), as reported for CtpF in M. tuberculosis [24]. Additionally, a blastp analysis showed that Pma1 exhibits the highest identity in amino acid sequence with CtpF (47 %). A0QZ77 is encoded by the M. smegmatis msmeg_3926 gene, which was automatically annotated as the cation-transporting ATPase Pma1 due to matching to the protein family PF00122 ([http:// mycobrowser.epfl.ch/smegmalist.html). This Pfam PF00122 family comprises H?-ATPases type PIII, which is found in plants and fungi [26]; however, the HMM analyses indicated that Pma1 is similar to P2C, P2B and P2A P-type ATPases that are Na?/K?, Ca2? plasma membrane (PMCA) and Ca2? sarcoendoplasmic reticulum (SERCA) ATPases, respectively.
embedded in the plasma membrane (Online Resource 2). The conserved motifs for Pma1 and CtpF were highly similar and had the same amino acid sequence in motif 4 (PEGL), which is responsible for the ion specificity of alkali/alkaline earth ion metals (Fig. 1). Contrary to SmegmaList, we found that Pma1 is not similar to H?ATPases. In contrast, this protein is very similar to CtpF, and both of these proteins share amino acids with the Na?/ K? and Ca2? ATPases that are important for the ion transport process (Fig. 1).
Na?/K? and/or Ca2? Pumping is Possibly Mediated by Pma1 in M. smegmatis Cells The hydrophobicity analysis showed that M. smegmatis Pma1 exhibits 10 a-helix type TMS, with its N- and C-termini located on the cytosolic side, which classifies this pump as a P-type ATPase with topology type 2 that is characteristic of alkali/alkaline earth cation transporters [35]. According to the hydrophobicity profiles that were obtained using the TMHMM 2.0 algorithm, Pma1 and CtpF exhibited a similar TMS distribution that contained a highly hydrophobic C-terminal end that was most likely
123
Hypoxia and DosR Stimulate Na?/K? and Ca2? ATPase Activities in the Mycobacterial Plasma Membrane The method that was used for mycobacterial plasma membrane isolation allowed for most of the vesicles to be obtained inside-out, thus exposing the ATP binding sites to the Mg2?-ATP substrate [31]. The basal ATPase activity that was estimated for plasma membrane vesicles of M. smegmatis mc2155 cells that were cultured at oxygenated conditions was 15.25 ± 0.61 U/mg. In contrast, the ATPase activity from cells cultured under hypoxic conditions and over-expressing the M. tuberculosis DosR regulator decreased approximately 30 and 40 % to values of 10.99 ± 0.11 and 6.14 ± 0.32 U/mg, respectively (Fig. 2). In addition, the basal ATPase activity determined in presence of vanadate (10.34 U/mg) indicated that specific P-type ATPase activity of the mycobacterial plasma membranes corresponded to approximately 70 % of the basal ATPase activity. In general, the level of Mg2?
P. A. Pulido et al.: The DosR Dormancy Regulator
Fig. 2 Basal, Na?/K? and Ca2? ATPase activities of the M. smegmatis plasma membrane. The enzymatic activity of plasma membrane vesicles obtained from M. smegmatis cells cultured in oxygenated or hypoxic conditions and over-expressing the M. tuberculosis DosR was measured. The specific ATPase activity was
estimated as the difference between the ATPase activity stimulated by Na?/K? and Ca2? and the basal ATPase activity that was determined under the same experimental conditions. The enzymatic ATPase activity (U/mg) corresponds to lmol of Pi released/mg of protein/min
stimulated ATPase activity determined in plasma membrane is similar to those previously reported in other studies [31, 40]. On the other hand, it has been observed that the transcription level of genes that encode ATPases in M. tuberculosis cells is affected by different intracellular stresses or hypoxic conditions [7, 20, 32]. In this regard, the ATPase activity that is stimulated by Mg2? (basal) in plasma membrane vesicles diminishing approximately 30-40 % in response to hypoxia and DosR over-expression is most likely a consequence of the reduction of mycobacterial metabolism, which generates less efficient biological oxidation when electron acceptors other than oxygen are used [6] and affects ion transport across the plasma membrane. Therefore, the heterologous overexpression of M. tuberculosis DosR in M. smegmatis cells significantly affected the ATPase activity of the plasma membrane of the M. smegmatis cells. Based on the fact that M. tuberculosis DosR possibly regulates the alkali/alkaline earth ion transport of the plasma membrane [3, 27], and the bioinformatic predictions performed in this work, we assessed the specific Na?/K? and Ca2? ATPase activities in plasma membrane vesicles obtained from M. smegmatis mc2155 cells that were cultured under oxygenated conditions, hypoxia and over-expressing the DosR regulator. It was detected that the specific Na?/K? and the Ca2? ATPase activities of the plasma membrane in oxygenated M. smegmatis mc2155 cells were 1.99 ± 0.53 U/ mg and 3.22 ± 0.16 U/mg, respectively. Surprisingly, it was observed that, under hypoxia, the Na?/K? and the Ca2? ATPase activities increased approximately 2.8-fold (until 5.54 ± 0.15 U/mg) and 3.5-fold (until 11.4 ± 0.76 U/mg) respectively. In agreement, the Na?/K? and Ca2? ATPase activity of the plasma membrane from M. smegmatis mc2155 cells over-expressing M. tuberculosis DosR were approximately 2.5-fold (5.02 ± 0.67 U/mg and 6.85 ± 0.43 U/mg) higher in comparison with the estimated activity of plasma membrane vesicles from oxygenated cells (Fig. 2).
The fact that M. tuberculosis DosR stimulates Na?/K? and Ca2? ATPase activities in the plasma membrane of M. smegmatis at a similar level as hypoxia also suggests that the DosR regulator is possibly associated with the transcription of genes that are responsible for Na?/K? and Ca2? ATPase activities in the plasma membrane. On the other hand, because ATP is limited in hypoxia, mycobacteria down-regulate ATPases with the exception of the essential ATPase activity [23]. Thus, the increased P-type Na?/K? and Ca2? ATPase activities that were observed in M. smegmatis mc2155 and cells growing under hypoxia and over-expressing the DosR regulator could be a natural response that guarantees the influx of K? ions and efflux of Na? and Ca2? in mycobacteria. It has been reported that the K? concentration in phagosomes diminishes dramatically after mycobacterial infection [14, 37]. In this sense, the activation of the mycobacterial Na?/K? ATPase that we observed in hypoxic M. smegmatis cells and cells overexpressing DosR could be explained by the importing of K? ions in response to environmental conditions that is essential for the mycobacterial viability. Transcription of the M. smegmatis pma1 Gene is Strongly Induced by Hypoxia and the DosR Overexpression Our bioinformatic analyses indicated that Pma1 is the most probable gene product that is responsible for Na?/K? and/or Ca2? ATPase activity in M. smegmatis cells. In addition, based on the influence of hypoxia and the DosR overexpression on the Na?/K? and/or Ca2? ATPase activities of the mycobacterial plasma membrane, we conducted RTqPCR experiments to establish if the pma1 gene expression is associated with hypoxia and the DosR regulator. Thus, RNA was isolated from M. smegmatis mc2155 cells growing under oxygenated conditions, hypoxia, and from cells transformed with the pDosR1 plasmid. The efficiency of the
123
P. A. Pulido et al.: The DosR Dormancy Regulator
under the same experimental conditions. In addition, the transcription level of the M. smegmatis pma1 gene was upregulated under hypoxia at levels similar to that of cells over-expressing the M. tuberculosis DosR regulator, which agrees with the bioinformatic predictions and indicates that the pma1 gene product is most likely responsible for the Na?/K? and/or Ca2? ATPase activity in M. smegmatis cells. The fact that a cation transporter could be involved in the physiological mechanisms that mycobacteria display in response to hostile conditions make it an interesting target for the development of new antituberculous drugs.
Fig. 3 Quantification of M. smegmatis pma1 gene expression. The transcription level of the pma1 gene was measured in M. smegmatis mc2155 cells growing under oxygenated (control) or hypoxic conditions and over-expressing the M. tuberculosis DosR. For relative quantification, the transcription of the pma1 gene was normalized to the mean value of sigA
sigA and pma1 genes in the RT-qPCR experiments was 2.10 and 1.99, respectively, which ensured a reliable relative quantification. We found that M. smegmatis cells grown under hypoxia and cells over-expressing DosR exhibited 22and 19-fold increased transcription of the pma1 gene in comparison with that of oxygenated cells that were harvested in exponential phase of growth (Fig. 3). Similarly, the ion-specific ATPase assays showed that hypoxia and the DosR regulator stimulate the alkali/alkaline earth ion transport. From this point of view, the RT-qPCR experiments strongly suggest that hypoxia and the DosR regulator are actually associated with the pma1 gene transcription and the Na?/K? and Ca2? ATPase activities in the M. smegmatis cell membrane. This multifunctional behaviour of pma1 has also been observed in other M. smegmatis ATPases, for example, the M. smegmatis ATPase CtpD [TrEMBL: A0R3A7] is activated by Co2? and able to transport Ni2? and Zn2? [29]. However, taking into account the shared activities of plasma membrane ATPases to conserve cellular homeostasis, we cannot rule out that the occurrence of Na?/ K? and the Ca2? ATPase activities in the mycobacterial plasma membrane could be mediated by additional ATPases encoded by genes different from pma1.
Conclusion We can conclude that the basal ATPase activity of the M. smegmatis plasma membrane is diminished under hypoxia and when M. tuberculosis DosR latency global regulator is heterologously over-expressed in M. smegmatis cells. In contrast, the specific Na?/K? and Ca2? P-type ATPase activities of the plasma membrane are strongly augmented
123
Acknowledgments This work was supported by the ‘‘Divisio´n de Investigacio´n Bogota´, DIB’’, Vicerrectorı´a de Investigacio´n, Universidad Nacional de Colombia, grants 15835, 14337, 14837 and 16060. Conflict of interest of interest.
The authors declare that they have no conflict
References 1. Agranoff DD, Krishna S (1998) Metal ion homeostasis and intracellular parasitism. Mol Microbiol 28(3):403–412 2. Andersen JP, Vilsen B (1995) Structure-function relationships of cation translocation by Ca2?- and Na?, K?-ATPases studied by site-directed mutagenesis. FEBS Lett 359(2–3):101–106 3. Bacon J, James BW, Wernisch L, Williams A, Morley KA, Hatch GJ, Mangan JA, Hinds J, Stoker NG, Butcher PD, Marsh PD (2004) The influence of reduced oxygen availability on pathogenicity and gene expression in Mycobacterium tuberculosis. Tuberculosis (Edinb) 84(3–4):205–217 4. Bartek IL, Rutherford R, Gruppo V, Morton RA, Morris RP, Klein MR, Visconti KC, Ryan GJ, Schoolnik GK, Lenaerts A, Voskuil MI (2009) The DosR regulon of M. tuberculosis and antibacterial tolerance. Tuberculosis (Edinb) 89(4):310–316 5. Basu J, Chattopadhyay R, Kundu M, Chakrabarti P (1992) Purification and partial characterization of a penicillin-binding protein from Mycobacterium smegmatis. J Bacteriol 174(14):4829–4832 6. Berney M, Cook GM (2010) Unique flexibility in energy metabolism allows mycobacteria to combat starvation and hypoxia. PLoS ONE 5(1):e8614 7. Botella H, Peyron P, Levillain F, Poincloux R, Poquet Y, Brandli I, Wang C, Tailleux L, Tilleul S, Charriere GM, Waddell SJ, Foti M, Lugo-Villarino G, Gao Q, Maridonneau-Parini I, Butcher PD, Castagnoli PR, Gicquel B, de Chastellier C, Neyrolles O (2011) Mycobacterial P(1)-type ATPases mediate resistance to zinc poisoning in human macrophages. Cell Host Microbe 10(3):248–259 8. Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254 9. Bua A, Rosu V, Molicotti P, Das Gupta SK, Ahmed N, Zanetti S, Sechi LA (2009) Phages specific for mycobacterial lipoarabinomannan help serodiagnosis of tuberculosis. New Microbiol 32(3):293–296 10. Bublitz M, Poulsen H, Morth JP, Nissen P (2010) In and out of the cation pumps: P-type ATPase structure revisited. Curr Opin Struct Biol 20(4):431–439
P. A. Pulido et al.: The DosR Dormancy Regulator 11. Cook GM, Berney M, Gebhard S, Heinemann M, Cox RA, Danilchanka O, Niederweis M (2009) Physiology of mycobacteria. Adv Microb Physiol 55(81–182):189–318 12. Fiske SHaS Y (1925) The colorimetric determination of phosphorus. J Biol Chem 66(2):375–400 13. Gerasimova A, Kazakov AE, Arkin AP, Dubchak I, Gelfand MS (2011) Comparative genomics of the dormancy regulons in mycobacteria. J Bacteriol 193(14):3446–3452 14. Jha SS, Danelishvili L, Wagner D, Maser J, Li YJ, Moric I, Vogt S, Yamazaki Y, Lai B, Bermudez LE (2010) Virulence-related Mycobacterium avium subsp hominissuis MAV_2928 gene is associated with vacuole remodeling in macrophages. BMC Microbiol 10:100 15. Kim MJ, Park KJ, Ko IJ, Kim YM, Oh JI (2010) Different roles of DosS and DosT in the hypoxic adaptation of Mycobacteria. J Bacteriol 192(19):4868–4875 16. Kimura M, Yamaguchi Y, Takada S, Tanabe K (1993) Cloning of a Ca2?-ATPase gene of Plasmodium falciparum and comparison with vertebrate Ca2?-ATPases. J Cell Sci 104(Pt 4):1129–1136 17. Kobayashi H, Anraku Y (1972) Membrane-bound adenosine triphosphatase of Escherichia coli. I. Partial purification and properties. J Biochem 71(3):387–399 18. Kremer L, Guerardel Y, Gurcha SS, Locht C, Besra GS (2002) Temperature-induced changes in the cell-wall components of Mycobacterium thermoresistibile. Microbiology 148(Pt 10): 3145–3154 19. Kruh NA, Troudt J, Izzo A, Prenni J, Dobos KM (2010) Portrait of a pathogen: the Mycobacterium tuberculosis proteome in vivo. PLoS ONE 5(11):e13938 20. Kumar M, Khan FG, Sharma S, Kumar R, Faujdar J, Sharma R, Chauhan DS, Singh R, Magotra SK, Khan IA (2011) Identification of Mycobacterium tuberculosis genes preferentially expressed during human infection. Microb Pathog 50(1):31–38 21. Leistikow RL, Morton RA, Bartek IL, Frimpong I, Wagner K, Voskuil MI (2010) The Mycobacterium tuberculosis DosR regulon assists in metabolic homeostasis and enables rapid recovery from nonrespiring dormancy. J Bacteriol 192(6):1662–1670 22. Morth JP, Pedersen BP, Toustrup-Jensen MS, Sorensen TL, Petersen J, Andersen JP, Vilsen B, Nissen P (2007) Crystal structure of the sodium-potassium pump. Nature 450(7172):1043–1049 23. Murphy DJ, Brown JR (2007) Identification of gene targets against dormant phase Mycobacterium tuberculosis infections. BMC Infect Dis 7:84 24. Novoa-Aponte L, Leon-Torres A, Patino-Ruiz M, Cuesta-Bernal J, Salazar LM, Landsman D, Marino-Ramirez L, Soto CY (2012) In silico Identification and characterization of the ion transport specificity for P-type ATPases in the Mycobacterium tuberculosis complex. BMC Struct Biol 12(1):25 25. Ogawa H, Toyoshima C (2002) Homology modeling of the cation binding sites of Na? K?-ATPase. Proc Natl Acad Sci USA 99(25):15977–15982 26. Palmgren MG, Nissen P (2011) P-type ATPases. Ann Rev Biophys 40:243–266 27. Park HD, Guinn KM, Harrell MI, Liao R, Voskuil MI, Tompa M, Schoolnik GK, Sherman DR (2003) Rv3133c/dosR is a transcription factor that mediates the hypoxic response of Mycobacterium tuberculosis. Mol Microbiol 48(3):833–843
28. Raeymaekers L, Wuytack E, Willems I, Michiels CW, Wuytack F (2002) Expression of a P-type Ca2?-transport ATPase in Bacillus subtilis during sporulation. Cell Calcium 32(2):93 29. Raimunda D, Long JE, Sassetti CM, Arguello JM (2012) Role in metal homeostasis of CtpD, a Co2? transporting P(1B4)-ATPase of Mycobacterium smegmatis. Mol Microbiol 84(6):1139–1149 30. Roberts DM, Liao RP, Wisedchaisri G, Hol WG, Sherman DR (2004) Two sensor kinases contribute to the hypoxic response of Mycobacterium tuberculosis. J Biol Chem 279(22):23082–23087 31. Santos P, Gordillo A, Osses L, Salazar LM, Soto CY (2012) Effect of antimicrobial peptides on ATPase activity and proton pumping in plasma membrane vesicles obtained from mycobacteria. Peptides 36(1):121–128 32. Schnappinger D, Ehrt S, Voskuil MI, Liu Y, Mangan JA, Monahan IM, Dolganov G, Efron B, Butcher PD, Nathan C, Schoolnik GK (2003) Transcriptional Adaptation of Mycobacterium tuberculosis within Macrophages: insights into the Phagosomal Environment. J Exp Med 198(5):693–704 33. Somerville W, Thibert L, Schwartzman K, Behr MA (2005) Extraction of Mycobacterium tuberculosis DNA: a question of containment. J Clin Microbiol 43(6):2996–2997 34. Stover CK, de la Cruz VF, Fuerst TR, Burlein JE, Benson LA, Bennett LT, Bansal GP, Young JF, Lee MH, Hatfull GF et al (1991) New use of BCG for recombinant vaccines. Nature 351(6326):456–460 35. Thever MD, Saier MH Jr (2009) Bioinformatic characterization of P-type ATPases encoded within the fully sequenced genomes of 26 eukaryotes. J Membr Biol 229(3):115–130 36. Trias J, Benz R (1994) Permeability of the cell wall of Mycobacterium smegmatis. Mol Microbiol 14(2):283–290 37. Wagner D, Maser J, Lai B, Cai Z, Barry CE 3rd, Honer Zu, Bentrup K, Russell DG, Bermudez LE (2005) Elemental analysis of Mycobacterium avium-, Mycobacterium tuberculosis-, and Mycobacterium smegmatis-containing phagosomes indicates pathogen-induced microenvironments within the host cell’s endosomal system. J Immunol 174(3):1491–1500 38. Wayne LG, Hayes LG (1996) An in vitro model for sequential study of shiftdown of Mycobacterium tuberculosis through two stages of nonreplicating persistence. Infect Immun 64(6):2062–2069 39. WHO (2012) Global tuberculosis report 2012. World Health Organization, Switzerland 40. Wiangnon K, Raksajit W, Incharoensakdi A (2007) Presence of a Na?-stimulated P-type ATPase in the plasma membrane of the alkaliphilic halotolerant cyanobacterium Aphanothece halophytica. FEMS Microbiol Lett 270(1):139–145 41. Yatime L, Buch-Pedersen MJ, Musgaard M, Morth JP, Lund Winther AM, Pedersen BP, Olesen C, Andersen JP, Vilsen B, Schiott B, Palmgren MG, Moller JV, Nissen P, Fedosova N (2009) P-type ATPases as drug targets: tools for medicine and science. Biochim Biophys Acta 1787(4):207–220 42. Zhang L, Zhong Q, Bao L, Zhang Y, Gao L, Huang B, Zhang HD (2009) Rv0901 from Mycobacterium tuberculosis, a possible novel virulent gene proved through the recombinant Mycobacterium smegmatis. Jpn J Infect Dis 62(1):26–31
123
