Plasma Membrane Ca²⁺-ATPase Isoform Expression in Human Cataractous Lenses Compared to Age-Matched Clear Lenses

Original Paper Ophthalmic Res 2008;40:86–93 DOI: 10.1159/000113886

Received: October 23, 2006 Accepted after revision: July 14, 2007 Published online: January 25, 2008

Plasma Membrane Ca2+-ATPase Isoform Expression in Human Cataractous Lenses Compared to Age-Matched Clear Lenses Moazez J. Marian a Partha Mukhopadhyay b Douglas Borchman c Christopher A. Paterson c Departments of a Biochemistry and Molecular Biology, b Dentistry-Molecular, Cellular and Craniobiology and c Ophthalmology and Visual Sciences, University of Louisville, Louisville, Ky., USA

Key Words Plasma membrane calcium ATPase ⴢ Ca2+-ATPase ⴢ Lens, human ⴢ Calcium

Abstract The plasma membrane calcium ATPase (PMCA) pump is the major mechanism by which calcium is removed from the lens. The aim of this study was to determine if mRNA and proteins levels of PMCA isoforms changed with age or lens opacity. mRNA was quantified using a quantitative real-time reverse transcription polymerase chain reaction assay (RTPCR). PMCA protein levels were quantified using Western blot analysis. No PMCA mRNA or proteins were detected in human lens fiber cells. The mRNA and protein levels of PMCA1, 3 and 4 in the epithelium of cataractous lenses were similar to those of epithelium from age-matched clear lenses and were also the same in younger lenses. PMCA2 mRNA and protein levels were 1.6–2.5 times higher, respectively, in cataractous lenses compared to age-matched clear lenses. Elevated PMCA2 expression in cataractous lenses might be a compensatory mechanism to overcome higher intracelluCopyright © 2008 S. Karger AG, Basel lar calcium levels in cataract.

© 2008 S. Karger AG, Basel 0030–3747/08/0402–0086$24.50/0 Fax +41 61 306 12 34 E-Mail [email protected] www.karger.com

Accessible online at: www.karger.com/ore

Introduction

Regulation of intracellular calcium is vital to normal cell function. Nearly all physiological and pathological events in cells are accompanied by ionic changes [1]. Calcium regulates many physiological and cellular events by acting as a second messenger; calcium also triggers pathological events in cell injury and death [1]. The lens is no exception; all cataractous lenses contain 3–1,000 times more calcium than clear lenses of the same age [2–10]. The loss of lens transparency is associated with elevated calcium levels in many animal models of cataract such as hypoglycemic [11], X-ray [12] and selenite cataracts [13]. Transparency is preserved if calcium homeostasis is maintained [14–17]. Calcium-containing vacuoles contribute to light scattering in the rat lens and may be a major source of scatter in many human lenses [18]. When calcium is bound to purified lens lipid membranes light scattering is 3 times greater [2]. Cataract development is undoubtedly a complex cascade of events. The studies described above suggest that elevated lens calcium may be a significant factor in contributing to lens opacity. Calcium homeostasis is made possible through a delicate balance between lens cell membrane permeability and the energy-dependent transport of calcium by Ca2+Douglas Borchman, PhD University of Louisville, Kentucky Lions Eye Center 301 E. Muhammad Ali Blvd Louisville, KY 40202 (USA) Tel. +1 502 852 7435, Fax +1 502 852 7450, E-Mail [email protected]

ATPase at the level of lens cell membrane plasma membrane calcium ATPase (PMCA) and at the level of the endoplasmic reticulum [sarco/endoplasmic reticulum calcium ATPase (SERCA)]. Calcium might also be transported outward by a sodium-calcium exchange mechanism in addition to a Ca2+-ATPase in rats [19–21]. The amount of sodium-calcium exchange is species dependent, and data suggest it plays only a minor role in the human lenses [22], where calcium and potassium content are correlated in cataractous lenses but not calcium and sodium [23]. Therefore, Na-Ca exchange would seem to be an important but secondary regulating mechanism in the human lens. The lens contains both PMCA and SERCA pumps [24]. In other tissues, 3 homologous SERCA genes have been identified and these 3 genes are translated into different Ca2+-ATPase isoforms [25]. Multiple PMCA isoforms are expressed from 4 genes located on 4 different chromosomes [26–29]. Nearly 50% of the Ca2+-ATPase activity of the lens arises from the PMCA isoforms [24]. Ca2+-ATPase activity was identified in animal lenses in 1979 [30]. Later studies showed that total Ca2+-ATPase activity is 50% lower in human cataractous lenses compared with clear ones [31]. Lens Ca2+-ATPase is especially sensitive to H2O2 [32–34], and the expression of some isoforms of Ca2+-ATPase in cultured human lens epithelial cells is sensitive to calcium [35, 36]. We have examined the expression of Ca2+-ATPase isoforms in the human lens to determine if the 4 PMCA isoforms are expressed differently during aging and in the development of cataract. One difficulty in measuring PMCA mRNA and protein in all animal and plant cells is that ATPases are present in a minute amount that probably never exceeds 0.1% of the total membrane protein, with the exception of nerve cells [26]. Because PMCA is found only in the monolayer of equatorial cells on the anterior surface of the human lens, it makes up less than 1 millionth of the total lens protein. Recent technological advances such as quantitative real-time reverse transcription (RT) polymerase chain reaction (PCR) make it possible to study PMCA expression in the human lens, despite its paucity.

liquid nitrogen immediately after removal (1–3 min) as an early step in phaco-emulsion cataract surgery. Tissue was obtained with informed consent as approved by the University of Louisville Human Studies Committee. Chemicals Unless indicated, all chemicals were purchased from Sigma Chemical Co. (St. Louis, Mo., USA). Catalase inhibitor, 3-aminotriazole was purchased from Aldrich (Milwaukee, Wisc., USA). Enhanced ChemiLuminescence detection kit was purchased from Amersham Pharmacia Biotech (Buckinghamshire, UK). Human Lens Epithelium Membrane Preparation Epithelia from clear lenses were removed by a small incision on the posterior surface of the lens and by carefully peeling the capsule towards the anterior side. The entire procedures were performed on ice. The lens cortex (outer layer) and nucleus (central zone) were separated. Pooled epithelia were homogenized by a mechanical tissue tearor (Biospec Products Inc.) and ultrasonicated 3 times (Branson Ultrasonics Co., Danbury, Conn., USA) at medium power for 5 s with 3 min ice-cooling intervals in ice-cold buffer A containing: 150 mM sucrose, 1 m M dithiothreitol, 5 mM 4-(2-hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES), pH 7.4. The samples were then centrifuged at 140,000 g for 1 h at 4 ° C. The pellets were then suspended in buffer B containing buffer A, plus 4 mM ethylene glycol-bis(2-aminoethylether)N,N,Nⴕ,Nⴕ-tetraacetic acid, and a mixture of the following protease inhibitors: 10 ␮g/ml of each pepstatin A, antipain and leupeptin, 2 ␮g/ml aprotinin and 1 mM phenylmethylsulfonyl fluoride. The samples were then centrifuged at 140,000 g for 1 h at 4 ° C. The pellets were then suspended in buffer B containing 0.6 KCl and centrifuged at 140,000 g for 1 h at 4 ° C. The final pellet was resuspended and homogenized in buffer A containing 150 mM sucrose, 1 mM dithiothreitol and 5 mM HEPES, pH 7.4, placed in small tubes, then quick-frozen in liquid nitrogen and stored at –70 ° C until use. The protein concentration of the membrane material was determined using the Bio-Rad protein assay kit (BioRad, Hercules, Calif., USA). The procedure was repeated for the cortex and nucleus.

Tissues Clear human lenses were obtained from the Kentucky Lions Eye Bank within hours after death. The lenses were stored frozen in liquid nitrogen until use. Lenses from eyes of diabetic donors were excluded. Epithelia from cataractous lenses were frozen in

Total RNA Extraction and RT Total RNA isolation was performed using the RNeasy kit (Qiagen, Valencia, Calif., USA). Human lens epithelium was homogenized first by a mechanical tissue tearor (Biospec Products Inc.), then lysed in RLT buffer from the RNeasy kit. The lysed cells were loaded onto a shredder column (Qiagen) for homogenization. In the final stage, RNA was eluted with 40 ␮l of RNAase-free water. RNA concentration was measured in an UV spectrophotometer at 260 nm. Isolated RNA was stored at –70 ° C until used. cDNA was produced via an RT reaction using SuperscriptTM Preamplification System (Invitrogen Life Technologies, Carlsbad, Calif., USA) with random hexamer primers according to the manufacturer’s protocol. The final reaction volume was 20 ␮l with 2 ␮g of total RNA extracted. The final concentrations of the reaction components were as follows: 200 units Superscript II reverse transcriptase, 5 mM MgCl2, 1 mM of each deoxynucleoside triphosphate and 2.5 ␮ M random hexamer primers. The reaction tubes were incubated at room temperature for 10 min, 42 ° C for 50 min and 70 ° C for 15 min. The RNA template was removed by incubating with 2 units RNase H at 37 ° C for 20 min.

Human Lens PMCA Expression

Ophthalmic Res 2008;40:86–93

Materials and Methods

87

Table 1. Primers for PCR Isoform type

Upstream primer

Upstream primer bases

Downstream primer

Downstream primer bases

Accession No.

PMCA1 PMCA2 PMCA3 PMCA4

TAGGCACTTTTGTGGTACAG AGATCCACGGCGAGCGCAAT AGCTCAAGTGCCTGAAGGAAG CATTCACCACCCAGCCAGCACTAT

3222–3241 3363–3382 3311–3331 3254–3277

GCTCTGAATCTTCTATCCTA CGAGTTCTGCTTGAGCGCGG CTGAAGAGGTAGCTGACTTGG CGGTGAAAAGTCCCATCATCACC

3631–3650 3900–3919 3870–3890 4080–4101

NM_001682 XM_052353 NM_021949 XM_046775

Primers The primers for polymerase chain reaction were designed according to the published sequences of human PMCA cDNA and synthesized by Integrated DNA Technologies (Coralville, Iowa, USA; table 1). Polymerase Chain Reaction The RT mixture (2 ␮l) was used for PCR. PCR was performed in a final volume of 50 ␮l, PCR buffer (10 m M Tris-HCl, 100 mM KC1, pH 8.3), 2 mM MgCl2, 0.2 mM of each deoxynucleotide triphosphate, 0.5 mM of each primer and 2.5 units of Taq DNA polymerase. The reaction was carried out in a Gene Amp PCR System 2400 (Perkin Elmer, Wellesley, Mass., USA). The PCR cycle conditions were: initial denaturation at 94 ° C for 5 min, followed by 35 cycles of 94 ° C for 1 min, 60 ° C for 1 min and 72 ° C for 2 min. The reaction mixture was then incubated at 72 ° C for 10 min for the final extension and then chilled at 4 ° C. The PCR products were analyzed by 1.5% agarose gel electrophoresis. Sequencing of RT-PCR Products The PCR products of PMCA1–4 were collected and cleaned with a gel DNA purification kit (Qiagen). Sequencing was carried out in duplicate using the fluorescent-tagged dideoxynucleotide terminator sequencing reaction for automated sequencing (Beckman, Fullerion, Calif., USA). The sequences from PCR products were aligned with the human PMCA1, 2, 4 sequences published in Genbank. Quantitative Real-Time PCR (TaqMan) Total RNA prepared from human lens epithelial cells was treated with DNase 1 in the presence of RNaseOUT (Invitrogen Life Technologies) to remove DNA contamination before cDNA synthesis. cDNA was synthesized with random hexamer primers and Superscript II reverse transcriptase (Invitrogen Life Technologies). Real-time PCR (TaqMan) analysis was performed on a TaqMan ABI Prism 7700 Sequence Detector (Applied Biosystems, Foster City, Calif., USA). Primers and matching fluorescence probes were designed for PMCA1–4 using Applied Biosystems ‘Assays-by-Design’ custom service. The final primer concentrations, both forward and reverse primers, were 900 nM and the final concentrations for the fluorescence probes were 200 nM . The total volume for PCR reaction was 25 ␮l with a final concentration of 0.2 mM for each of dATP, dCTP and dGTP and 0.4 mM for dUTP, 0.625 unit of Amplitaq Gold and 2 ␮l of cDNA template. The cycling parameters were: 50 ° C for 2 min for probe and primer activation, 95 ° C for 10 min for DNA denaturation, followed by 40 cycles of denaturation at 95 ° C for 15 s, and primer extension at 60° for 1 min. Data were analyzed with Sequence Detector 1.6.3 software (Applied Biosystems). The mRNA amount

88

Ophthalmic Res 2008;40:86–93

for each PMCA1–4 was normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA present in each sample by using GAPDH PCR primers and fluorescence probe (Applied Biosystems). Electrophoresis and Western Blot Western blot experiments were conducted using a methodology based on the technique of Moseley et al. [37]. Membrane proteins were solublized in sample dilution buffer containing 50 mM Tris (pH 6.8), 2% (w/v) sodium dodecyl sulfate salt, 50% (v/v) glycerol, bromophenol blue and 5% (v/v) 3-mercaptoethanol. By 7.5% sodium-dodecyl-sulfate-polyacrylamide gel electrophoresis, 50– 100 ␮g of soluble protein was resolved. Separated proteins were transferred to nitrocellulose membrane. The membrane was blocked with 5% (w/v) nonfat dry milk in TTBS buffer (30 mM Tris, 150 mM NaCl and 0.5% (v/v) Tween20, pH 7.4) for 1 h at room temperature. The nitrocellulose membranes were incubated with polyclonal anti-PMCA1–3 (Affinity Bioreagents, Golden, Colo., USA) or monoclonal anti-PMCA4 (Affinity Bioreagents) for 1 h at room temperature. After washing with TTBS, the nitrocellulose membranes were incubated with anti-rabbit, PMCA1–3, or antimouse, PMCA4, horseradish-peroxidase-conjugated secondary antibody for 1 h at room temperature. The nitrocellulose membranes were then washed with TTBS. Bands of PMCA isoforms were visualized using the Enhanced ChemiLuminescence detection kit (Amersham Pharmacia Biotech) and exposed to a Kodak X-ray film for 0.5–2 min. For quantification studies, the processed blots were subjected to densitometric analysis using Personal Densitometer SI (Molecular Dynamics, Calif., USA) and the intensity of each band was quantified by ImageQuaNT image analysis software. Then the blots were stripped in the stripping solution [62.5 mM Tris-HCl, pH 6.7, 2% (w/v) sodium dodecyl sulfate, and 100 mM ␤-mercaptoethanol] for 30 min at 50 ° C. The blots were washed with TTBS, blocked with 5% (w/v) nonfat dry milk in TTBS buffer and incubated with polyclonal ␤-actin antibody (Affinity Bioreagents) for 1 h at room temperature, then with anti-rabbit horseradish peroxidase-conjugated secondary antibody for 1 h at room temperature. The blots were scanned, analyzed by densitometry and the intensities of the ␤-actin bands were recorded and used as an internal control to correct for differences in the samples loading on the gels. The densitometry data for each PMCA and SERCA band were normalized by those of ␤-actin in that lane. Statistical Analysis Results are presented as means 8 SEM as indicated. Data were tested for statistical significance by the paired Student t test [38]. A value of p ^ 0.05 was considered significant. Four independent measurements were made unless indicated.

Marian /Mukhopadhyay /Borchman / Paterson

PMCA3

PMCA1

␤-Actin

PMCA4

PMCA2

Fig. 1. PMCA protein expression in the ep-

Results

Clear human lenses were assigned to 2 groups; young (average age = 34 8 7 years, n = 39) and old (average age = 71 8 3 years, n = 25). The sex of the donors of clear lenses was not recorded. One hundred and forty-two cataractous lens epithelial samples were pooled from 78 female and 64 male donors with an average age of 74 8 9 years. The median age of the donors was 75 years. Cataracts were classified by slit lamp examination as: posterior sclerotic and brunescent (n = 54), pure nuclear sclerotic (n = 52), brunescent (n = 27), nuclear and posterior sclerotic (n = 5) and pure posterior sclerotic (n = 4).

Cataract

Older

Cataract

Older

␤-Actin

Younger

␤-Actin

Younger

ithelium of (left lane) younger, 34 years, (center lane) older, 71 years, and (right lane) cataractous, 75 years, human lenses by Western blot. An equal amount of membrane protein was loaded in each lane and subjected to electrophoresis. Blots were incubated with a specific PMCA antibody, then stripped and reprobed with ␤-actin antibody. Densitometric results are shown in figure 2.

␤-Actin

to the older, 1.1 8 0.2, or cataractous, 1.2 8 0.2, groups (fig. 2a). Nor was there a significant difference in the PMCA2 protein level between the younger, 1 8 0.2, and older, 0.9 8 0.3, lens groups (fig. 2b). However, densitometric analysis of the data in figure 1b showed that PMCA2 protein in human cataractous lenses was 1.6 8 0.3, more than in cataractous lenses compared to clear younger or older lenses (p ! 0.05; fig. 2b). No significant differences were evident in the amount of PMCA3 protein in the younger, older and cataractous groups, 1.0 8 0.1, 1.2 8 0.1 and 1.1 8 0.2, respectively (fig. 2c). Similarly, there was no significant difference in the PMCA4 protein level between the younger, 1.0 8 0.1, and older, 1.1 8 0.1, lens groups and cataractous groups, 1.1 8 0.2 (fig. 2d).

Quantification of PMCA Isoform Protein Levels in Human Lenses by Western Blot Analysis PMCA1–4 were expressed in epithelium of younger, older and cataractous lenses (fig. 1) but not in the cortex or nucleus. The protein bands in each lane of the gels in figure 1 were scanned and subjected to densitometry analysis (fig. 2). Densitometry data for each band were normalized with respect to those of the ␤-actin band so that the result in the clear lens younger group, considered as a control, had a relative value of 1 (fig. 2). The changes in the other groups were presented proportional to the control. The amount of PMCA1 protein was not significantly different for the younger group, 1.00 8 0.09, compared

Quantification of PMCA Isoform mRNA in Human Lenses by Quantitative RT-PCR Analysis The amount of PMCA1 mRNA was not significantly different for the younger group, 1.0 8 0.1, compared to the older, 1.2 8 0.1, or cataractous, 1.2 8 0.2, groups (fig. 3a). Nor was there a significant difference in the PMCA2 mRNA level between the younger, 1.0 8 0.1, and older, 1.2 8 0.2, lens groups (fig. 3b). However, PMCA2 mRNA in human cataractous lenses was 2.5 8 0.3, about 2.5 times higher in cataractous lenses compared to clear younger or older lenses (p ! 0.05; fig. 3b). This is in agreement with the higher levels of PMCA2

Human Lens PMCA Expression

Ophthalmic Res 2008;40:86–93

89

Younger

2

Ophthalmic Res 2008;40:86–93

Cataractous

c

1

0 Younger

2

Older

Cataractous

a

1

0 Younger

2

Older

Cataractous

c

1

0 Younger

protein seen with the Western bloting (fig. 1 and 2b). No significant differences were evident in the amount of PMCA3 mRNA in the younger, older and cataractous groups, 1.00 8 0.07, 1.3 8 0.2 and 1.2 8 0.1, respectively (fig. 3c). Similarly, there was no significant difference in the PMCA4 mRNA level between the younger 1.0 8 0.2, older ,1.2 8 0.2, and cataractous, 1.2 8 0.2, lens groups (fig. 3d).

90

Older

Older

Cataractous

Amount of PMCA2 protein (relative to younger group)

0

Amount of PMCA4 protein (relative to younger group)

1

Amount of PMCA2 mRNA (relative to younger group)

a

Amount of PMCA4 mRNA (relative to younger group)

Amount of PMCA3 protein (relative to younger group)

Amount of PMCA1 protein (relative to younger group)

epithelium of younger, 34 years, older, 71 years, and cataractous, 75 years, human lenses by quantitative real-time RT-PCR. a PMCA1. b PMCA2. c PMCA3. d PMCA4. RNA from epithelium of each lens was first subjected to RT, then to quantitative RT-PCR. The mRNA expression level was normalized to the GAPDH and then to the value of the younger lens group. The results are presented as means 8 SEM of 3 or 4 separate experiments. * p ^ 0.05 was considered significant.

Amount of PMCA1 mRNA (relative to younger group)

Fig. 3. mRNA expression of PMCA in the

Amount of PMCA3 mRNA (relative to younger group)

Fig. 2. Densitometric analysis of gels (example in fig. 1), to quantify PMCA protein expression in the lens epithelium. a PMCA1. b PMCA2. c PMCA3. d PMCA4. The results are presented as means 8 SEM of 3 or 4 separate experiments. * p ^ 0.05 was considered significant.

2

3

b

*

2 1 0 Younger

2

Older

Cataractous

Older

Cataractous

d

1

0 Younger

4

b

*

3 2 1 0 Younger

2

Older

Cataractous

Older

Cataractous

d

1

0 Younger

We detected a low level (Ct values ⬃33–34) of PMCA3 gene expression and were able to identify a faint band corresponding to PMCA3 by Western blot analysis. However, we did not find any PMCA isoforms with the quantitative real-time RT-PCR in human lens cortex or nucleus. Total RNA prepared from human lens epithelial, cortical and nuclear tissue showed no signs of degradation after analysis by agarose gel electrophoresis as was evident from the integrity of 18s and 28s rRNAs. Marian /Mukhopadhyay /Borchman / Paterson

Do the Levels of PMCA Isoforms in Human Lens Epithelium Change with Age or Cataract? Only changes in PMCA isoform levels greater than 50% were detectable because of the experimental deviations inherent in our quantitative real-time RT-PCR and less sensitive Western blot assays. The expression of PMCA1–4 was unchanged (less than 50%) in both older and younger lenses (fig. 2, 3). It is obvious, even without

statistical evaluation, that PMCA2 mRNA is expressed at higher levels (fig. 3b) in the cataractous human lenses compared to age-matched clear lenses. It is less obvious that PMCA2 protein levels are expressed at higher levels. Since data were collected in pairs, clear versus cataract, the paired t test was ideal for analyzing the difference between pairs of data which might be lost when analyzing the difference between gels. Experimental variability from gel to gel was controlled for by using the paired t test, which tests the difference between clear and cataract pairs, rather than the average values. In the only other study of PMCA isoform expression in the lens, PMCA1b was the only isoform expressed in both normal and cataractous rat lenses [42]. In the present study, elevated levels of PMCA2 may be functionally significant because PMCA2 is about 10 times more sensitive to calcium/calmodulin than other PMCA isoforms [43]. One may speculate that PMCA2 is preferentially upregulated in cataractous lenses because at elevated levels of calcium, calcium/calmodulin would activate PMCA2 more than the other PMCA isoforms. Furthermore, like PMCA1, PMCA2 has a higher affinity for ATP than PMCA4 [44]. One may speculate that PMCA2 is preferentially upregulated in cataractous lenses because at the lower levels of ATP found in cataractous lenses, it would be more active than PMCA4. PMCA2 is upregulated in the lactating mammary gland [45], and in other tissues, it is the fastest of the PMCA isoforms to be activated in response to an increase in calcium [46, 47]. The expression of a PMCA isoform is tissue-specific, suggesting that the amount of particular PMCA isoforms provides a tissue-specific functional advantage [48, 49]. Because the results of our current experiments show that the total amount of PMCA in cataractous human lenses is not diminished, lack of expression of PMCA cannot account for the elevated levels of calcium with increasing age and cataract. Other factors such as an increase in membrane permeability, or as discussed below, the direct inhibition of PMCA or its activators, must account for the high amount of total calcium in cataractous lenses. Total Ca2+-ATPase activity (SERCA and PMCA) increases with age in clear human lenses [50], yet in the present study, PMCA levels remained constant. Therefore, the increase in total Ca2+-ATPase activity with age must be due to the activation of PMCA or SERCA or an increase in SERCA expression. In reconstitution studies we found that the higher degree of lipid order found with increasing age [51] stimulates PMCA1 activity [52] and inhibits SERCA activity [53].

Human Lens PMCA Expression

Ophthalmic Res 2008;40:86–93

Discussion

What PMCA Isoforms Are Present in the Human Lens and Where Are They Located? Our results indicate that PMCA1–4 are all expressed in the epithelium of the clear younger and older as well as cataractous human lenses (fig. 1). PMCA3 mRNA was measured in lens epithelium at a level just above the detection limit. PMCA3 mRNA and protein were not detected in our previous study [39] yet found in the present study perhaps because we used quantitative real-time RTPCR, which is more specific and sensitive [40] than the PCR method we used previously [39]. The specificity of RT-PCR is much higher than regular PCR because it uses a gene-specific fluorescent ‘probe’ in addition to the genespecific primer pair. The better sensitivity of the RT-PCR lies in the fact that one can visualize the PCR product formation in real time, which is not possible in regular PCR. In regular PCR one must wait at least 30–35 cycles to visualize the PCR product. We did not detect any PMCA isoform expression in the cortex and nucleus of the cataractous lenses as well as in those of clear lenses in agreement with out previous study of clear lenses [39]. The methodology we employed was capable of detecting any PMCA mRNA if it were present. It was somewhat surprising that we did not detect any PMCA isoforms in the cortex, especially considering the fact that the outer layer of the cortex, adjacent to the epithelium, possesses many cellular activities including Na/K-ATPase activity [37]. Ca2+-ATPase activity as well as Na/K-ATPase activity is present in the cortex of the rabbit lens [33]. The finding that the nucleus of clear lenses did not express any PMCA isoforms was not unexpected. PMCA activity was found in rat epithelial cells but not in the nucleus [1]. Furthermore, only PMCA1b was detected in the epithelium of rat lens and no PMCA isoform was observed in the lens nuclear region [41, 42]. These results from rat lenses are in agreement with our findings from human lenses that PMCA isoforms are expressed by the lens epithelial cells but not by the nucleus or cortex [39].

91

In this study only the central epithelium was recovered in cataractous tissue. Therefore, one must be cautious when comparing PMCA levels with complete epithelium from clear lenses. This is one of the variables which is not controllable when working with human tissues. It is unlikely that the distribution and amount of PMCA is so radically different in the equatorial region compared with that of the central region of the epithelium to change our results so that PMCA is downregulated in cataract. At worse, PMCA levels could be the same as those in clear lenses. No significant regional differences in the distribution PMCA isoforms were detected in porcine lenses [54]. Total Ca 2+-ATPase activity is 50% lower in the cataractous lenses [31], and based on our data, the lower Ca 2+-ATPase activity in the cataractous lenses is not due to the lower expression of PMCA but must be due to PMCA/SERCA inactivation or lower expression of SERCA. We believe that the decrease in the total Ca 2+ATPase activity in the cataractous lenses might be due to SERCA inhibition by higher lipid order or oxidation.

However, whether PMCA is also inhibited in the cataractous lens either directly or indirectly, has yet to be determined. The increase in the PMCA2 expression in the cataractous lenses might be a compensatory mechanism by the cell to overcome higher intracellular calcium levels [2–10] or SERCA inhibition. Elevated PMCA2 expression is distinct to cataract, and like many other factors such as protein oxidation, is not an acceleration of the aging process [55]. Knowing which PMCA isoforms are present in the human lens and their location is a step toward elucidating the role of PMCA in maintaining calcium homeostasis and lens transparency.

Acknowledgments This work was supported by USPHS research grant EYO6916, the Kentucky Lions Eye Foundation, and an unrestricted grant from Research to Prevent Blindness Inc.

References 1 Missiaen L, Robberecht W, Bosch LVD, Callewaert G, Parys JB, Wuytack F, et al: Abnormal intracellular Ca 2+ homeostasis and disease. Cell Calcium 2000;28:1–21. 2 Tang D, Borchman D, Yappert MC, Vrensen GF, Rasi V: Influence of age, diabetes, and cataract on calcium, lipid-calcium, and protein-calcium relationships in human lenses. Invest Ophthalmol Vis Sci 2003; 44: 2059– 2066. 3 Adams DR: The role of calcium in senile cataract. Biochem J 1929; 23:902–912. 4 Burge WE: Analysis of the ash of the normal and the cataractous lens. Arch Ophthalmol 1909;23:435–450. 5 Dilsiz N, Olcucu A, Atas M: Determination of calcium, sodium, potassium and magnesium concentrations in human senile cataractous lenses. Cell Biochem Funct 2000; 18: 259–262. 6 Duncan G, Bushell AR: Ion analyses of human cataractous lenses. Exp Eye Res 1975; 20:223–230. 7 Duncan G, van Heyningen R: Distribution of non-diffusible calcium and sodium in normal and cataractous human lenses. Exp Eye Res 1977;25:183–193. 8 Hightower KR, Reddy VN: Calcium content and distribution in human cataract. Exp Eye Res 1982;34:413–421.

92

9 Jedziniak JA, Nicoli DF, Yates EM, Benedek GB: On the calcium concentration of cataractous and normal human lenses and protein fractions of cataractous lenses. Exp Eye Res 1976;23:325–332. 10 Rasi V, Costantini S, Moramarco A, Giordano R, Giustolisi R, Balacco GC: Inorganic element concentrations in cataractous human lenses. Ann Ophthalmol 1992;24:459–464. 11 Chylack LT Jr: Mechanism of ‘hypoglycemic’ cataract formation in the rat lens. I. The role of hexokinase instability. Invest Ophthalmol 1975;14:746–755. 12 Hightower KR, Giblin FJ, Reddy VN: Changes in the distribution of lens calcium during development of X-ray cataract. Invest Ophthalmol Vis Sci 1983;24:1188–1193. 13 Bunce GE, Hess JL, Batra R: Lens calcium and selenite-induced cataract. Curr Eye Res 1984;3:315–320. 14 Hightower KR, Reddy VN: Ca++-induced cataract. Invest Ophthalmol Vis Sci 1982;22: 263–267. 15 Marcantonio JM, Duncan G, Rink H: Calcium-induced opacification and loss of protein in the organ-cultured bovine lens. Exp Eye Res 1986;42:617–630. 16 Shridas P, Sharma Y, Balasubramanian D: Transglutaminase-mediated cross-linking of alpha-crystallin: structural and functional consequences. FEBS Lett 2001; 499: 245– 250.

Ophthalmic Res 2008;40:86–93

17 Mathur P, Gupta SK, Wegener AR, et al: Comparison of various calpain inhibitors in reduction of light scattering, protein precipitation and nuclear cataract in vitro. Curr Eye Res 2000;21:926–933. 18 Vrensen GF, Sanderson J, Willekens B, Duncan G: Calcium localization and ultrastructure of clear and pCMPS-treated rat lenses. Invest Ophthalmol Vis Sci 1995; 36: 2287– 2295. 19 Tomlinson J, Bannister SC, Croghan PC, Duncan G: Analysis of rat lens 45Ca 2+ fluxes: evidence for Na+-Ca 2+ exchange. Exp Eye Res 1991;52:619–627. 20 Ramana KV, Chandra D, Wills NK, Bhatnagar A, Srivastava SK: Oxidative stress-induced up-regulation of the chloride channel and Na+/Ca 2+ exchanger during cataractogenesis in diabetic rats. J Diabetes Complicat 2004;18:177–182. 21 Okafor M, Tamiya S, Delamere NA: Sodiumcalcium exchange influences the response to endothelin-1 in lens epithelium. Cell Calcium 2003;34:231–240. 22 Duncan G, Webb SF, Dawson AP, Bootman MD, Elliott AJ: Calcium regulation in tissuecultured human and bovine lens epithelial cells. Invest Ophthalmol Vis Sci 1993; 34: 2835–2842.

Marian /Mukhopadhyay /Borchman / Paterson

23 Shukla N, Moitra JK, Trivedi RC: Determination of lead, zinc, potassium, calcium, copper and sodium in human cataract lenses. Sci Total Environ 1996;181:161–165. 24 Chiesa R, Sredy J, Spector A: Phosphorylated intermediates of two Ca++-ATPases in membrane preparations from lens epithelial cells. Curr Eye Res 1985;4:897–903. 25 Burk SE, Lytton J, MacLennan DH, Shull GE: cDNA cloning, functional expression, and mRNA tissue distribution of a third organellar Ca 2+ pump. J Biol Chem 1989;264:18561– 18568. 26 Guerini D: The significance of the isoforms of plasma membrane calcium ATPase. Cell Tissue Res 1998;292:191–197. 27 Grover AK, Khan I: Calcium pump isoforms: diversity, selectivity and plasticity. Cell Calcium 1992;13:9–17. 28 Carafoli E: Biogenesis: plasma membrane calcium ATPase: 15 years of work on the purified enzyme. FASEB J 1994;8:993–1002. 29 Zeng J, Borchman D, Paterson CA: ATPase activities of rabbit and bovine lens epithelial microsomes: a continuous fluorimetric assay study. Curr Eye Res 1995;14:87–93. 30 Hamilton PM, Delamere NA, Paterson CA: The influence of calcium on lens ATPase activity. Invest Ophthalmol Vis Sci 1979; 18: 434–436. 31 Paterson CA, Zeng J, Husseini Z, Borchman D, Delamere NA, Garland D, et al: Calcium ATPase activity and membrane structure in clear and cataractous human lenses. Curr Eye Res 1997;16:333–338. 32 Ahuja RP, Borchman D, Dean WL, Paterson CA, Zeng J, Zhang Z, et al: Effect of oxidation on Ca 2+-ATPase activity and membrane lipids in lens epithelial microsomes. Free Rad Biol Med 1999; 27:177–185. 33 Borchman D, Paterson C, Delamere N: Selective inhibition of membrane ATPases by hydrogen peroxide in the lens of the eye. Basic Life Sci 1988;49:1029–1033. 34 Borchman D, Paterson CA, Delamere NA: Oxidative inhibition of Ca 2+-ATPase in the rabbit lens. Invest Ophthalmol Vis Sci 1989; 30:1633–1637.

Human Lens PMCA Expression

35 Marian JM, Mukhopadhyay P, Borchman D, Tang D, Paterson CA: Regulation of sarco/ endoplasmic and plasma membrane calcium ATPase gene expression by calcium in cultured human lens epithelial cells. Cell Calcium 2007;41:87–95. 36 Liu L, Paterson CP, Borchman D: Regulation of sarco/endoplasmic Ca 2+-ATPase expression by calcium in human lens cells. Exp Eye Res 2002;75:583–590. 37 Moseley AE, Dean WL, Delamere NA: Isoforms of Na,K-ATPase in rat lens epithelium and fiber cells. Invest Ophthalmol Vis Sci 1996;37:1502–1508. 38 Goulden CH: Methods of Statistical Analysis, ed 2. New York, Wiley, 1956, pp 50–55. 39 Marian JM, Li H, Borchman D, Paterson CA: Plasma membrane Ca 2+-ATPase expression in the human lens. Exp Eye Res 2005; 81:57– 64. 40 Bustin SA: Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J Mol Endocrinol 2000;25:169–193. 41 Wang Z, Bunce GE, Hess JL: Selenite and Ca 2+ homeostasis in the rat lens: effect on CaATPase and passive Ca 2+ transport. Curr Eye Res 1993;12:213–218. 42 Nabekura T, Takeda M, Hori R, Tomohiro M, Ito Y: Expression of plasma membrane Ca 2+-ATPase in lenses from normal and hereditary cataract UPL rats. Curr Eye Res 2001;22:446–450. 43 Hilfiker H, Guerini D, Carafoli E: Cloning and expression of isoforms 2 of the human plasma membrane Ca 2+-ATPase: functional properties of the enzyme and its splicing products. J Biol Chem 1994; 269: 26178– 26183. 44 Guerini D, Pan B, Carafoli E: Expression, purification, and characterization of isoforms 1 of the plasma membrane Ca 2+ pump: focus on calpain sensitivity. J Biol Chem 2003;278: 38141–38148.

45 Reinhardt TA, Lippolis JD, Shull GE, Horst RL: Null mutation in the gene encoding plasma membrane Ca 2+-ATPase isoform 2 impairs calcium transport into milk. J Biol Chem 2004;279:42369–42373. 46 Barini M, Coletto L, Pierobon N, Kraev N, Guerini D, Carafoli E: A comparative functional analysis of plasma membrane Ca 2+ pump isoforms in intact cells. J Biol Chem 2003;278:24500–24508. 47 Caride AL, Filoteo AG, Peaheiter AR, Paszty K, Enyedi A, Penniston T: Delayed activation of the plasma membrane calcium pump by a sudden increase in Ca 2+: fast pumps reside in fast cells. Cell Calcium 2003;30:49–57. 48 Stauffer TP, Guerini D, Celio MR, Carafoli E: Immunolocalization of the plasma membrane Ca 2+ pump isoforms in the rat brain. Brain Res 1997;748:21–29. 49 Hammes A, Oberdorf S, Strehler EE, Stauffer T, Carafoli E, Vetter H, et al: Differentiationspecific isoform mRNA expression of the calmodulin-dependent plasma membrane Ca 2+-ATPase. FASEB J 1994;8:428–435. 50 Borchman D, Paterson CA, Delamere NA: Ca-ATPase activity in the human lens. Curr Eye Res 1989;8:1049–1054. 51 Borchman D, Tang D, Yappert MC: Lipid composition, membrane structure relationships in lens and muscle sarcoplasmic reticulum. Biospectroscopy 1999; 5:151–167. 52 Tang D, Dean WL, Borchman D, Paterson CA: The influence of membrane lipid structure on plasma membrane Ca 2+-ATPAse activity. Cell Calcium 2006;39:209–216. 53 Zeng J, Zhang Z, Paterson CA, FergusonYankey S, Yappert MC, Borchman D: Ca 2+ATPase activity and lens lipid composition in reconstituted systems. Exp Eye Res 1999; 69:323–330. 54 Tamiya S, Dean WL, Paterson CA, Delamere NA: Regional distribution of Na,K-ATPase activity in porcine lens epithelium. Invest Ophthalmol Vis Sci 2003;44:4395–4399. 55 Truscott RJ: Age-related nuclear cataractoxidation is the key. Exp Eye Res 2005; 80: 709–725.

Ophthalmic Res 2008;40:86–93

93