Prenatal origin of acute lymphoblastic leukaemia in children J L Wiemels, G Cazzaniga, M Daniotti, O B Eden, G M Addison, G Masera, V Saha, A Biondi, M F Greaves
Summary Background There is little current insight into the natural history of childhood leukaemia or the timing of relevant mutational events. TEL-AML1 gene fusion due to chromosomal translocation is frequently seen in the common form of childhood acute lymphoblastic leukaemia. We investigated whether this abnormality arises prenatally. Methods We identified, by reverse-transcriptase PCR screening of blood or bone marrow, TEL-AML1 fusion in 12 children, plus a pair of identical twins, aged 2–5 years from Italy and the UK, who had newly diagnosed acute lymphoblastic leukaemia. We amplified and sequenced the genomic TEL-AML1 fusion gene with a long-distance inverse PCR method. Primers were designed that could be used in short-range PCR to screen for patient-specific, leukaemia clone-specific TEL-AML1 genomic fusion sequences in neonatal blood spots from each child. Findings We initially identified TEL-AML1 fusion sequences in blood spots from the identical twins, diagnosed with concordant acute lymphoblastic leukaemia at age 4 years, who shared a single or clonotypic TEL-AML1 sequence that suggested prenatal origin in one twin. Three children were excluded because control genes could not be amplified. Of the other nine patients, six had positive blood spots. Blood spots that were classified as negative were uninformative. Interpretation Our findings showed that childhood acute lymphoblastic leukaemia is frequently initiated by a chromosome translocation event in utero. Studies in identical twins show however that such an event is insufficient for clinical leukaemia and that a postnatal promotional event is also required. Lancet 1999; 354: 1499–503 See Commentary page 1486
Leukaemia Research Fund Centre, Institute of Cancer Research, Chester Beatty Laboratories, London SW3 6JB, UK (J L Weimels PhD, Prof M F Greaves PhD); Centro Ricerca Tettamanti, Clinica Pediatrica, Universita di Milano, Ospedale San Gerardo, Milan, Italy (G Cazzaniga PhD, M Daniotti BSc, G Masera MD, A Biondi MD); Academic Unit of Paediatric Oncology, Christie Hospital NHS Trust, Manchester, UK (O B Eden FRCP); Department of Clinical Biochemistry, Royal Manchester Children’s Hospital, Manchester (G M Addison FRCPath); and Department of Paediatric Haematology and Oncology, Royal London Hospital, London (V Saha FRCPCH) Correspondence to: Prof M F Greaves (e-mail:
[email protected])
THE LANCET • Vol 354 • October 30, 1999
Introduction Acute lymphoblastic leukaemia is the main type of leukaemia in children and the most common childhood cancer overall.1 The disease is biologically and clinically heterogeneous, but one subtype, referred to as common acute lymphoblastic leukaemia, derived from B-cell progenitors, accounts for the peak incidence of acute lymphoblastic leukaemia between ages 2 years and 5 years2,3 and for a large proportion of cases that are curable by combination chemotherapy.4,5 There has been much speculation on the cause of childhood cancers, especially leukaemia, commonly in the context of apparent clusters of disease.6,7 Ionising radiation is the only known cause of de-novo acute leukaemia in children, but is unlikely to represent a major causal pathway.8 Epidemiological studies have suggested a possible role of non-ionising radiation, some chemicals, and, especially, infection.8–10 What is generally missing from such studies is any insight into the natural history of the disease and the likely timing of key exposures and mutational events. Clinically evident symptoms of childhood acute lymphoblastic leukaemia are generally present only for a few weeks before diagnosis,11 and rarely for several months.12 The development of acute lymphoblastic leukaemia probably therefore involves a covert or clinically silent phase between initiation and the onset of symptoms. Given the young age of most children who have acute lymphoblastic leukaemia and the latency expected for clonal evolution of cancer,3 it is possible that the disease originates before birth in utero. The only evidence to support this hypothesis has, however, been weak and indirect, since it was derived from epidemiological associations with radiation or viral exposures during pregnancy.13–16 Molecular insights into childhood leukaemia have provided an opportunity to investigate the natural history of the disease more clearly. In particular, the consistent chromosomal and molecular genetic abnormalities provide stable and unique (or clonotypic) markers for tracking the leukaemic cells.3 Molecular studies on several pairs of identical twins, aged between 2 months and 14 years at diagnosis, have provided strong evidence that concordant acute lymphoblastic leukaemia arises in monozygotic twins after mutation and clonal expansion of one cell in one fetus in utero.17–20 Since the disease in twins is not different, biologically or clinically, from that in singletons, at least some singletons are also likely to have prenatal initiation of leukaemia. The concordance rate in monozygotic twins is not, however, known accurately, but is estimated to be around 5% (for children aged >1 year).21,22 It follows that some additional event or exposure is required postnatally, for which discordance is the rule in twins, or that most childhood acute lymphoblastic leukaemia in twinned and non-twinned children is initiated postnatally. Since this issue has a major bearing on the cause of childhood leukaemia, we aimed to find a direct and unambiguous test. We devised a way to identify the
1499
Patient*
TEL side primer (59 to 39)
AML1 side primer (59 to 39)
PCR product size (bp)
K Twin A† K Twin B 1†
GAACCTAGGACGCAGAGGTTG CCGAGATTGCATCACTGAACTCC GGTCTGGTTCACGTTTCACTG GCTTGTGGTTAGAGAACTGTCC CAGTCAGAGTCACCAAGCCACA CCCACCATTTTTCACTCCTCACT GATTTACGTGTTCAAAGGCCATG TCTCCTTTCTTGTGTTTCTCTCATTATT GGTGTTGCCGTTGCTATTGA AATCTAGAGCTGAAATATGAGCCTTCA AGATCTCTTCACTCCCAACCCTC CCCTCTTAGAACACACTTCGCA CAAAAGTTTTTAAATCTCCC TTCCACTGAAAGGCATTGTT GCCGGTACTGTCCCTTTTTTATTTA TTTCTCTGGCCCCAAGTGC AACAAGCTGCCAATTGATCATTTT CATTTAATCCAGCAAAGCCAACT CCCTTGCCCGGAATGC GCCTGTGTCTGAGTTATCCTT
GTGGCATACCGAGGTCTCTCTG GTGGCATACCGAGGTCTCTCTG CAATGGTTTGCTTGGCTTCACTC CAATGGTTTGCTTGGCTTCACTC GATGTCACAGGGATGGAAAACA CACCTGCCATACACACTATCCAG GAGTTTAGCCTTTTGTTTCCAATGTT TTCATGGAGAACAGGCATGC CTTCTTCCTCAGCAGAGTTTTGG GAAGAGACAGGCAGACAGGAAATC GATGCCAGCCTCAGTCCTCA AGGCCAGGACCATGTCCA GAGACTATCTTCCACGAAT TCTTCCACGAATCTTGCTTG AACACACCCTGGTTTCACCATT AACACACCCTGGTTTCACCATT TAGGCATTGACTGACAGGTAGGAAC TGAGAATGGCTTTTACTTCCAAAGT GCTGCTCCTGAGGCTCATGTA GCTGCTCCTGAGGCTCATGTA
347 319 278 187 198 110 212 84 223 94 133 92 189 119 131 87 204 89 144 129
2†‡ 3§ 4† 5§ 6†‡ 7† 8† 9†‡
*Two separate primer pairs are shown for each patient, the first is the primary reaction, the second the nested (or, in K twins and patients 1, 7, and 9, seminested). All PCR were done with a 60ºC annealing temperature, except PCR for patients 2 and 6 (55ºC) and patient 9 (57ºC). †Makowski method for Guthrie analysis.32 ‡Patients from Italian centre. All others are from UK. §Ampdirect method for Guthrie analysis.
Table 1: Patient-specific TEL and AML1 sequences and PCR conditions for Guthrie studies
presence of clonotypic or patient-specific leukaemia fusion-gene sequences in neonatal blood spots or Guthrie cards. Neonatal blood samples are routinely used to screen for inherited metabolic disorders. The cards are commonly retained for many years, generally at room temperature, but have intact DNA that is amplifiable by PCR.23 This source of DNA has been used to identify constitutive or inherited mutations23,24 and exogenous viral sequences25 in neonatal blood. Lymphoblastic leukaemia in infants (aged
