Prenatal origin of separate evolution of leukemia in identical twins

Leukemia (2004) 18, 1624–1629 & 2004 Nature Publishing Group All rights reserved 0887-6924/04 $30.00 www.nature.com/leu

Prenatal origin of separate evolution of leukemia in identical twins O Teuffel1, DR Betts1, M Dettling2, R Schaub1, BW Scha¨fer1 and FK Niggli1 Department of Oncology, University Children’s Hospital, Zurich, Switzerland; and 2Seminar for Statistics, Swiss Federal Institute of Technology (ETH), Zurich, Switzerland 1

Several studies involving identical twins with concordant leukemia and retrospective scrutiny of archived neonatal blood spots have shown that the TEL-AML1 fusion gene in childhood acute lymphoblastic leukemia (ALL) frequently arises before birth. A prenatal origin of childhood leukemia was further supported by the detection of clonotypic immunoglobulin gene rearrangements on neonatal blood spots of children with various other subtypes of ALL. However, no comprehensive study is available linking these clonotypic events. We describe a pair of 5-year-old monozygotic twins with concordant TELAML1-positive ALL. Separate leukemic clones were identified in the diagnostic samples since distinct IGH and IGK-Kde gene rearrangements could be detected. Additional differences characterizing the leukemic clones included an aberration of the second, nonrearranged TEL allele observed in one twin only. Interestingly, both the identical TEL-AML1 fusion sequence and distinct immunoglobulin gene rearrangements were identified on the neonatal blood spots indicating that separate preleukemic clones evolved already before birth. Finally, we compared the reported twins with an additional 31 children with ALL by using the microarray technology. Gene expression profiling provided evidence that leukemia in twins harbours the same subtype-typical feature as TEL-AML1positive leukemia in singletons suggesting that the leukemogenesis model might also be applicable generally. Leukemia (2004) 18, 1624–1629. doi:10.1038/sj.leu.2403462 Published online 9 September 2004 Keywords: TEL-AML1; ALL; monozygotic twins; immunoglobulin gene rearrangements; gene expression profiling

These studies have generally produced positive results indicative of a prenatal origin of this ALL subtype. However, there is not much information available linking clonotypic IGH/TCR gene rearrangements and clonotypic genomic fusion sequences in leukemia harboring the TEL-AML1 fusion gene. Ford et al reported monozygotic twins with TEL-AML1 positive ALL sharing an identical rearranged IGH allele at diagnosis. Nevertheless, in addition to the common, clonotypic rearrangement, an IGH sequence distinct to only one twin was detected suggesting separate molecular events during further development to leukemia.5 However, it remains unclear, if the separate molecular evolution in identical twins has its origin prior to birth, or if this is a late event occurring close to the onset of disease. To illustrate the multistep nature of childhood leukemia, we investigated the diagnostic bone marrow and the neonatal blood spots of a pair of male twins that were diagnosed with TELAML1-positive ALL at the age of 4.8 years (T1) and 5.1 years (T2), respectively. To further characterize the twin samples of this study, we analyzed their gene expression profiles in comparison to another 31 samples of children with ALL.19

Material and methods

Patient characteristics Introduction The most common chromosomal translocation in childhood acute lymphoblastic leukemia (ALL) is the t(12;21) that results in a TEL-AML1 fusion product.1–4 Studies of monozygotic twins and their neonatal blood spots have backtracked the origin of this translocation to before birth.5–8 In the subgroup of TELAML1-positive leukemias, the concordance rate for monozygotic twins is estimated to be approximately 10–15%. Together with the protracted and variable latency of the disease and transgenic modeling, this indicates that additional secondary genetic events are necessary to develop leukemia.9–12 However, the pathogenetic role of frequent additional cytogenetic aberrations such as deletion of the second, nonrearranged TEL allele in leukemogenesis remains to be elucidated.13,14 Since there are no molecular correlates of hyperdiploidy accessible to PCR-based screening, IGH or TCR clonotypic sequences of hyperdiploid ALL have been used as surrogate markers in screening of neonatal blood spots or cord blood.15–18 Correspondence: Dr FK Niggli, Department of Oncology, University Children’s Hospital Zurich, Steinwiesstrasse 75, CH-8032 Zurich, Switzerland; Fax: þ 41 1 2667171; E-mail: [email protected] Received 18 May 2004; accepted 5 July 2004; Published online 9 September 2004

The monozygotic twins were born as preterms at 32 weeks sharing a single, monochorionic placenta. Before leukemia onset, the medical history of both twins was unremarkable. Standard diagnostics revealed a precursor B-cell immunophenotype (CD10 þ CD19 þ ) coexpressing the myeloid marker CD13 for both twins. TEL-AML1 fusion was identified by fluorescence in situ hybridization (FISH) and confirmed by reverse-transcriptase PCR in both cases. Distinct twin-specific immunoglobulin gene rearrangements were identified to monitor minimal residual disease (MRD) during further treatment periods (Figure 2a). The twins were entered onto the ALL-BFM 2000 protocol in April and July 2003, respectively. Both are currently in first clinical remission as judged by morphology as well as MRD negativity for the immunoglobulin rearrangements and the TEL-AML1 fusion by quantitative PCR.

Identification of the TEL-AML1 genomic fusion sequences DNA was extracted from diagnostic samples as well as the neonatal blood spots using QIAmp DNA extraction kits (Qiagen, Hilden, Germany). Three primers from TEL intron 5 were used in a long-distance PCR reaction in combination with 10 primers from AML1 intron 1 (spaced approximately 15 kb apart) as

Multistep pathogenesis in childhood leukemia O Teuffel et al

described.20 Obtaining positive products, individual reactions were performed by use of each TEL primer in combination with the AML1 primer. Purified PCR products were sequenced by cycle-sequencing (Applied Biosystems, Foster City, CA, USA).

Detection of IGH and IGK-Kde gene rearrangements Diagnostic bone marrow and neonatal blood spots were analyzed for immunoglobulin gene rearrangements. PCR amplification of IGH and IGK-Kde gene rearrangements and heteroduplex analysis of products were performed as described.21–23 Individual immunoglobulin gene rearrangements were amplified by specific PCR reactions (primer sequences available from the authors upon request) and all PCR products were sequenced by cycle-sequencing (Applied Biosystems, Foster City, CA, USA). Sequences were compared by BLAST search with the human germline sequences deposited in GenBank and allele-specific oligonucleotides (ASO) were designed using the Primer Express 1.0 software (Applied Biosystems). Rearrangements on the neonatal blood spots were detected after reamplification only and therefore below the detection limit of a single quantitative PCR.

Cytogenetics and FISH G-banded karyotypes from cultured bone marrow cells were obtained by standard techniques at diagnosis. Karyotypic interpretation was performed according to ISCN 1995. FISH was used to investigate TEL-AML1 status (probes from Vysis, Downers Grove, IL, USA). For T2 a chromosome 12 paint (Vysis) was also employed.

1625 combinations of the TEL and AML1 genes identified an identical clonotypic product of 5100 bp in both twins (Figure 1a). Subsequently, DNA extracted from the neonatal blood spots was analyzed. PCR studies of the TEL-AML1 breakpoint identified again the same fusion sequence (Figure 1b). These results confirm previous findings that TEL-AML1-positive leukemia share a common cell of origin in monozygotic twins (Figure 1c) and that this initiating chromosomal aberration can be backtracked to before birth.9 Specific and for both twins distinct immunoglobulin rearrangements were identified from the diagnostic bone marrow (Figure 2a). Subsequently, we investigated whether these clonal rearrangements could be identified already at birth. Using specific primers, for T1 identifying a VH1-JH4 and a VH3-JH4 rearrangement and for T2 a Vk1-Kde rearrangement, these clonotypic sequences were indeed found in the DNA isolated from neonatal blood spots. The product of T1 was not identified in T2 and vice versa, indicating that the rearrangements are specific for each twin (Figure 2b and c). Therefore, despite the leukemia of the twins sharing a common cell of origin, separate preleukemic clones were already established at birth since different clonotypic markers could be identified on the neonatal blood spots. We cannot further pinpoint the exact time point when these events occurred in the precursor cells; however, our data support recent findings from a study that analyzed antigen receptor gene rearrangements of matched diagnosis/relapse samples from children with TEL-AML1-positive ALL.24 Based on their data, the authors hypothesized that the maturity of the immunophenotype of the leukemic precursor cell that is affected

Gene expression analysis Microarray studies were performed with the Affymetrix HGU133A GeneChipt using standard protocols as recommended by the manufacturer (Affymetrix, Santa Clara, CA, USA; starting material 100 ng total RNA, ‘Small Sample Labeling Protocol vII’, http://www.affymetrix.com). Stained chips were scanned on a Gene Array Scanner (Agilent, Palo Alto, CA, USA), and data files were processed by GeneChipt software (Microarray Suite, Affymetrix). Hierarchical clustering was done on base 10 logtransformed expression data, using the statistical software bundle R. Prior to an average-linkage hierarchical clustering of all 33 samples based on Euclidean distances, we performed unsupervised gene filtering. By requiring a variation coefficient (s.d./ mean) of at least 0.3 across samples and a minimal expression of 20 absolute units in at least 17 of the 33 samples, we obtained a set of 286 probe sets for the clustering. A detailed description of the methods and all microarray data – including the additional 31 samples of children with ALL that were published previously – are available from the ArrayExpress database (www.ebi.ac.uk/ arrayexpress; Accession Numbers E-MEXP-122 (for the reported twins) and E-MEXP-120 (for the additional 31 samples)).19 For each twin, duplicate arrays were run. Gene expression data were validated for six randomly chosen genes by quantitative PCR and found to be in very good agreement.

Results and discussion The leukemic DNA of both twins shared the same unique TEL-AML1 fusion sequence. Long-distance PCR with primer

Figure 1 PCR studies of the TEL-AML1 breakpoint region and identification of the clonotypic fusion sequence on neonatal blood spots. (a) Long-distance PCR with primer combinations of the TEL and AML1 genes amplifies a product of 5100 bp in both twins. M: Marker. (b) PCR analysis of the immediate breakpoint region in neonatal blood spot DNA of the twins amplifying a product of 196 bp with the following primers: TEL 50 CCATGTGCCTTGAGATAGAAGAAAGCCC30 and AML1 50 AGATCTTTTGGTATGACTGTCTGGAGAAGGTC30 . Lane 1: Twin 1 neonatal blood spot DNA; 2: Twin 1 diagnostic DNA; 3: Twin 2 neonatal blood spot DNA; 4: water control; 5: Buffy coat; 6: 50 bp DNA ladder. (c) Sequence of the TEL-AML1 breakpoint found in the twins. The normal TEL sequence is shown at the top, the sequence found in the patients is shown in the middle, and the AML1 sequence is shown at the bottom. The 22 nucleotides bridging the gap between the TEL and AML1 sequence in the patients are also part of the AML1 gene, but incorporated inversely. TEL breaking point: nt37910 (GenBank Accession U61375 and GenBank Accession U63313), AML1 breaking point: nt173249 (GenBank Accession AP001721). Leukemia

Multistep pathogenesis in childhood leukemia O Teuffel et al

1626 by the TEL-AML1 gene fusion determines the potential for ongoing recombination. This suggests that the potential heterogeneity of IG/TCR rearrangements depends on the tight timing of the occurrence of the TEL-AML1 gene fusion in a cell before, during, or after somatic recombination. Taken this hypothesis together with our finding of distinct unrelated IGH/IGK-Kde gene rearrangements in the twins 1 and 2, this indicates that the TEL-AML1 gene fusion occurred before somatic recombination in the progenitor cell corresponding to a high potential heterogeneity of IG rearrangements. This notion is further supported by the findings of Pine et al.25 In contrast, the detection of both an identical and a related, but distinct, IGH gene rearrangement in identical twins (as reported by Ford et al) would mirror the occurrence of the TEL-AML1 fusion gene in a more mature precursor cell corresponding to a reduced potential heterogeneity of IG rearrangements.5 The leukemic clones were further characterized by cytogenetic studies, where both twins displayed an abnormal

karyotype (Table 1). Secondary chromosomal aberrations were identified involving chromosome 6 in T1, whereas T2 presented cytogenetic abnormalities of chromosomes 12 and 19. FISH analysis for the TEL-AML1 translocation revealed two abnormal populations in T2. In the major population, the signal from the nontranslocated TEL was reduced in size implying an aberration of the second TEL allele. A second, smaller population that was not detected during G-banded analysis, displayed loss of the normal TEL signal accompanied by gain of a normal AML1 signal. A chromosome 12 paint analysis for T2 provided further support for loss of the terminal region of 12p. Thus, cytogenetic characterization of the leukemic populations identified an aberration of the second, nonrearranged TEL allele in one twin only. Aberration or complete deletion of the second TEL allele is a frequent secondary event in patients with TEL-AML1-positive ALL.13,14 Hence, loss of the second TEL allele might be an important, but nonobligatory secondary event in the multistep pathogenesis of leukemia.

Figure 2 Identification of IGH and IGK-Kde gene rearrangements. (a) Analysis of gene rearrangements in leukemic cells of the twins. Immunoglobulin H (T1 VH gene) and immunoglobulin kappa (T1 VK gene) rearrangements of T1 showing V, N, D and J nucleotide sequences. Immunoglobulin kappa (T2 VK gene) rearrangement of T2 showing Vk, N, Kde nucleotide sequences. (b) Twin 1: PCR was carried out with patient specific primers identified from the diagnostic samples. Lane 1: VH1 JH4 (117 bp) detection in neonatal blood spot DNA. Lane 2: VH1 JH4 detection in diagnostic genomic DNA. Lane 3: Buffy coat DNA. Lane 4: water. Lane 5: IGK-Kde rearrangement of twin 2 with neonatal blood spot DNA of twin 1. Lane 6: VH3 JH4 (130 bp) detection in neonatal blood spot DNA. Lane 7: VH3 JH4 detection in diagnostic genomic DNA. (c) Twin 2: Lane 1: IGK-Kde (161 bp) detection in neonatal blood spot DNA. Lane 2: IGK-Kde detection in diagnostic genomic DNA. Lane 3: Buffy coat DNA. Lane 4: VH1 JH4 rearrangement of twin 1 with neonatal blood spot DNA of twin 2. Lane 5: VH3 JH4 rearrangement of twin1 with neonatal blood spot DNA of twin 2. Lane 6: Albumin (81 bp).

Table 1

Cytogenetic analysis in the leukemic cells of twins 1 and 2

Twin

Karyotype

TEL-AML1 FISH

T1

46,XY,add(6)(q14B16)[5]/46,XY[10]

12p13(TELx2),21q22(AML1x2) (TEL con AML1x1)

T2

46,XY,del(12)(p13),add(19)(q13)[9]/46,XY[1]

12p13(TELx2),21q22(AML1x2) (TEL con AML1x1)/ 12p13(TELx1),21q22(AML1x3) (TEL con AML1x1)

Karyotype studies show an abnormal karyotype of the leukemia in both twins. TEL-AML1 FISH studies present different findings in regard to the second, nonrearranged alleles. Leukemia

Multistep pathogenesis in childhood leukemia O Teuffel et al

1627 Genomewide expression patterns are able to identify immunological subgroups (precursor-B ALL vs T-cell leukemia) and cytogenetic abnormalities such as TEL-AML1, E2A-PBX1, BCR-ABL, hyperdiploid with 450 chromosomes, and MLL gene rearrangements in childhood ALL with high accuracy.26–29 To confirm these findings, global gene expression of the diagnostic bone marrow from the twins were analyzed in comparison to

the expression profiles of an additional 31 childhood ALL samples that included eight TEL-AML1-positive cases.19 Using unsupervised hierarchical clustering, this analysis clearly identified all TEL-AML1-positive samples indicating a subtypetypical gene expression profile for both twins (Figure 3). Although assigned to the other TEL-AML1-positive samples, the twins do not cluster adjacent to each other. Hence, this

Figure 3 Gene expression analysis of the leukemic blasts. Unsupervised hierarchical clustering of 33 children with ALL including the reported twins. All 10 TEL-AML1-positive samples are represented in one branch of the dendrogram. Although grouped with the other eight TEL-AML1positive samples, the twins do not cluster adjacent to each other. Cluster dendrogram based on 286 filtered probe sets (filter criteria see methods). The dendrogram does not substantially change if all probe sets (n ¼ 22 383) are used. Red bar ¼ 10 TEL-AML1-positive samples including the samples of the reported twins 1 and 2; blue bar ¼ 5 E2A-PBX-positive samples; gray bar ¼ four samples with hyperdiploidy 450; orange bar ¼ one BCR-ABL-positive sample; green bars ¼ samples without any of the above cytogenetic aberrations.

Figure 4 Multistep pathogenesis in TEL-AML1-positive leukemia. The model visualizes the multistep leukemogenesis in the reported twins. It indicates that immunoglobulin gene rearrangements and nonrandom additional cytogenetic events in leukemic cells of monozygotic twins can arise independently from a common TEL-AML1 stem cell. The diverse preleukemic clonality in twins can be backtracked to before birth. T1: IGH1 (VH1-JH4), IGH2 (VH3-JH4), IGK2 (VK3-Kde), IGK3 (VK1-Kde); T2: IGK1 (VK1-Kde). Leukemia

Multistep pathogenesis in childhood leukemia O Teuffel et al

1628 analysis supports the notion that further development of leukemia in both twins occurred as independent events, comparable to singletons, and likely influenced by the observed secondary genetic changes. Despite distinct molecular evolution, both twins developed leukemia almost simultaneously approximately 5 years after birth (Figure 4). It is conceivable that the essential – leukemia initiating – steps of pathogenesis are ‘cryptic’ and near-identical between the twins. It remains still unclear whether such essential events are preassigned due to the common TEL-AML1 stem cell, or if they are triggered by environmental exposures. No evidence could be established that the reported twins suffered exposure to genotoxicity (ionizing radiation, solvents) or proliferative stress (infection, toxins, diet) in their history. Nevertheless, data of sociodemographic studies of childhood leukemia provide a hint that some kind of abnormal or delayed response to common infections may promote the initiating event.10,30 In summary, our results suggest that the multistep leukemogenesis in the reported twins was not only initiated in utero by the occurrence of a chromosomal translocation, but also proceeded very early during development as distinct clonalities. We hypothesize that the underlying reason for this might be a rather immature immunophenotype of the common leukemic precursor cell that was affected by the TEL-AML1 gene fusion. Further, we demonstrate that secondary genetic changes can occur independently from a common TEL-AML1 stem cell. Whether some of these might already be present at birth cannot, at the moment, be determined. In addition, gene expression analysis provides strong evidence that twins and singletons share TEL-AML1-associated features indicating that our observations about the multistep leukemogenesis in twins might also be applicable to singletons. Nevertheless, further investigations aimed at the identification of essential ‘cryptic’ events in the multistep pathogenesis of TEL-AML1-positive leukemia are warranted.

5

6

7 8 9 10 11

12

13

14

15

Acknowledgements We are very grateful to Gunnar Cario, Martin Stanulla, and Martin Schrappe from the Hannover Medical School, Germany, for their assistance in sample collecting for the microarray analysis. We also thank the Functional Genomics Center of University and ETH, Zurich, for providing access to the Affymetrix work station. This work was supported by grants from the Krebsliga of the Kanton Zurich, the Krebsliga Schweiz, the ‘Schweizer Forschungsstiftung Kind und Krebs’, and the ‘Provita Kinderleuka¨miestiftung, Vaduz (FL)’.

References 1 Golub TR, Barker GF, Bohlander SK, Hiebert SW, Ward DC, Bray-Ward P et al. Fusion of the TEL gene on 12p13 to the AML1 gene on 21q22 in acute lymphoblastic leukemia. Proc Natl Acad Sci USA 1995; 92: 4917–4921. 2 Romana SP, Mauchauffe M, Le Coniat M, Chumakov I, Le Paslier D, Berger R et al. The t(12;21) of acute lymphoblastic leukemia results in a tel-AML1 gene fusion. Blood 1995; 85: 3662–3670. 3 Shurtleff SA, Buijs A, Behm FG, Rubnitz JE, Raimondi SC, Hancock ML et al. TEL/AML1 fusion resulting from a cryptic t(12;21) is the most common genetic lesion in pediatric ALL and defines a subgroup of patients with an excellent prognosis. Leukemia 1995; 9: 1985–1989. 4 Borkhardt A, Cazzaniga G, Viehmann S, Valsecchi MG, Ludwig WD, Burci L et al. Incidence and clinical relevance of TEL/AML1 fusion genes in children with acute lymphoblastic leukemia Leukemia

16

17

18

19

20

21

22

enrolled in the German and Italian multicenter therapy trials. Associazione Italiana Ematologia Oncologia Pediatrica and the Berlin-Frankfurt-Munster Study Group. Blood 1997; 90: 571–577. Ford AM, Bennett CA, Price CM, Bruin MC, Van Wering ER, Greaves M. Fetal origins of the TEL-AML1 fusion gene in identical twins with leukemia. Proc Natl Acad Sci USA 1998; 95: 4584–4588. Wiemels JL, Ford AM, Van Wering ER, Postma A, Greaves M. Protracted and variable latency of acute lymphoblastic leukemia after TEL-AML1 gene fusion in utero. Blood 1999; 94: 1057–1062. Wiemels JL, Cazzaniga G, Daniotti M, Eden OB, Addison GM, Masera G et al. Prenatal origin of acute lymphoblastic leukaemia in children. Lancet 1999; 354: 1499–1503. Maia AT, Ford AM, Jalali GR, Harrison CJ, Taylor GM, Eden OB et al. Molecular tracking of leukemogenesis in a triplet pregnancy. Blood 2001; 98: 478–482. Greaves MF, Maia AT, Wiemels JL, Ford AM. Leukemia in twins: lessons in natural history. Blood 2003; 102: 2321–2333. Greaves MF. Aetiology of acute leukaemia. Lancet 1997; 349: 344–349. Andreasson P, Schwaller J, Anastasiadou E, Aster J, Gilliland DG. The expression of ETV6/CBFA2 (TEL/AML1) is not sufficient for the transformation of hematopoietic cell lines in vitro or the induction of hematologic disease in vivo. Cancer Genet Cytogenet 2001; 130: 93–104. Bernardin F, Yang Y, Cleaves R, Zahurak M, Cheng L, Civin CI et al. TEL-AML1, expressed from t(12;21) in human acute lymphocytic leukemia, induces acute leukemia in mice. Cancer Res 2002; 62: 3904–3908. Raynaud S, Cave H, Baens M, Bastard C, Cacheux V, Grosgeorge J et al. The 12;21 translocation involving TEL and deletion of the other TEL allele: two frequently associated alterations found in childhood acute lymphoblastic leukemia. Blood 1996; 87: 2891–2899. Raynaud SD, Dastugue N, Zoccola D, Shurtleff SA, Mathew S, Raimondi SC. Cytogenetic abnormalities associated with the t(12;21): a collaborative study of 169 children with t(12;21)-positive acute lymphoblastic leukemia. Leukemia 1999; 13: 1325–1330. Fasching K, Panzer S, Haas OA, Marschalek R, Gadner H, Panzer-Grumayer ER. Presence of clone-specific antigen receptor gene rearrangements at birth indicates an in utero origin of diverse types of early childhood acute lymphoblastic leukemia. Blood 2000; 95: 2722–2724. Yagi T, Hibi S, Tabata Y, Kuriyama K, Teramura T, Hashida T et al. Detection of clonotypic IGH and TCR rearrangements in the neonatal blood spots of infants and children with B-cell precursor acute lymphoblastic leukemia. Blood 2000; 96: 264–268. Taub JW, Konrad MA, Ge Y, Naber JM, Scott JS, Matherly LH et al. High frequency of leukemic clones in newborn screening blood samples of children with B-precursor acute lymphoblastic leukemia. Blood 2002; 99: 2992–2996. Maia AT, Tussiwand R, Cazzaniga G, Rebulla P, Colman S, Biondi A et al. Identification of preleukemic precursors of hyperdiploid acute lymphoblastic leukemia in cord blood. Genes Chromosomes Cancer 2004; 40: 38–43. Teuffel O, Dettling M, Cario G, Stanulla M, Schrappe M, Bu¨hlmann P et al. Association of gene expression profiles with risk stratification in childhood acute lymphoblastic leukemia. Haematologica 2004; 89: 801–808. McHale CM, Wiemels JL, Zhang L, Ma X, Buffler PA, Guo W et al. Prenatal origin of TEL-AML1-positive acute lymphoblastic leukemia in children born in California. Genes Chromosomes Cancer 2003; 37: 36–43. Verhagen OJ, Willemse MJ, Breunis WB, Wijkhuijs AJ, Jacobs DC, Joosten SA et al. Application of germline IGH probes in real-time quantitative PCR for the detection of minimal residual disease in acute lymphoblastic leukemia. Leukemia 2000; 14: 1426–1435. van der Velden VH, Willemse MJ, van der Schoot CE, Hahlen K, van Wering ER, van Dongen JJ. Immunoglobulin kappa deleting element rearrangements in precursor-B acute lymphoblastic leukemia are stable targets for detection of minimal residual disease by real-time quantitative PCR. Leukemia 2002; 16: 928–936.

Multistep pathogenesis in childhood leukemia O Teuffel et al

1629 23 Pongers-Willemse MJ, Seriu T, Stolz F, d’Aniello E, Gameiro P, Pisa P et al. Primers and protocols for standardized detection of minimal residual disease in acute lymphoblastic leukemia using immunoglobulin and T cell receptor gene rearrangements and TAL1 deletions as PCR targets: report of the BIOMED-1 CONCERTED ACTION: investigation of minimal residual disease in acute leukemia. Leukemia 1999; 13: 110–118. 24 Peham M, Konrad M, Harbott J, Konig M, Haas OA, Panzer-Grumayer ER. Clonal variation of the immunogenotype in relapsed ETV6/RUNX1-positive acute lymphoblastic leukemia indicates subclone formation during early stages of leukemia development. Genes Chromosomes Cancer 2004; 39: 156–160. 25 Pine SR, Wiemels JL, Jayabose S, Sandoval C. TEL-AML1 fusion precedes differentiation to pre-B cells in childhood acute lymphoblastic leukemia. Leuk Res 2003; 27: 155–164. 26 Golub TR, Slonim DK, Tamayo P, Huard C, Gaasenbeek M, Mesirov JP et al. Molecular classification of cancer: class discovery

27

28

29

30

and class prediction by gene expression monitoring. Science 1999; 286: 531–537. Ferrando AA, Neuberg DS, Staunton J, Loh ML, Huard C, Raimondi SC et al. Gene expression signatures define novel oncogenic pathways in T cell acute lymphoblastic leukemia. Cancer Cell 2002; 1: 75–87. Armstrong SA, Staunton JE, Silverman LB, Pieters R, den Boer ML, Minden MD et al. MLL translocations specify a distinct gene expression profile that distinguishes a unique leukemia. Nat Genet 2002; 30: 41–47. Yeoh EJ, Ross ME, Shurtleff SA, Williams WK, Patel D, Mahfouz R et al. Classification, subtype discovery, and prediction of outcome in pediatric acute lymphoblastic leukemia by gene expression profiling. Cancer Cell 2002; 1: 133–143. Greaves M. Molecular genetics, natural history and the demise of childhood leukaemia. Eur J Cancer 1999; 35: 1941–1953.

Leukemia