Plasmodium falciparum: Generation of a cDNA Library Enriched in Sporozoite-Specific Transcripts by Directional Tag Subtractive Hybridization

Experimental Parasitology 95, 220–225 (2000) doi:10.1006/expr.2000.4528, available online at http://www.idealibrary.com on

RESEARCH BRIEF Plasmodium falciparum: Generation of a cDNA Library Enriched in SporozoiteSpecific Transcripts by Directional Tag Subtractive Hybridization

David A. Fidock,*,†,1 Thanh V. Nguyen,* Jose M. Ribeiro,‡ Jesus G. Valenzuela,‡ and Anthony A. James* *Department of Molecular Biology and Biochemistry, University of California, Irvine, California 92697, †Malaria Genetics Section and ‡Medical Entomology Section, Laboratory of Parasitic Diseases, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Maryland 20892-0425, U.S.A.

Fidock, D. A., Nguyen, T. V., Ribeiro, J. M., Valenzuela, J. G., and James, A. A., 2000. Plasmodium falciparum: Generation of a cDNA library enriched in sporozoite-specific transcripts by directional tag subtractive hybridization. Experimental Parasitology 95, 220–225. We have adapted the ‘‘directional tag subtractive hybridization’’ technique as a means of investigating stage-specific gene expression in Plasmodium falciparum. This technique utilizes unidirectional cDNA libraries cloned into separate lambda vectors and involves hydroxyapatite chromatographic separation of target antisense cDNA and driver sense strand cRNA followed by PCR amplification of cDNA sequences specific to the target stage. This technique enabled efficient subtraction of asexual blood stage sequences from a P. falciparum sporozoite cDNA library and led to identification of novel sporozoite sequences. This technique can be applied to study gene expression in parasite stages that are difficult to obtain routinely. q 2000 Academic Press Index Descriptors and Abbreviations: Plasmodium falciparum; protozoa; parasitic; malaria; human; stage-specific gene expression; subtraction; lambda cDNA libraries; SPZ, sporozoite; ABS, asexual blood stages.

in gene expression as this obligate intracellular parasite cycles through tissues of the vertebrate and mosquito hosts. With the exception of the readily cultured asexual blood stages (ABS), the different developmental forms of the parasite cannot be isolated in large numbers, thus hindering their molecular analysis. However, such analyses are needed to identify parasite genes critical for host cell invasion, induction, or targeting of stage-specific immunity and to understand the biochemistry that is specific to the different developmental stages. Subtractive hybridization is an efficient means of isolating stagespecific genes and has proven its utility in a number of eukaryotic systems (Swendeman and La Quaglia 1996; Wong et al. 1997). One such method, “directional tag subtractive hybridization,” is based on plasmid cDNA libraries and was used to study differential gene expression in regions of mouse brains or between normal mice and those with neurological disorders (Gautvik et al. 1996; Usui et al. 1994). This method minimizes the need to repeatedly extract stage-specific RNA and requires only the initial isolations for making the cDNA libraries. We have adapted the original method to allow it to be used with lambda phage cDNA libraries and to accommodate the high AT content of Plasmodium parasites. Phage cDNA libraries appear to have an advantage over plasmid libraries when working with Plasmodium species in that they can accommodate larger fragment inserts and show less sequence rearrangement and “scrambling” (Goman et al. 1982; our unpublished observations with cloning of the repeat region of the P. gallinaceum CS gene). We have optimized this subtraction method to begin characterization of P. falciparum genes expressed in sporozoites (SPZ) but not in ABS. Sporozoites are of interest because of their ability to invade mosquito salivary glands and human hepatocytes, as well as the repeated demonstration that immunization of humans with irradiated SPZ confers protection against experimental

The Plasmodium falciparum lifecycle is marked by major changes

1

To whom correspondence should be addressed at current address: Department of Microbiology and Immunology, Albert Einstein College of Medicine, 1300 Morris Park Avenue, The Bronx, NY 10461. Email:[email protected].

220

0014-4894/00 $35.00 Copyright q 2000 by Academic Press All rights of reproduction in any form reserved.

SPOROZOITE-SPECIFIC cDNA LIBRARIES

221

FIG. 1. Schematic outline of subtractive hybridization procedure applied to the generation of a P. falciparum cDNA library enriched in SPZspecific transcripts. The flanking vector sequences for the target and driver populations are sufficiently different such that target–driver association is restricted only to sequences that have homologous inserts. This requires that the initial libraries be cloned in the two different lambda vectors, which have markedly different nucleotide sequences in their multiple cloning sites flanking the inserts. SK8 Xho-T, T7, BK-58, and T3 refer to the name of the oligonucleotide primers used to amplify cDNAs (Fidock et al. 2000a). The location of various restriction endonuclease sites are indicated: A, Apa I; B, Bam HI; C, Cla I; E, Eco RI; K, Kpn I; N, Not I; P, Pst I; S, Sac I; Sm, Sma I; Sp, Spe I; and X, Xho I. The 58 and 38 indicate the orientation of the cDNA inserts (dotted and textured bars).

challenge (Egan et al. 1993; Herrington et al. 1991). In addition to the vaccine research, the identification of novel SPZ genes, including those involved in the cellular invasion process, may lead to novel control or therapeutic targets. Here we summarize briefly our modified directional tag subtraction protocol and show results of gene amplification experiments that validate the procedure. Step-by-step procedures are detailed in Fidock et al. (2000a) and are available upon request. The procedure (Fig. 1) begins with preparation of total RNA from the “target” and “driver” stages of the parasite and construction of lambda cDNA libraries (detailed in Fidock et al. 2000b). High-quality RNA can be rapidly purified using Trizol (Life Technologies). Poly(A)+ mRNA is then isolated following two rounds of purification over an oligo(dT) resin (we favor Oligotex by Qiagen). Messenger RNA is primed using an oligo(dT) linker-primer that contains a 58-end Xho I site and is transcribed using monkey murine leukemia virus reverse transcriptase and 5-methyl dCTP (provided in the Stratagene cDNA synthesis kit). The 5-methyl dCTP hemimethylates the cDNA, which protects Xho I digestion of internal sites, such that only the unmethylated site in the linker-primer is cleaved during the subsequent cloning step. Once the cDNA synthesis is complete, the uneven termini of the double-stranded cDNA are repaired by the exonuclease and polymerase activities of Pfu DNA polymerase (Stratagene). Eco RI adapters are ligated onto the blunt-end DNA fragments and these products are

digested with Xho I. The resulting cDNAs with 58-end Eco RI and 38end Xho I sites are size-selected for .0.6-kb products by gel filtration using Chroma Spin 400 columns (Clontech). The target and driver cDNAs are unidirectionally ligated into the lambda Uni-ZAP XR and ZAP Express phage vectors (Stratagene), respectively. Packaging of recombinant lambda phage is performed using Gigapack III Gold packaging extracts (Stratagene). After amplification of the cDNA libraries, phage DNA is purified (using the Qiagen Lambda Maxi kit) and this serves as the template for generation of complementary RNA (cRNA) or antisense cDNA. To prepare target antisense cDNA, the target phage DNA is first linearized with Not I, and single-strand antisense cDNA is generated by 25 rounds of gene amplification using an Xho I–oligo (dT) linker-primer and biotin-labeled dUTP. This antisense cDNA is recovered by incubation of the amplification mixture with streptavidin-coated paramagnetic beads, and the cDNA is eluted by the addition of 0.2 N NaOH, 0.05% Tween 20 and rapidly neutralized with 1 M Tris?Cl, pH 7.5. For production of driver sense-strand cRNA, phage DNA is linearized with Not I and purified, and cRNA is generated using T3 RNA polymerase (Megascript kit; Ambion). Phage DNA is removed by 2 rounds of DNase I digestion and the cRNA is precipitated with NH4OAc. Target antisense cDNA and driver cRNA are then coincubated for 24 h at 688C in a 1:50 molar ratio to enable association of complementary

222 (common) sequences. Single-stranded target-specific cDNA is separated from the duplexed common target cDNA/driver cRNA by hydroxyapatite chromatography, with the target cDNA population eluting in 120 mM phosphate buffer. The eluted fractions containing the target cDNA are desalted and any contaminating cRNA is hydrolyzed. The single-stranded, subtracted target cDNA is amplified for 25 cycles to convert it to double-stranded cDNA with the primers Xho-T and SK8 (the latter is specific for the target library; Fig. 1). Purified products can be cloned into the plasmid vector pGEM-3Z (Promega). Alternatively, the subtracted products can be directionally cloned into a lambda phage expression vector, such as Lambda UniZap (Stratagene). This lambda vector expresses cDNAs as a fusion product with the lac Z gene, making it possible to immunoscreen these libraries. We have generated a target library from P. falciparum SPZ isolated from dissected Anopheles gambiae salivary glands. The driver libraries were generated from uninfected A. gambiae salivary glands as well as P. falciparum asynchronous ABS cultured in vitro. Both P. falciparum libraries were made from cDNA of the NF54 strain, the parental line of the genome reference clone 3D7. The SPZ, uninfected salivary gland, and ABS cDNA libraries were made from 0.2, 0.35, and 0.5 mg of poly(A)+ RNA, respectively, and contained 1.1 3 106, 7.0 3 104, and 1.9 3 106 primary inserts, with the percentage of recombinant clones at 93, 73, and 90%. The uninfected salivary gland cDNA library was made because our initial analysis of the SPZ library revealed that over 98% of the inserts were derived from the mosquito host, despite trituration of the glands during dissection and washing of the SPZ pellet. The identification of each cDNA insert as being of either A. gambiae or P. falciparum origin was facilitated initially by differences in nucleotide composition and the length of 38-end polyadenylated (poly-A) sequences. P. falciparum coding regions are typically about 75% AT rich (Bowman et al. 1999; Gardner et al. 1998), as opposed to the ,40–50% A-T content that we observe for A. gambiae. Also, we found that A. gambiae oligo(dT)-primed cDNA sequences generally carry a 40- to 60-nucleotide poly-A 38-end, whereas the poly-A region of P. falciparum, if present, is small (,15 nucleotides). Oligod (dT) annealing of P. falciparum mRNA often initiates first-strand cDNA synthesis from 38-end, untranslated A-rich regions and can frequently prime from A-rich stretches near the 38-end of the coding sequence. Final assignment of the origin of the DNA insert to parasite or host mosquito was made by gene amplification with internal oligonucleotide primers against genomic DNA. Initial sequencing of 12 randomly chosen cDNAs from the unidirectionally cloned SPZ-infected salivary gland library revealed that these contained unique A. gambiae inserts with open reading frames in the correct orientation. Computer analysis with data in the gene banks revealed that the conceptual translation products of 3 of the cDNAs had a high degree of similarity to ribosomal proteins S17 or L8 or the elongation initiation factor 4C (1A) described in other species. These genes have been designated AgS17, AgL8, and AgelF-4C, respectively (Table I). The remaining nine clones had novel cDNA inserts. Diagnostic gene amplification was used to assess the presence of known SPZ genes and possible genomic DNA contamination in this library (Table 1 and Fig. 2). Oligonucleotide primer pairs specific for the CS (circumsporozoite; Dame et al. 1984; Enea et al. 1984), TRAP (thrombospondin-related anonymous protein; Robson et al. 1988; also known as sporozoite surface protein-2; Rogers et al. 1992), and ribosomal phosphoprotein P2 (Fidock et al. 1998) genes all gave a pcR amplification product of the correct size (Fig. 2A). Primers located on

FIDOCK ET AL.

either side of the 38-end intron in the SALSA gene (sporozoite and liver stage antigen; Bottius et al. 1996; also known as merozoite surface protein-4; Marshall et al. 1997) gave a 220-bp product of the size expected for a cDNA species, with no evidence of a 364-bp fragment that would have resulted from contaminating genomic DNA. To confirm the SPZ nature of the cDNA library, we determined the NF54 sequence of the rRNA small subunit (SSU) gene sequences expressed during the SPZ and ABS, previously defined for the 7G8 clone (Gunderson et al. 1987). The presence of rRNA sequences in Plasmodium cDNA libraries results from oligo(dT) priming of the AT-rich rRNA transcripts and is a common finding (Rogers et al. 1995). Gene amplification revealed an abundant product with SPZ-specific SSU primers, with the ABS-specific primers also giving evidence of low levels of transcription of this gene unit during the SPZ stage. Gene amplification with primers from the parasite ABS genes MSP-1 and MSP-2 (merozoite surface proteins 1 and 2; Hall et al. 1984; Holder et al. 1985; Mackay et al. 1985; Smythe et al. 1988) were negative. Finally, amplification of the three A. gambiae genes, AgS17, AgL8, and AgelF-4C, gave products of the expected cDNA sizes, with no visually detectable bands corresponding to potentially contaminating genomic DNA fragments in the multiexonic genes AgS17 and AgL8 (Fig. 2A and Table I). All oligonucleotide primer pairs tested against this library were positive by gene amplification against genomic DNA from the corresponding organism (Fig. 2A). From this, we can conclude that this cDNA library had no detectable genomic DNA contamination and that it contained P. falciparum genes that are known to be expressed during the SPZ stage. Recent sequencing of more than 300 cDNA inserts (on a CEQ2000 DNA sequencing instrument; Beckman Coulter Inc., Fullerton, CA) revealed one clone, DB589 (GenBank Accession No. AF250760), with complete homology to an internal coding region of the P. falciparum PFC1010C gene, predicted from the chromosome 3 sequence using the HexExon algorithm (Bowman et al. 1999). The corresponding 404-amino acid gene product (MAL3P7.31; protein ID CAB39044) shows significant homology (PSI-BLAST E values ,10216 with one iteration) to hypothetical proteins related to the HesB family from bacteria including Neisseria, Haemophilus, and Synechocystis spp., yeast including Saccharomyces and Schizosaccharomyces spp., and plants including Arabidopsis and Porphyra spp. This HesB family is involved in nitrogen fixation in some bacterial species; however, its role in P. falciparum remains unclear. We note that a PFC1010C homolog, known as PFB0320C, is present on chromosome 2. The corresponding 160-amino acid product (locus AAC71853) shows slightly lower homology to the HesB protein family and was previously noted to possibly have redox activity (Gardner et al. 1998). We have applied the subtractive hybridization technique outlined above to the SPZ-infected salivary gland library to deplete it of parasite sequences also expressed during the ABS, as well as mosquito sequences derived from uninfected salivary glands. The subtracted library was cloned into the plasmid vector pGEM-3Z, yielding 2 3 105 recombinant clones. To assess the efficacy of subtraction, we applied the same diagnostic gene amplifications against the subtracted library now enriched for P. falciparum SPZ-specific sequences. Amplification with the SPZ genes CS and TRAP showed that these genes were still retained in the subtracted library (Fig. 2B). This is expected for the CS gene, which is not believed to be transcribed at any significant levels in the ABS (Me´nard et al. 1997; Nussenzweig and Nussenzweig 1989), and provides evidence in favor of the SPZ-specific expression of the TRAP gene, which has been a matter of contention (Robson et al. 1988;

223

SPOROZOITE-SPECIFIC cDNA LIBRARIES

TABLE I Primers Used for Diagnostic PCR on Nonsubtracted and Subtracted cDNA Libraries Gene

Organism

a

CS

P. falciparum

TRAPb

P. falciparum

P2c

P. falciparum

SSU-SPZd

P. falciparum

SSU-ABSe

P. falciparum

MSP-2f

P. falciparum

MSP-1g

P. falciparum

SALSAh

P. falciparum

AgS17i

A. gambiae

AgL8j

A. gambiae

AgeIF-4Ck

A. gambiae

Primer sequences gctctgctaataaacctaaagac gataataccattattaatcctattg gaggattagctttactcgcatg atctgaattgttcaggttcgtc cattaaaaggaaagagttgcc ggaaaatcctaagtcgtcttc aaaatgtacttataaataagtgtg tgcttactaggcattcctcg atctttgcttatattttgcatac tgcttactaggcattcctcg accagagaataaaggtacaggac acagttttctttgttaccatcgg ggtggatgtgatgcagatgc ggaactgcagaaaataccatc ccttcgttgtggtcttcctcc tccctaaaaaggtagttcaacc agtggccatcattccgacg acacacacagtattacaggag agcccaagctgcgccatc ccggtgtacataccttcgg aactgatcttcaaggaggatg gtacgtcttcagatttcgggc

cDNA length (bp)

gDNA length (bp)

Accession No.

130

130

M22982

145

145

X13022

188

188

PFU78753

132

132

M19173l

126

126

M19172l

115

115

M28891

123

123

Z35327

220

364

365

1407

U85260 AE001386 AF164153

178

286

AF164152

245

245

AF164151

a

Encodes sporozoite surface protein. Encodes sporozoite micronemal and surface-associated protein, also known as PfSSP2. c Encodes ribosomal phosphoprotein expressed by sporozoites and asexual blood stages. d rRNA small subunit sequence predominantly expressed during sporozoite stage. e rRNA small subunit sequence predominantly expressed by asexual blood stages. f Encodes asexual blood stage merozoite surface protein-2. g Encodes asexual blood stage merozoite surface protein-1. h Encodes sporozoite- and liver-stage protein; also described as asexual blood-stage merozoite surface protein-4. i Encodes ribosomal protein S17. j Encodes ribosomal protein L8. k Encodes translation initiation factor 4C (1A). l These primers were generated using sequence data from S-type and A-type SSUs in the NF54 strain, revealing sequence polymorphisms with the GenBank sequences generated from the 7G8 strain. b

Rogers et al. 1992). In contrast, no products were amplified from either the P. falciparum P2 gene, expressed in both SPZ and ABS (Fidock et al. 1998), or the SPZ-specific SSU sequence, indicating their efficient removal during the subtractive hybridization. Subtraction of the SPZspecific SSU sequences is expected on the basis that the SPZ and ABS rRNA sequences show over 98% similarity, permitting efficient duplex association and subtraction. Lack of genomic DNA contamination was supported by the absence of detectable amplification with the MSP-2 or MSP-1 oligonucleotide primers. When testing for the presence of the three A. gambiae genes L8, S17, and elF-4C, we observed a high degree of subtraction, with only the latter gene showing some trace amplification (Fig. 2B). We propose that this trace amplification results from the use for this prototype library of only a single round of subtraction and that more efficient subtraction would be obtained with

an additional one to two rounds of subtraction, as reported in the original directional tag PCR studies (Gautvik et al. 1996; Usui et al. 1994). Independent confirmation of the efficiency of subtraction came from screening of the nonsubtracted and subtracted SPZ cDNA libraries, which showed a respective increase in CS gene representation from 0.1 to 6% (data not shown). Preliminary sequence analysis of subtracted SPZ libraries indicated two matches with the P. falciparum genome database. One clone, DD50 (GenBank Accession No. AF250761), corresponded to a region of the fragmented large subunit rRNA present on the parasite 6-kb mitochondrial genome (see GenBank Accession Nos. M76611 and M99416), suggesting that this rRNA sequence is expressed in SPZ along with the chromosomal SPZ-specific rRNA locus. The other, MB17 (GenBank Accession No. AF250762), corresponded to the PFPFC1060C gene,

224

FIDOCK ET AL.

FIG. 2. Diagnostic PCR of P. falciparum SPZ cDNA library before (A) and after (B) subtraction. (A) The products left of the central Low Mass ladder result from gene amplification with primers specific for designated genes, CS, TRAP, P2, SSU-SPZ, SSU-ABS, MSP-2, MSP-1, SALSA, AgS-17, AgL8, and AgelF4C, tested against the P. falciparum SPZ-infected A. gambiae salivary gland cDNA library. Gene amplifications with P. falciparum or A. gambiae genomic DNA are shown to the right of the Low Mass ladder, demonstrating that all primer pairs amplified appropriate control fragments and that gene fragments detected in the cDNA library were from transcribed sequences and were not a result of genomic DNA contamination. Low Mass ladder (Gibco BRL) fragment sizes are, from top to bottom, 2000, 1200, 800, 400, 200, and 100 bp in length. (B) Results of testing primers specific for diagnostic genes against the subtracted cDNA library enriched for P. falciparum SPZ-specific transcripts. The A. gambiae sequences, Ag517, AgL8, and AgelF4C, have been deposited in GenBank under the Accession Nos. AF164153, AF164152, and AF164151. All PCR amplifications were carried out using 30 cycles.

located 45 kb distal to the PFC1010C gene on chromosome 3 (Bowman et al. 1999). Analysis of the predicted full-length protein product (MAL3P7.43; protein ID CAB39050) shows multiple regions of significant homology (PSI-BLAST E values ,1024 with one iteration) with the CG6686 gene product (AAF53138), identified during the course of the sequencing of the Drosophila melanogaster genome project, and related proteins. These related proteins include a human IgE autoantigen (CAA74694), the mouse protein SART-1 (BAA24056) that is thought to be involved in epithelial cell proliferation, the mouse protein MSART-1 (BAA36583) that shares homology with the human tumor-rejection antigen SART-1 (BAA24056), and a mouse hypoxia associated factor (AAD20645) that is proposed to function as a cellular growth factor. By analogy, it is possible that the malaria parasite protein MAL3P7.43 may be involved in cell development during the sporogonic or hepatic stages and might have antigenic features, though this is speculative at present. Large-scale sequencing analysis of the subtracted SPZ cDNA library should now allow a more complete molecular characterization of this important stage, for which we presently know the expression of fewer than a dozen documented genes. This subtractive hybridization method should also be useful to gain further understanding of other underinvestigated developmental stages during the lifecycle of the P. falciparum malaria pathogen.

ACKNOWLEDGMENTS (The authors thank Lynn Olson for help in preparing the manuscript. D.A.F. gratefully acknowledges the Pasteur Institute for their support. This work was funded by an award from the Burroughs-Wellcome Fund to A.A.J.)

REFERENCES Bottius, E., BenMohamed, L., Brahimi, K., Gras, H., Lepers, J.-P., Raharimalala, L., Aikawa, M., Meis, J., Slierendregt, B., Tartar, A., Thomas, A., and Druilhe, P. 1996. A novel Plasmodium falciparum sporozoite and liver stage antigen (SALSA) defines major B, T helper, and CTL epitopes. Journal of Immunology 156, 2874–2884. Bowman, S., Lawson, D., Basham, D., Brown, D., Chillingworth, T., Churcher, C. M., Craig, A., Davies, R. M., Devlin, K., Feltwell, T., Gentles, S., Gwilliam, R., Hamlin, N., Harris, D., Holroyd, S., Hornsby, T., Horrocks, P., Jagels, K., Jassal, B., Kyes, S., McLean, J., Moule, S., Mungall, K., Murphy, L., Olivedr, K., Quail, M. A.,

225

SPOROZOITE-SPECIFIC cDNA LIBRARIES

Rajandream, M.-A., Rutter, S., Skelton, J., Squares, R., Squares, S., Sulston, J. E., Whitehead, S., Woodward, J. R., Newbold, C., and Barrell, B. G. 1999. The complete nucleotide sequence of chromosome 3 of Plasmodium falciparum. Nature 400, 532–538. Dame, J. B., Williams, J. L., McCutchan, T. F., Weber, J. L., Wirtz, R. A., Hockmeyer, W. T., Maloy, W. L., Haynes, J. D., Schneider, I., Roberts, D., Sanders, G. S., Reddy, E. P., Diggs, C. L., and Miller, L. H. 1984. Structure of the gene encoding the immunodominant surface antigen on the sporozoite of the human malaria parasite Plasmodium falciparum. Science 225, 593–599. Egan, J. E., Hoffman, S. L., Haynes, J. D., Sadoff, J. C., Schneider, I., Grau, G. E., Hollingdale, M. R., Ballou, W. R., and Gordon, D. M. 1993. Humoral immune responses in volunteers immunized with irradiated Plasmodium falciparum sporozoites. American Journal of Tropical Medicine and Hygiene 49, 166–173. Enea, V., Ellis, J., Zavala, F., Arnot, D., Asavanich, A., Masuda, A., Quakyi, I., Nussenzweig, R. S., and Nussenzweig, V. 1984. DNA cloning of Plasmodium falciparum circumsporozoite gene: Amino acid sequence of the repetitive epitope. Science 225, 628–630. Fidock, D. A., Nguyen, T. V., Beerntsen, B., and James, A. A. 2000a. Subtractive hybridization applied to Plasmodium falciparum. In “Malaria Methods and Protocols” (D. L. Doolan, Ed.). Humana Press, Totowa, NJ., in press. Fidock, D. A., Rathore, D., and McCutchan, T. F. 2000b. Construction of Plasmodium falciparum l cDNA libraries. In “Malaria Methods and Protocols” (D. L. Doolan, Ed.). Humana Press, Totowa, NJ, in press. Fidock, D. A., Nguyen, T. V., Dodemont, H., Eling, W. M., and James, A. A. 1998. Plasmodium falciparum: Identification of the ribosomal P2 protein gene whose expression is independent of the developmentally regulated rRNAs. Experimental Parasitology 89, 125–128. Gardner, M. J,, Tettelin, H., Carucci, D. J., Cummings, L. M., Aravind, L., Koonin, E. V., Shallom, S., Mason, T., Yu, K., Fujii, C., Pederson, J., Shen, K., Jing, J., Aston, C., Lai, Z., Schwartz, D. C., Pertea, M., Salzberg, S., Zhou, L., Sutton, G. G., Clayton, R., White, O., Smith, H. O., Frawer, C. M., Adams, M. D., Venter, J. C., and Hoffman, S. L. 1998. Chromosome 2 sequence of the human malaria parasite Plasmodium falciparum. Science 282, 1126–1132. Gautvik, K. M., de Lecea, L., Gautvik, V. T., Danielson, P. E., Tranque, P., Dopazo, A., Bloom, F. E., and Sutcliffe, J. G. 1996. Overview of the most prevalent hypothalamus-specific mRNAs, as identified by directional tag PCR subtraction. Proceedings of the National Academy of Sciences USA 93, 8733–8738. Goman, M., Langsley, G., Hyde, J. E., Yankovsky, N. K., Zolg, J. W., and Scaife, J. G. 1982. The establishment of genomic DNA libraries for the human malaria parasite Plasmodium falciparum and identification of individual clones by hybridisation. Molecular and Biochemical Parasitology 5, 391–400. Gunderson, J. H., Sogin, M. L., Wollett, G., Hollingdale, M., de la Cruz, V. F., Waters, A. P., and McCutchan, T. F. 1987. Structurally distinct, stage-specific ribosomes occur in Plasmodium. Science 238, 933–937. Hall, R., Hyde, J. E., Goman, M., Simmons, D. L., Hope, I. A., Mackay, M., Scaife, J., Merkli, B., Richle R., and Stocker J. 1984. Major surface antigen gene of a human malaria parasite cloned and expressed in bacteria. Nature 311, 379–382.

Herrington, D., Davis, J., Nardin, E., Beier, M., Cortese, J., Eddy, H., Losonsky, G., Hollingdale, M., Stzein, M., Levine, M., Nussenzweig, R. S., Clyde, D., and Edelman, R. 1991. Successful immunization of humans with irradiated malaria sporozoites: Humoral and cellular responses of the protected vaccines. American Journal of Tropical Medicine and Hygiene 45, 539–547. Holder, A. A., Lockyer, M. J., Odink, K. G., Sandhu, J. S., RiverosMoreno, V., Nicholls, S. C., Hillman, Y., Davey, L. S., Tizard, M. L., Schwarz, R. T., and Freeman, R. F. 1985. Primary structure of the precursor to the three major surface antigens of Plasmodium falciparum merozoites. Nature 317, 270–273. Mackay, M., Goman, M., Bone, N., Hyde, J. E., Scaife, J., Certa, U., Stunnenberg, H., and Bujard, H. 1985. Polymorphism of the precursor for the major surface antigens of Plasmodium falciparum merozoites: Studies at the genetic level. EMBO Journal 4, 3823–3829. Marshall, V. M., Silva, A., Foley, M., Cranmer, S., Wang, L., McColl, D. J., Kemp, D. J., and Coppel, R. L. 1997. A second merozoite surface protein (MSP-4) of Plasmodium falciparum that contains an epidermal growth factor-like domain. Infection and Immunity 65, 4460–4467. Me´nard, R., Sultan, A. A., Cortes, C., Altszuler, R., van Djik, M. R., Jamse, C. J., Waters, A. P., Nussenzweig, R. S., and Nussenzweig, V. 1997. Circumsporozoite protein is required for development of malaria sporozoites in mosquitoes. Nature 385, 336–340. Nussenzweig, V., and Nussenzweig, R. S. 1989. Rationale for the development of an engineered sporozoite malaria vaccine. Advances in Immunology 45, 283–334. Robson, K. J., Hall, J. R., Jennings, M. W., Harris, T. J., Marsh, K., Newbold, C. I., Tate, V. E., and Weatherall, D. J. 1988. A highly conserved amino-acid sequence in thrombospondin, properdin and in proteins from sporozoites and blood stages of a human malaria parasite. Nature 335, 79–82. Rogers, M. J., McConkey, G. A., Li, J., and McCutchan, T. F. 1995. The ribosomal DNA loci in Plasmodium falciparum accumulate mutations independently. Journal of Molecular Biology 254, 881–891. Rogers, W. O., Malik, A., Mellouk, S., Nakamura, K., Rogers, M. D., Szarfman, A., Gordon, D. M., Nussler, A. K., Aikawa, M., and Hoffman, S. L. 1992. Characterization of Plasmodium falciparum sporozoite surface protein 2. Proceedings of the National Academy of Sciences USA 89, 9176–9180. Smythe, J. A., Coppel, R. L., Brown, G. V., Ramasamy, R., Kemp, D. J., and Anders, R. F. 1988. Identification of two integral membrane proteins of Plasmodium falciparum. Proceedings of the National Academy of Sciences USA 85, 5195–5199. Swendeman, S. L., and La Quaglia, M. P. 1996. cDNA subtraction hybridization: A review and an application to neuroblastoma. Seminars in Pediatric Surgery 5, 149–154. Usui, H., Falk, J. D., Dopazo, A., de Lecea, L., Erlander, M. G., and Sutcliffe, J. G. 1994. Isolation of ciones of rat striatum-specific mRNAs by directional tag PCR subtraction. Journal of Neuroscience 14, 4915–4926. Wong, B., Park, C. G., and Choi, Y. 1997. Identifying the molecular control of T-cell death: On the hunt for killer genes. Seminars in Immunology 9, 7–16. Received 5 January 2000; accepted with revision 16 May 2000