Preferential amplification and molecular characterization of junction sequences of a pathogenetic deletion in human mitochondrial DNA

GENOMICS

5, 623 -628

(1989)

Preferential Amplification and Molecular Characterization Junction Sequences of a Pathogenetic Deletion in Human Mitochondrial DNA R. JOHNS*

DONALD Departments

of *Neurology

and tMedicine,

AND OREST

April

7, 1989;

Academic

Press.

Inc.

INTRODUCTION

The mitochondrial encephalomyopathies are a clinically, biochemically, and genetically heterogeneous group of disorders, the common features of which are altered mitochondrial morphology and defects of oxidative phosphorylation (Berenberg et al., 1977; Pavlakis et al., 1984; Rosing et al., 1985; Petty et al., 1986; Moreadith et al., 1984). Because 13 of the proteins in the electron transport chain are encoded by mitochondrial DNA (mtDNA) it was suspected that some of these disorders might result from mutations of this organellar genome, the entire 16,569-nucleotide (nt) sequence (Anderson et al., 1981) and gene products (Attardi et al., 1986) of which have been determined. Support for the involvement of mtDNA came from pedigree analyses that suggested maternal inheritance in some kindreds (Egger and Wilson, 1983; Wallace et al., 1988b). Sequence data EMBL/GenBank

from Data

this article have been deposited with Libraries under Accession No. 504745.

revised

May

Baltimore,

Maryland

21205

18, 1989.

Demonstration of mtDNA deletions in skeletal muscle in some patients with mitochondrial encephalomyopathies provides direct evidence for a pathogenetic role of mtDNA mutations (Holt et al., 1988a, b; Lestienne and Ponsot, 1988; Ozawa et al., 1988; Zevianni et al., 1988; Saiffuoin-Noer et al., 1988). Southern analysis of biopsied skeletal muscle revealed that a proportion of mtDNA (18 to 79%) contained deletions ranging from 0.4 to 7 kb in length in different patients. The location of these deletions was only defined approximately, however, because of the limitations posed by heteroplasmy (the presence of more than one population of mtDNA within an individual) and the limited quantity of tissue available for analysis. No deleted mtDNA was detected by Southern analysis of blood in these patients. This pattern of heteroplasmy and tissue variability contrasts sharply with Leber’s hereditary optic atrophy, in which all tissues contain only one population of mtDNA bearing a pathogenetic point mutation (Wallace et al., 1988a), and suggested that deletion mutations might arise during development of the muscle cell lineage. The aims of this study were to define more precisely the structure and tissue distribution of a pathogenetic mitochondrial DNA mutation, in order to clarify its origin. To facilitate the detection and molecular analysis of minor proportions of deleted mtDNA species, we developed a procedure, widely spaced primer polymerase chain reaction (WISP-PCR), that selectively amplifies sequencesflanking a deleted region of DNA.

Deletions of mitochondrial DNA have been detected in skeletal muscle of some patients with mitochondrial encephalomyopathies, but their junctions have been defined only approximately. We developed a procedure, using widely spaced primers for the polymerase chain reaction, that amplifies preferentially the sequences bracketing the deletion. This procedure permits detection of minor proportions, not detectable by Southern analysis, of deleted mitochondrial DNA species in a heteroplasmic mixture. Different proportions of intact mitochondrial DNA and species deleted from nucleotide 8708 to 13,722 were found in skeletal muscle, blood, and urinary epithelial cells from a patient with chronic progressive external ophthalmoplegia. These data indicate that the mutation occurred at or before early embryonic development and provide the first definition at the nucleotide level of a human disease caused by a deletion of mitochondrial DNA. IF 1989

kJRKO*‘t

The Johns Hopkins University School of Medicine,

Received

of

MATERIALS

Preparation

of

AND

Mitochondrial

METHODS

DNA

Mitochondrial DNA from the HeLa cells was isolated in cesium chloride equilibrium buoyant density gradients in the presence of propidium iodide (Bogenhagen and Clayton, 1974; Hudson et al., 1969). A synthetic mtDNA deletion was created by digesting purified

the

623

0888.7543/89

Copyright 8 1989 All rights of reproduction

$3.00

by Academic Press, Inc. in any form reserved.

624

JOHNS

HeLa mtDNA with restriction enzyme PstI (which cleaves at nt 6910 and nt 9020), isolating the resulting 14.5-kb linear fragment after electrophoresis in lowmelting-point agarose, and circularizing it with T4 DNA ligase (New England Biolabs). The patient’s DNA was isolated from mitochondrial and nuclear fractions of skeletal muscle tissue that were prepared by differential centrifugation in preparation for oxygen electrode polarography (Moreadith et al., 1984), and from unfractionated homogenates of cultured myoblasts, peripheral blood leukocytes, and urinary sediment. Total DNA was extracted by digestion with 5 mg proteinase K at 50°C for 2 h in the presence of 1% (w/v) sodium dodecyl sulfate, extraction with phenol and chloroform, and precipitation in ethanol. Polymerase

Chain Reaction

The PCR on isolated HeLa mtDNA was carried out with 10 ng of template DNA, 2.5 units of Taq polymerase (Perkin-Elmer Cetus), using 35 cycles of 94’C for 2 min, 37°C for 2 min, 72°C for 4 min, on an automated thermal cycler (Perkin-Elmer Cetus); the PCRs on the patient’s specimens were performed with 100 ng of template DNA, with 40 cycles of 94’C for 1 min, 55°C for 2 min, 72°C for 6 min. Oligonucleotide

Primers

Oligonucleotide primers were synthesized by Operon Technologies (San Pablo, CA). Their designation, locations, and sequences are as follows: DRJ-1-66966714, AAAGAACCATTTGGATACA; DRJ-2-91399157, TAGAAGTGTGAAAACGTAG;DRJ-3-74077425,TACCACACATTCGAAGAAC; DRJ-1214,452-14,470, ATATACTACAGCGATGGCT; DRJ15- 8566-8580, ATCCTAGGCCTACCC; DRJ-1613,789-13,809, GAGGGCTGTAGTTTTAGGTA. Products of the PCR reactions were visualized after electrophoresis on 1.1% agarose gels, staining with ethidium bromide, and illumination with ultraviolet light. DNA

Sequencing

The product from a WISP-PCR encompassing the deletion was collected in an ultrafiltration microconcentrator (Centricon-30, Amicon) and sequenced directly with a 32P-end-labeled primer, DRJ-15, by the dideoxy chain termination method (Higuchi et al., 1988). Muscle Biopsy Approximately 5 g of muscle was taken from the right quadriceps for diagnostic studies, including standard histological and histochemical preparations of frozen sections (Dubowitz and Brooke, 1973). Four

AND

HURKO

grams of this specimen was used to prepare mitochondria for oxygen electrode polarography (Moreadith et al., 1984) and isolation of DNA, and the remainder of the specimen was used to establish tissue cultures (Yasin et al., 1977). RESULTS

Preferential Amplification

of Deletion Junctions

In order to facilitate the molecular analysis of the junctions of deletions in mtDNA and the search for low levels of heteroplasmy, we developed the widely spacedprimer PCR procedure that selectively amplifies sequences flanking a deleted region of DNA. Amplification products of standard PCR have been determined empirically to have a length limitation of about 2 kb (Saiki et al., 1988). In widely spaced primer PCR we use two oligonucleotide primers that recognize unique sequenceswidely spaced on normal mtDNA, but which are more closely apposed on mtDNA that contains a large deletion in the bracketed interval. We first tested the widely spaced primer PCR procedure with purified HeLa mtDNA into which we introduced a 2.11-kb deletion by digestion with PstI, which cleaves mitochondrial DNA in two sites, and religation of the larger product after its separation on low-melting-point agarose. The deletion junction DNA was amplified preferentially with primers that bracketed the deletion, when mixtures of normal and deleted mtDNA were used as templates, even when the normal species was present in thousandfold excess (Fig. IA). Clinical Evaluation of Patient Our first clinical application of this procedure was the study of samples from a 43-year-old elementary school teacher with chronic progressive external ophthalmoplegia, the only offspring of two healthy, unrelated individuals. Ptosis, slowing of saccadic eye movements, marked symmetric limitation of eye movements, and peripheral pigmentary retinopathy were found at age 13. In late adolescence she developed easy fatiguability, marked facial and proximal weakness, and mild dysphagia, all of which continue to progressgradually. She was diffusely hyporeflexic and had moderate muscular atrophy of cervical and shoulder girdle muscles. There was no optic atrophy or cardiopathy; renal, thyroid, and parathyroid function were normal. She declined lumbar puncture. Venous levels of lactate and alanine at rest and after graded exercise were two to three times the upper limit of normal. Electromyography demonstrated numerous short, duration motor unit potentials, nerve conduction velocities were normal, and there was no decrement of responses after repetitive stimulation. Electrocardiography demonstrated minimal ST-T wave changes but

MITOCHONDRIAL

2.46-

DNA

-4 -3 -2 - 1.6

625

DELETION

1

B

2

3

M kb

kb -3

-2 - 1.6

-506 -.396 -.344 -.298

.QO -

FIG. 1. Widely spaced primer PCR amplification of deleted human mtDNA. (A) Amplification of a synthetic 2.11-kb human mtDNA deletion. A widely spaced primer pair, DRJ-1 and DRJ-2, that bracketed the deletion, which extended from nt 6910 to nt 9020, was synthesized. At ratios of deletedmormal template mtDNA of 1:l to l:lOOO, preferential amplification of the deleted species (351 nt) was observed relative to that derived from the normal template (2.46 kb). The identity of the minor band, which is smaller than the expected 351 nt band, is unknown. (B) Amplification of heteroplasmic skeletal muscle DNA obtained from a mitochondrial encephalopathy patient by use of three different widely spaced human mtDNA primer pairs. Lane 1, primers DRJ-3 and DRJ-12 (which recognize sequences that are 7.06 kb apart on normal human mtDNA) produce a Z-kb product; lane 2, primers DRJ-3 and DRJ-16 (6.40 kb apart) produce a 1.4.kb band; lane 3, primers DRJ-15 and DRJ16 (5.90 kb apart) produce a 0.9.kb band. These results are consistent with a 5kb deletion between nt 8581 and nt 13,788. (C!) Amplification of template DNA derived from various tissues of the same patient by use of a single widely spaced primer pair, DRJ-15 and DRJ16, which recognizes sequences that are 5.24 kb apart on normal mtDNA. An identical 229-nt fragment is generated from all four tissues, although the band generated from urinary sediment is less intense. The molecular weight marker is a l-kh ladder (BRL, Gaithersburg, MD).

was otherwise normal. Frozen sections of skeletal muscle revealed abnormal subsarcolemmal collection of mitochondria in about 10 to 20% of muscle fibers, as assessed by the Gomori trichrome and succinic dehydrogenase stain, respectively. Analysis of freshly isolated skeletal muscle mitochondria demonstrated profound diminution of oxygen uptake with succinate, NADH-linked substrates, and TMPD-ascorbate in a pattern indicative of a deficiency of respiratory complex IV (cytochrome oxidase). Southern

Anal,ysis

In order to establish the diagnosis of a mtDNA deletion and to determine the optimal positioning of primers for amplification, we first studied mtDNA extracted from skeletal muscle, by Southern analysis. After

digestion of total muscle DNA with BumHI (which cleaves only at nt 14,258 in the Cambridge sequence) (Anderson et al., 1981), hybridization with a cloned human mtDNA probe revealed two populations of mtDNA: the normal 16.6-kb species and an 11.6-kb species which constituted 65% of the total mtDNA, as assessed by laser densitometry. The 5-kb deletion was localized grossly by hybridization with two additional cloned mtDNA probes to a position between nt 8,000nt 9,000 and nt 13,000-14,000 (Fig. 2). Widely spaced primer PCR was then used to analyze the deleted mtDNA species in the skeletal muscle. PCR amplification was performed with several widely spaced primer pairs that bracketed the deletion and recognized sites on intact mtDNA spaced too widely to permit amplification of the nondeleted species. The resultant products indicated a 5-kb deletion (Fig. 1B). The

626

JOHNS

AND

HURKO

which generates several premature termination codons (Fig. 3). The new sequencethus encodes a “fusion protein,” consisting of the first 60 amino acids of ATPase 6 plus 2 additional amino acids. The genes encoding five transfer RNAs; subunits 3, 4L, and 4 of NADH dehydrogenase; and subunit III of cytochrome oxidase were deleted entirely (Fig. 2). Analysis

T-i:

FIG. 2. Schematic illustration of human mtDNA. The 5.kb deletion in the mitochondrial encephalomyopathy patient is indicated by the arc within the circle. The deleted species hybridized with probes T26 (nt 16,453-nt 32451 and T45 (nt 5274-6203), but did not hybridize with probe 3S18 (nt 11,680-nt 12,570). The location and 5’ to 3’ orientation of the primers used in the WISP-PCR reactions are indicated by the arrowheads. The gene products are abbreviated as follows: 12s and 16S, ribosomal RNAs; NADH 1, 2. 3, 4L, 4, 5, and 6, subunits of NADH-coenzyme Q reductase: CO I, CO II, CO III, subunits of cytochrome oxidase; A8 and A6, subunits of ATP synthetase; and Cyt b, cytochrome b. The origins of heavy- and lightchain replication are indicated by OH and OL, respectively. The 22 transfer RNAs are represented by the small unfilled spaces and the numerals refer to the nucleotide position according to the Cambridge sequence ( 11.

boundaries of the deletion were mapped by restriction endonuclease digestion of the amplification products and visualization on agarose gels. The left breakpoint was estimated to lie between nt 8645 (H&T restriction site present) and nt 8729 (Mb01 restriction site absent), and the right breakpoint was localized to a position between nt 13,712 (HpaII restriction site absent) and nt 13,759 (SfaNI restriction site present.) Sequence

of the Deletion

Breakpoint

Closely bracketing primer sites were then chosen for further amplification and sequencing of the mtDNA region around the deletion (Fig. 1C). Direct sequencing of the widely spaced primer PCR product confirmed the localization that was made by restriction site analysis. The 5.014-kb deletion arose from breakage and religation at nt 8708 and nt 13,722 (Fig. 3). Gross structural alterations (e.g., tandem inverted repeats) or point mutations in the region surrounding the breakpoints were not observed. The deletion breakpoints occur within the genes encoding subunit 6 of ATPase and subunit 5 of NADH dehydrogenase. In the direction of transcription, this results in a frameshift mutation in the remainder of the NADH 5 gene,

of Nonmuscle

Tissue

Southern analysis of total DNA extracted from peripheral blood and urinary sediment showed only normal mtDNA. Nevertheless widely spaced primer PCR amplification of DNA from these tissues revealed the same deletion junction that was observed in skeletal muscle (Fig. 1C). Concurrent control specimens from other patients did not yield detectable amplification products using these primers. The identity of amplification products from skeletal muscle, blood, and urinary epithelium was confirmed by restriction analysis and Southern blotting with cloned mtDNA probes. The sequencebracketing the deletion in blood was identical to that found in skeletal muscle (Fig. 3). Thus blood and urinary epithelial cells contain a substantially smaller proportion of deleted mtDNA (below the detection threshold of Southern analysis) than does skeletal muscle. DISCUSSION

The presence of the mtDNA deletion in cells of mesodermal (muscle, blood) and endodermal (urinary

I

\‘~‘i”l-v 11CAATGkTAATCAAA;TAACCTCA CAATGACTAATCAAACTAACiZTCA A~CAAATGATLACCATAC

AC~AGACT

AAACAAATGATAACCATAC TTCGCAGG ,; II -*/ ), jj I GGAAGCGTATTCGCAG9 AllXTCATTACTAACAACAlll-C Al-lTCTCA?ACTAACAACATTTC

*

’ \ I)1’ _/

FIG. 3. Nucleotide sequence surrounding the pathogenetic mtDNA deletion. The 5,014.kb deletion arose from breakage at nt 8708 after amino acid 60 of ATPase 6 and rejoining at nt 13,722 at amino acid 463 of NADH 5. The frameshift mutation nromntlv 1 .“” eenerates multiple premature termination codons, including those at 8 and 23 nucleotides past the breakpoint. Cam refers to the reference Cambridge sequence t 11 corresponding to the region of the deletion junctions and DH is the sequence of the mitochondrial encephalomyopathy patient’s mtDNA. Amino acid ahhreviations: K, lysine; Q, glutamine; M, methionine; T. threonine; L. leucine; R, arginine: stop, termination codon.

MITOCHONDRIAL

tract epithelium) origin indicates that the deletion must have been present early in embryonic development, before divergence of these lineages. The major differencesin the proportions of mutant and normal mtDNA in various tissues may result from mitotic segregation (Birky, 1978) or selection. Cells that proliferate actively throughout life, such as hematopoietic and epithelial cells, have more opportunities for mitotic segregation than do skeletal muscle cells which are less mitotically active. Random accumulation of a critical proportion of deleted mtDNA could cause proliferative disadvantage or death. Myoblast cultures established from this patient contain deleted mtDNA (Fig. 1C) and should provide a useful experimental system in which to study segregation and selection of the deletions (King and Attardi, 1988). Widely spaced primer PCR analysis of the blood of both parents did not reveal a deleted mtDNA species. Nevertheless, the mtDNA deletion may have originated in a maternal ancestor and increased in relative proportion in embryoblastic cells of our patient to reach pathologically significant levels. Expansion of minor populations of maternal mtDNA during embryogenesis in offspring has been demonstrated in Holstein cows. Heteroplasmy was detectable by Southern analysis in some instances, while in others it could only be inferred by pedigree analysis (Hauswirth and Laipis, 1982). Our findings establish that such cryptic heteroplasmy can exist in human peripheral blood and can in some instances be detected by widely spaced primer PCR. Widely spaced primer PCR analysis is a useful tool for the study of the structure and distribution of deleted mtDNA. The technique should also have broader applicability to other disease states in which pathogenetically important deletions occur in well-defined chromosomal regions, such as those in the Xp21 region in Duchenne muscular dystrophy (Malhotra et al., 1988). ACKNOWLEDGMENTS We thank S. Antonarakis, R. Johnson, J. B. Martin, V. Narayanan, and P. Talalay for critical reviews of the manuscript; 0. C. Stine, B. Baker, and S. L. Rutledge for helpful suggestions; and M. Mordes for referral of his patient to our clinic. Muscle cultures were prepared by L. McKee, isolation of mitochondria and polarography were performed by T. Chechik, and muscle biopsy and histologic analysis were performed by D. B. Drachman. This work supported by NIH Grant ROl AR38231 and grants from the Muscular Dystrophy Association. REFERENCES 1. ANDERSON, S., BANKIER, A. T., BARRELL, B. G., DE BRUIJN, M. H. L., COULSON, A. R., DROUIN, J., EPERON, I. C., NIERLICH, 1). P., ROE, B. A., SANGER., F., SCHREIER, P. H., SMITH, A. J. H., STADEN, R., AND YOUNG, I. G. (1981). Sequence and

627

DNA DELETION

2.

3.

4. 5.

6. 7.

8.

organization of the human mitochondrial genome. Nature (London) 290: 457-465. ATTARDI, G., CHOMYN, A., DOOLITTLE, R. F., MARIOTTINI, P., AND RAGAN, C. I. (1986). Seven unidentified reading frames of human mitochondrial DNA encode subunits of the respiratory chain NADH dehydrogenase. CoM Spring Harbor Symp. Quunt. Biol. 51: 103-114. BERENBERG, R. A., PELLOCK, J. M., DIMAURO, S., SCHOTLAND, D. L., BONILLA, E., EASTWOOD, A., HAYS, A., VICALE, C. T., BEHRENS, M., CHUTORIAN, A., AND ROWLAND, L. P. (1977). Lumping or splitting? ‘Ophthalmoplegia-plus’ or Kearns-Sayre syndrome? Ann. Neural. 1: 37-54. BIRKY, C. W. (1978). Transmission genetics of mitochondria and chloroplasts. Annu. Reu. Genet. 12: 471-512. BOCENHAGEN, D., AND CLAYTON, D. A. (1974). The number of mitochondrial deoxyribonucleic acid genomes in mouse L and human HeLa cells: Quantitative isolation of mitochondrial deoxyribonucleic acid. J. Biol. Chem. 249: 7991-7995. DUBOWITZ, V., AND BROOKE, M. H. (1973). “Muscle Biopsy: A Modern Approach,” Saunders, London. EGGER, J., AND WILSON, J. (1983). Mitochondrial inheritance in a mitochondrially mediated disease. N. Engl. J. Med. 309: 142-145. HAUSWIRTH, W. W., AND LAIPIS, P. J. (1982). Mitochondrial DNA polymorphism in a maternal lineage of Holstein cows. Proc.

Natl.

Acad.

Sci.

USA

79:

4686-4690.

9. HIGUCHI, R., VON BEROI~DINGEN, C. H., SENSABAIJGH, G. F., AND ERLICH, H. A. (1988). DNA typing from single hairs. Nature (London)

332:

543-546.

10. HOI/~, I. J.. COOPER, J. M., MORGAN-HITGHES, J. A., AND HARDING, A. E. (1988a). Deletions of muscle mitochondrial DNA. Lancet i: 1462. 11. HOLT, I. J., HARDING, A. E., AND MORGAN-HUGHES, J. A. (1988b). Deletions of muscle mitochondrial DNA in patients with mitochondrial myopathies. Nature (London) 331: 717719. 12. HUDSON, B., UPHOLT, W. B., DEVINNY, J., AND VINOGRAD, J. (1969). The use of an ethidium analogue in the dye-buoyant density procedure for the isolation of closed circular DNA: The variation of the superhelix density of mitochondrial DNA. Proc. Natl. Acad. Sci. lJSA 62: 813-820. 13. KING, M. P., AND ATTARDI, G. (1988). Injection of mitochondria into human cells leads to a rapid replacement of the endogenous mitochondrial DNA. Cell 52: 811-819. 14. LESTIENNE, P., AND PONSOT, G. (1988). Kearns-Sayre syndrome with muscle mitochondrial DNA deletion. Lancet i: 885. 15. MALHOTRA, S. B., HART, K. A., KLAMUT, H. J., THOMAS, N. S., BODRUG, S. E., BURGHES, A. H., BOBROW, M., HARPER, P. S., THOMPSON, M. W., RAY, P. N., AND WORTON, R. G. (1988). Frame shift deletions in patients with Duchenne and Becker muscular dystophy. Science 242: 755-759. 16. MOREADITH, R. W., BATSHAW, M. L., OHNISHI, T., KERR, D., KNOX, B., JACKSON, D., HRUBAN, R., OLSON, J., REYNAFARJE, B., AND LEHNINGER, A. L. (1984). Deficiency of the iron-sulfur clusters of mitochondrial reduced nicotinamide-adenine dinucleotide-ubiquinone oxidoreductase (complex I) in an infant with congenital lactic acidosis. J. Clin. Invest. 74: 685-697. 17. OZA~A, T.. YONEDA, M., TANAKA, M., OHNO, K., SATO, W., SUZUKI, H., NISHIKIMI, M., YAMAMOTO, M., NOP~AKA, I., AND HORAI, S. (1988). Maternal inheritance of deleted mitochondrial DNA in a family with mitochondrial myopathy. Biochem. Biophys. i?es. Commun. 154: 1240-1247. 18. PAVLAKIS, S. G., PHILLIPS, P. C., DIMA~JRO, S., DEVIVO, D. C.,

628

19.

20.

21.

22.

JOHNS AND HURKO AND ROWLAND, L. P. (1984). Mitochondrial myopathy, encephalopathy, lactic-acidosis and stroke-like episodes: A distinctive clinical syndrome. Ann. Neural. 16: 481-488. PE?TY, R. K. H., HARDING, A. E., AND MORGAN-HUGHES. J. A. (1986). The clinical features of mitochondrial myopathy, Brain 109: 915-938. ROSING, H. S., HOPKINS, L. C., AND WAI~LACE, D. C. (19851. Maternally inherited mitochondrial myopathy and myoclonic epilepsy. Ann. Neural. 17: 228-237. SAIFFUOIN-NOER, A., MARZUKI, S., TROUNCE, I., AND BYRNE, E. (1988). Mitochondrial DNA deletion in encephalomyopathy. Lancet ii: 125331254. SAIKI, R. K., GELFAND, D. H., STOFFELL, S., SCHARF, S. J., HIGUCHI, R., HORN, G. T., MULLIS, K. B., AND EHRLICH, H. A. (1988). Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239: 487-491.

23. WALLACE, D. C., SINGH, G., LOTT, M. T., HODGE, J. A., SCHURR, T. G., LEZZA, A. M., ELSAS, L. J., II, AND NIKOSKELAINEN, E. K. (1988a). Mitochondrial DNA mutation associated with Leber’s hereditary optic neuropathy. Science 242: 1427-1430. 24. WALLACE, D. C., ZHENG, X. X., LOTT, M. T., SHOFFNER,J. M.. HODGE, .J. A., KEI,I,EY, R. I,, EPSTEIN, C. M., AND HOPKINS, L. C. (1988b). Familial mitochondrial encephalomyopathy (MERRF): Genetic, pathophysiological, and biochemical characterization of a mitochondrial DNA disease. Cell 55: 601-610. 25. YASIN, R., VAN BEERS, G., NURSE, K. C. E., LANDON, D., AND THOMPSON, E. J. (19771. A quantitative technique for growing human adult skeletal muscle in culture starting from mononucleated cells. J. Neural. Sci. 32: 347-360. 26. ZEVIANI, M., MORAES, C. T., DIMAURO, S., NAKASE, H., BoNILLA, E., SCHON, E. A., AND ROWLAND, L. P. (1988). Deletions of mitochondrial DNA in Kearns-Sayre syndrome. Neurology 38: 1339-1346.