Journal of Pathology J Pathol 2008; 216: 440–450 Published online 14 July 2008 in Wiley InterScience (www.interscience.wiley.com) DOI: 10.1002/path.2410
Original Paper
MYC translocation-negative classical Burkitt lymphoma cases: an alternative pathogenetic mechanism involving miRNA deregulation E Leucci,1 M Cocco,1 A Onnis,1 G De Falco,1 P van Cleef,2 C Bellan,1 A van Rijk,2 J Nyagol,1 B Byakika,3 S Lazzi,1 P Tosi,1 H van Krieken2 and L Leoncini1 * 1 Department of Human Pathology and Oncology, University of Siena, Italy 2 Department of Pathology, Radboud University Nijmegen Medical Center, Nijmegen, 3 The Nairobi Hospital, Nairobi, Kenya
*Correspondence to: L Leoncini, MD Department of Human Pathology and Oncology, University of Siena, Via delle Scotte, 6 - 53100 - Siena, Italy. E-mail:
[email protected] No conflicts of interest were declared.
Received: 29 January 2008 Revised: 13 June 2008 Accepted: 4 July 2008
The Netherlands
Abstract The molecular feature of Burkitt lymphoma (BL) is the translocation that places cMyc under the control of immunoglobulin gene regulatory elements. However, there is accumulating evidence that some cases may lack an identifiable MYC translocation. In addition, during the EUROFISH project, aiming at the standardization of FISH procedures in lymphoma diagnosis, we found that five cases out of 35 classic endemic BLs were negative for MYC translocations by using a split-signal as well as a dual-fusion probe. Here we investigated the expression pattern of miRNAs predicted to target c-Myc, in BL cases, to clarify whether alternative pathogenetic mechanisms may be responsible for lymphomagenesis in cases lacking the MYC translocation. miRNAs are a class of small RNAs that are able to regulate gene expression at the post-transcriptional level. Several studies have reported their involvement in cancer and their association with fragile sites in the genome. They have also been shown to control cell growth, differentiation, and apoptosis, suggesting that these molecules could act as tumour suppressors or oncogenes. Our results demonstrated a modulation of specific miRNAs. In particular, down-regulation of hsa-let-7c was observed in BL cases, compared to normal controls. More interestingly, hsa-mir-34b was found to be down-regulated only in BL cases that were negative for MYC translocation, suggesting that this event might be responsible for c-Myc deregulation in such cases. This hypothesis was further confirmed by our in vitro experiments, which demonstrated that increasing doses of synthetic hsa-mir-34b were able to modulate c-Myc expression. These results indicate for the first time that hsa-mir-34b may influence c-Myc expression in Burkitt lymphoma as the more common aberrant control exercised by the immunoglobulin enhancer locus. Copyright 2008 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Keywords: negative
Burkitt lymphoma; microRNAs; c-Myc; hsa-mir-34b; Let7c; translocation
Introduction Burkitt lymphoma (BL) is listed in the World Health Organization (WHO) classification of lymphoid tumours as a B-cell non-Hodgkin’s lymphoma with a high proliferative index. The WHO classification recognizes three subsets of BL: endemic, sporadic, and immunodeficiency associated. Each affects different populations and can present in different clinical forms [1]. The molecular characteristic of BL is the activation of the c-MYC oncogene through reciprocal chromosomal translocation, which juxtaposes c-MYC on chromosome 8 to the immunoglobulin (Ig) heavy chain locus on chromosome 14 or the kappa or lambda
light chain locus on chromosome 2 or 22. However, it should be considered that using FISH analysis, less than 10% of sporadic BL cases lack an identifiable MYC rearrangement [2,3]. From the EUROFISH project, which aimed to standardize FISH procedures in lymphoma diagnosis, we found that five out of 35 cases of classic endemic BL were negative for c-MYC translocation using both split and fusion probes for t(8;14), as well as IgH and IgL split probes [4]. These findings suggest that a different pathogenetic mechanism, other than MYC translocation, may be involved in malignant transformation in those cases. A novel class of RNAs (microRNAs) has recently been described, whose function seems to be crucial
Copyright 2008 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. www.pathsoc.org.uk
Role of microRNAs in the diagnosis and pathogenesis of Burkitt lymphoma
to the physiological regulation of gene expression at the post-transcriptional level. MicroRNAs (miRNAs) are small non-coding RNAs that are able, in their mature form (∼22 nt), to regulate gene expression by mRNA cleavage or translational inhibition [5]. They are usually expressed in a tissue-specific manner and play important roles in apoptosis, differentiation, and cell proliferation [6]. Several experimental studies have reported the involvement of miRNAs in cancer and their association with fragile sites in the genome [7–9], suggesting that these molecules may act as tumour suppressors or oncogenes. It has also been suggested that miRNA expression profiles can distinguish cancers according to the differentiation stage of the tumour more efficiently than mRNA expression profiles [8]. These observations prompted us to search, using web-available resources, for miRNAs directed against c-Myc and to investigate whether an imbalance in the miRNAs identified could be observed in BL cases negative for MYC translocation. Our results demonstrated down-regulation of hsa-let-7c in all the cases of BL tested and down-regulation of hsa-mir-34b in BL cases lacking the translocation. We also showed that hsa-mir-34b is able to down-regulate c-Myc specifically, as blocking hsa-mir-34b expression with a synthetic inhibitor leads to c-Myc overexpression. Our findings may explain c-Myc deregulation and Burkitt lymphomagenesis in those cases lacking MYC translocation.
Materials and methods Case selection Formalin-fixed and paraffin-embedded specimens of endemic and sporadic BL were collected from the Department of Human Pathology, Nairobi Hospital, Kenya and the Department of Human Pathology and Oncology, University of Siena, Italy. BL cases were reviewed by expert pathologists (BB, LL, HV) and diagnoses were established according to the criteria
441
of the WHO classification [1]. The diagnosis of BL was confirmed by morphology on histological slides stained with Giemsa and by immunophenotyping. The clinical and pathological data of these cases are summarized in Table 1a and Table 1b. Approval was obtained from the institutional review board of the Department of Human Pathology and Oncology of the University of Siena, Italy, and by the Ethical Committee of the Nairobi Hospital, Nairobi, Kenya, for these studies. Informed consent was obtained in accordance with the Declaration of Helsinki. Immunohistochemical studies were performed on representative paraffin sections from each case using microwave pretreatment of slides for antigen retrieval. A large panel of antibodies recognizing formalinresistant epitopes of the various antigens was applied, in conjunction with the alkaline phosphatase antialkaline phosphatase (APAAP) method, to visualize antibody binding [10]. Reactive lymph nodes were used as a control. Anti-L26 (1 : 150), anti-Ki67 (1 : 100), anti-IgA (1 : 200), anti-IgD (1 : 50), anti-cMYC (1 : 50), and anti-CD10 (1 : 20) were from BioOptica (Milan, Italy). Anti-CD79a (1 : 50), anti-IgM (1 : 10 000), anti-IgG (1 : 10 000), anti-κ (1 : 4000), anti-λ (1 : 4000), anti-p53 (1 : 50), anti-Bcl-2 (1 : 150), anti-Bcl-6 (1 : 30), and anti-LMP1 (1 : 50) were from DAKO (Milan, Italy). Anti-p21 (1 : 100) was from Calbiochem (Inalco-Division, Milan, Italy). Anti-p53 (1 : 50) was purchased from Immunotech-Delta Biologicals (Rome, Italy). The presence of Epstein–Barr virus (EBV) in primary tumors was assessed by in situ hybridization for EBERs using Epstein–Barr Virus (EBER) PNA/Fluorescein (DAKO, Denmark), a mixture of PNA probes complementary to the two nuclear EBER RNAs encoded by EBV, in conjunction with a DAKO PNA ISH Detection Kit (DAKO, Denmark). Five-micrometre-thick paraffin sections were deparaffinized, rehydrated, and processed according to the manufacturer’s instructions. A control slide, prepared from a paraffin-embedded tissue block containing metastatic nasopharyngeal carcinoma in a lymph node,
Table 1. Summary of clinical and pathological data relative to BL cases a Age range (median), years
F/M
Site (nodal/extra-nodal)
EBV+/total
HIV+/total
p53+
2–38 (14) 6–35 (17)
9/21 2/3
7/3 4/6
30/30 0/5
3/30 0/5
8/30 2/5
MYC+ MYC− b Case 1 2 3 4 5
Site
Age (years)
Sex
EBV
HIV
Phenotype
Cervical mass Ileum Jaw Lymph node Testis
35 9 6 17 13
F M M F M
Neg Neg Neg Neg Neg
Neg Neg Neg Neg Neg
CD20+, CD10+, BCL6+, BCL2−,P53+, MIB1 > 90% CD20+, CD10+, BCL6+, BCL2−,P53−, MIB1 > 90% CD20+, CD10+, BCL6+, BCL2−,P53−, MIB1 > 90% CD20+, CD10+, BCL6+, BCL2−,P53+, MIB1 > 90% CD20+, CD10+, BCL6+, BCL2−,P53−, MIB1 > 90%
EBV/HIV status refers to tumour samples. Neg = negative. J Pathol 2008; 216: 440–450 DOI: 10.1002/path Copyright 2008 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.
442
E Leucci et al
Table 2. Panel of the miRNAs used in this study with their target sequences miRNA ID
Probe code
Target sequence
RNU43
4373375 GAACUUAUUGACGGGCGGACAGAAACUGUGUGCUGAUUGUCACGUUCUGAUU hsa-mir-34b 4373037 UAGGCAGUGUCAUUAGCUGAUUG hsa-let-7c 4373167 UGAGGUAGUAGGUUGUAUGGUU hsa-miR-155 4373124 UUAAUGCUAAUCGUGAUAGGGG hsa-miR-30a-3p 4373062 CUUUCAGUCGGAUGUUUGCAGC hsa-miR-98 4373009 UGAGGUAGUAAGUUGUAUUGUU hsa-let-7a 4373169 UGAGGUAGUAGGUUGUAUAGUU
accompanied each hybridization run. HIV status in primary tumours was checked by PCR amplification as previously described [11].
Fluorescence in situ hybridization (FISH) FISH analysis was performed following standard protocols used during EUROFISH and available at www.euro-fish.org. Briefly, MYC rearrangements were sought using the MYC FISH DNA Probe–Split Signal using standard procedures. Briefly, paraffinembedded tissue sections (4 µm) were deparaffinized, air-dried, immersed in a jar filled with pretreatment solution, and warmed at 98 ◦ C for 10 min by means of a Whirlpool JT 356 microwave. Subsequently, the slides were cooled for 15 min at room temperature. After two passages of 3 min each in wash buffer, excess buffer was tapped off and the slides were digested with cold pepsin for 20 min in a Dako Cytomation Hybridizer (Dako, Denmark). The slides were then washed twice in wash buffer for 3 min, dehydrated using increasing graded ethanol series, airdried, and finally 10 µl of probe mix was applied to each tissue section. The slides, covered with a coverslip and sealed with rubber cement, were then incubated in the DakoCytomation Hybridizer (Dako, Denmark) according to the manufacturer’s recommendations. The next day, the slides were treated with stringency buffer at 65 ◦ C for 10 min and then rinsed twice in wash buffer for 3 min, dehydrated using increasing graded ethanol series, airdried, and counterstained by applying 15 µl of fluorescence mounting medium. Hybridization signals were visualized using a Leica microscope equipped with FiTC/spectrum green, Texas red/spectrum orange, and a DAPI/spectrum blue filters. Images were captured and archived using Leica FW4000 software. One hundred non-overlapping interphase nuclei were scored for each tumour specimen. In normal nuclei, two yellow fusion signals (2F) are detected, whereas in nuclei with translocations, a yellow (or red-green juxtaposed) signal is obtained from one red and one green segregated signal (1F1R1G). The results were further confirmed by additional FISH analysis using splitsignal probes for IgH and IgL loci, as well as an LSI IGH/MYC CEP 8 Tri-color Dual-Fusion Probe (Vysis,
Abbott Molecular, IL, USA) specific for the detection of the translocation t(8;14). All reagents, instruments, and split-signal probes were kindly provided by DakoCytomation (Glostrup, Denmark).
miRNA selection, RNA extraction, and real-time PCR By using web-available resources (Mirnaviewer, PicTar, Tarbase [12], and miRBase [13]; PicTar is a project of the Rajewsky laboratory at NYU’s Center for Comparative Functional Genomics and the Max Delbruck Centrum, Berlin; Mirnaviewer is available at http://cbio.mskcc.org/mirnaviewer), we searched for miRNAs directed against c-Myc. Among those predicted by the software programs, we chose six miRNAs present in different databases: hsa-mir-155, hsamir-30a-3p, hsa-mir-34b, hsa-let-7c, hsa-let-7a, and hsa-mir-98. Formalin-fixed, paraffin-embedded sections of 16 cases of BL (respectively five cases negative for MYC translocation, seven cases positive for the translocation, and four cases of sporadic BL, which were positive for translocation and EBVnegative) and reactive lymph nodes, as a control, were treated with xylene to eliminate paraffin and then miRNAs were extracted using TRIZOL (Invitrogen, Milan, Italy). After DNase I (Promega, Milan, Italy) treatment, each RNA sample was reverse-transcribed using the Taqman MicroRNA Reverse Transcription Kit (Applied Biosystems, Applera, Italy) and primers specific for each miRNA, according to the manufacturer’s instructions. Taqman probes for all of the miRNAs used in this study are summarized in Table 2. For each sample, 10 ng of total RNA was reversetranscribed. Real-time PCR was performed using Taqman probes specific for each miRNA and for RNU43, used as an endogenous control (Applied Biosystems). The probes recognize both endogenous and transfected hsa-mir-34b. The amount and quality of RNA were evaluated by measuring the OD at 260 nm and the 260/230 and 260/280 ratios by Nanodrop (Celbio, Italy). The quality of RNA was also checked by a BioAnalyzer (Agilent, CA, USA). Real-time PCR for c-myc was performed using FluoCycle SYBR green (Euroclone, Celbio, Italy) according to the manufacturer’s instructions and HPRT as an internal control. Primer sequences for c-Myc amplified a region of 129 bp: left: AGCGACTCTGAGGAGGAAC; right: TGTGAGGAGGTTTGCTGTG. Primer sequences for HPRT amplified a region of 191 bp: left: AGCCAGACTTTGTTGGATTTG; right: TTTACTGGCGATGTCAATAAG. Differences in gene expression were calculated using the Ct method [14].
Mutational analysis Mutational analysis of the hsa-mir-34b gene was performed in both MYC-translocation-negative and
J Pathol 2008; 216: 440–450 DOI: 10.1002/path Copyright 2008 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.
Role of microRNAs in the diagnosis and pathogenesis of Burkitt lymphoma
MYC-translocation-positive eBL cases by direct sequencing of PCR products. Briefly, genomic DNA extracted from primary tumours was amplified by PCR and sequenced using the Big Dye Terminator Kit (Applied Biosystems, CA, USA), following the manufacturer’s instructions. The hsa-mir-34b gene was amplified by means of two sets of primers: FW1: 5 -GGTCGAGAGAGCCAGCTCTAGG-3 ; RV1: 5 CCTTGTTTTGATGGCAGTGGAG-3 ; and FW2: 5 CTCCACTGCCATCAAAACAAGG-3 ; RV2: 5 -GCATTTTCCAACACCCCTCTTC-3 . All primers were designed using the Primer3 software (http://primer3. sourceforge.net).
Cell lines, nucleofection, and immunofluorescence Human Burkitt lymphoma cell lines, either positive or negative for EBV (Raji and Ramos, respectively), and a human B lymphoblastoid cell line (LCL) were used to carry out the in vitro experiments. Cell lines were purchased from ATCC (LGC Promochem, UK). Briefly, cells were cultured in RPMI supplemented with 10% FBS, 1% L-glutamine, penicillin/streptomycin, with 5% CO2 , at 37 ◦ C. Transient transfections were performed by nucleofection, using an Amaxa apparatus, program A23 and solution V for LCLs and program T16 and solution T for BL cells (Amaxa, Cologne, Germany). Transfection efficiency was 45% for the LCL cell line, 65% for the Raji cell line, and 33% for the Ramos cell line, as assessed by FACS analysis for a GFP reporter. Cells were transfected with 10, 25, and 50 nM hsa-mir34b mimic (C-300 145-01; Dharmacon, Celbio, Italy), 50 nM miRNA inhibitor (I-300 145-01; Dharmacon) or with 50 nM negative controls (NC I: IN-001 00001, NC: CN-001 000-01; Dharmacon). The mature miRNA sequence is UAGGCAGUGUCAUUAGCUGAUUG. RNA was extracted 7 h after nucleofection and the transfection efficiency was checked by realtime RT-PCR for hsa-mir-34b. For immunofluorescence, cells were smeared on positively charged slides 9 h after transfection and fixed in 4% paraformaldehyde in PBS for 10 min at room temperature. Permeabilization was obtained by washing cells with PBS, 0.2% Triton X-100, 1% BSA. Saturation was performed for 1 h at room temperature in goat serum (Zymed Laboratories, Milan, Italy). All of the antibodies were diluted in goat serum. Primary antibody incubation was carried out at room temperature for 1 h, using anti-Myc (9E10 sc-40; Santa Cruz Biotechnology, Santa Cruz, CA, USA) at a concentration of 1 : 50. Secondary goat anti-mouse antibody, conjugated with Alexafluor568 (Molecular Probes, Invitrogen, Italy), was diluted 1 : 100 and incubated at room temperature for 45 min. The slides were examined on an Axiovert 200 microscope (Carl Zeiss, Germany) and processed with proprietary software. All the experiments were repeated three times.
443
Results BL cases lacking MYC translocation have the morphology and the immunophenotype of typical BL and overexpressed c-Myc Thirty-five cases of classic endemic BL were tested for MYC translocation by FISH analysis using a genespecific split-signal probe. Of these, we found five negative cases. Absence of translocations was confirmed by repeating FISH both with a dual-fusion probe, specific for the detection of the translocation t(8;14), and by means of split-signal probes for IgH and IgL (Figures 1a–1d). The clinical and pathological characteristics of the cases are reported in Table 1. They had the morphology, immunophenotype, and clinical presentation of typical BL, and the diagnosis of BL could therefore be confirmed (Figures 2a and 2b) [1]. The only difference that emerged between cases negative and those positive for MYC translocation was that EBV was not detected in the cases lacking the translocation (Figures 2c and 2d). p53 expression was found in both groups with no significant difference (Table 1b) and correlated with p21 expression (data not shown). To compare the level of expression of c-Myc between cases positive and cases negative for MYC translocation, c-Myc expression was detected at the mRNA level by qRT-PCR; no significant difference was observed (Figure 3). This is in accordance with a previous report by Hummel et al [3] which showed no substantial difference in the gene expression profile among BLs carrying the MYC translocation and those without it.
hsa-let-7c and hsa-mir34b expression is altered in BL As no difference in terms of c-Myc expression was observed between cases positive and cases negative for translocation, we investigated whether there was differential expression of six miRNAs predicted to target c-Myc in BL cases carrying MYC translocation versus non-translocated ones. We found an altered pattern of expression for two miRNAs: hsa-let-7c and hsa-mir-34b. In particular, hsa-let-7c (Figure 4a) was down-regulated in all BLs tested compared with the normal controls, independently of the translocation status. On the other hand, hsa-mir-34b (Figure 4b) was specifically down-regulated in cases lacking the translocation and up-regulated in cases with typical translocation, compared with the normal controls. This finding was not related to the EBV status, as the four sporadic BL cases that we tested were EBV-negative, but showed even higher expression of this miRNA than the EBV-positive BL cases. No mutations in the hsa-mir-34b gene sequence were found, in either MYC-translocated or non-translocated cases. The expression level of the other four miRNAs predicted to target c-Myc was heterogeneous, without any significant difference between cases negative and positive for translocation, with respect to the control (data not shown).
J Pathol 2008; 216: 440–450 DOI: 10.1002/path Copyright 2008 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.
444
E Leucci et al
Figure 1. (a–d) FISH analysis to detect translocations involving the MYC gene in BL cases. BL case lacking evidence of MYC translocations (a) versus a BL case carrying MYC translocations (b) using a MYC-specific split-signal probe. FISH repeated on the same samples by means of a dual-colour dual-fusion probe specific for the detection of the translocation t(8;14)(q24;q32) confirmed the results (c and d, respectively). Original magnification 100×/1.25 OIL. All images were acquired through Leica FW4000 software by means of a Leica DMRB microscope equipped with a Leica DC350 FX camera
Figure 2. (a–d) Morphological and EBV status of BL lacking MYC translocation. Typical morphology of BL lacking MYC translocation (a) and carrying MYC translocation (b). Giemsa staining (original magnification 100×). (c, d) EBER in situ hybridization to detect EBV: (c) EBER staining of case a, which is negative for EBV; (d) EBER staining of case b, which is positive for EBV
J Pathol 2008; 216: 440–450 DOI: 10.1002/path Copyright 2008 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.
Role of microRNAs in the diagnosis and pathogenesis of Burkitt lymphoma
Figure 3. c-Myc expression in BL cases: MYC translocation either positive or negative. qRT-PCR for c-Myc in primary cases showed no differences in c-Myc expression between cases negative or positive for MYC translocation. Differences in gene expression were calculated using the Ct method. Error bars eBL represent standard deviation. reactive lymph nodes; eBL cases positive for cases negative for MYC translocation; MYC translocation; sBL cases positive for MYC translocation
hsa-mir-34b specifically targets c-Myc To confirm that hsa-mir-34b was specifically targeting c-Myc, we transfected a synthetic hsa-mir-34b miRNA into a human B lymphoblastoid cell line (Figure 5a) and then measured c-Myc expression by qRT-PCR. We found a significant dose-dependent decrease in c-myc mRNA in cells transfected with hsa-mir-34b (Figure 5b); in particular, transfection of 50 nM hsa-mir-34b completely silenced c-Myc mRNA (Figure 5b). We then checked the effect of these transfections on c-Myc at the protein level. Immunofluorescence confirmed an inverse correlation between hsa-mir-34b transfection and c-Myc expression (Figure 5c). Conversely, transfection of 50 nM hsa-mir-34 inhibitor (Figure 5d) caused a ten-fold increase in c-Myc mRNA (Figure 5e) and induced dramatic expression of c-Myc protein (Figure 5f). We then transfected BL cell lines, carrying the cMyc translocation but either negative or positive for EBV, with a synthetic hsa-mir-34b and then checked c-Myc expression. Our results demonstrated that cMyc expression was not affected by the synthetic miRNA in this context (Figures 6 and 7). On the other hand, transfection of miR-34b inhibitor was able to specifically increase the level of expression of cMyc in both EBV-positive and EBV-negative BL cells (Figures 6 and 7).
Discussion Until recently, the deregulation of the c-MYC oncogene due to translocations of genetic material between chromosome 8 and the immunoglobulin (Ig) heavy chain locus on chromosome 14 or the kappa or lambda light chain locus on chromosome 2 or 22 has been considered the molecular hallmark of BL. However,
445
it should be considered that few cases of sporadic BL lack an identifiable MYC rearrangement [2,3]. Interestingly, such cases showed the molecular profile of typical BLs carrying the c-Myc translocation [3]. Moreover, during the EUROFISH project, we also found that five out of 35 cases of endemic BL were negative for translocation involving c-Myc, using both a gene-specific split-signal probe and a dual-fusion probe for t(8;14), as well as IgH and IgL-specific split-signal probes [4]. In addition, we demonstrated that these cases express c-Myc at levels comparable to those of cases carrying the translocation. The overexpression of c-Myc in the absence of translocation may suggest that a different pathogenetic mechanism, other than MYC translocation, may be involved in malignant transformation in those cases. To investigate alternative molecular mechanisms, we decided to analyse miRNAs, which regulate gene expression at the post-transcriptional level, by checking specific miRNAs predicted to target c-myc. MicroRNAs are small regulatory biomolecules involved in processes as diverse as early development, cell proliferation and differentiation, apoptosis, and oncogenesis. Abnormal expression of miRNAs in cancer suggests that these small molecules may play a role in malignant transformation [15]. The causes of the widespread differential expression of miRNA genes in malignant compared with normal cells can be explained by the location of these genes in cancerassociated genomic regions [7], by epigenetic mechanisms, and by alterations in the microRNA processing machinery [16]. Among the six miRNAs predicted to target c-myc, two were altered in BL cases: hsa-let-7c and hsamiRNA-34b. In particular, the analysis of hsa-let-7c in BL cases revealed its down-regulation in all of the neoplastic samples, as opposed to reactive lymph nodes, with no difference between cases that were negative and cases that were positive for MYC translocation. The Let-7 family of miRNAs is required for timing of cell fate determination in C. elegans and it is conserved in many phyla [17]; in humans, various hsalet-7c genes has been mapped to fragile sites in the genome [7]. In cancer cell lines and primary tumours, let-7 expression is reduced. This miRNA family has recently been shown to target the oncogene RAS [18], resulting in c-Myc phosphorylaton and increased proliferation. Moreover, hsa-let-7c repressive effects on c-Myc have also been acknowledged in BL cell lines [19]. From our results, it is possible to speculate that down-regulation of hsa-let-7c may enhance the effects of c-Myc overexpression in cases that are positive for translocation, or that it may represent a possible mechanism of c-Myc deregulation in the negative ones. More interestingly, an alteration of the pattern of expression of hsa-mir-34b was observed only in BL
J Pathol 2008; 216: 440–450 DOI: 10.1002/path Copyright 2008 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.
446
E Leucci et al
Figure 4. (a, b) Expression of hsa-let-7c and hsa-mir-34b in primary BL cases. reactive lymph nodes; eBL cases negative for eBL cases positive for MYC translocation; sBL cases positive for MYC translocation (a) The expression MYC translocation; of hsa-let-7c was evaluated by qRT-PCR. All of the cases showed low or no expression of Let-7c compared with reactive lymph nodes, independently of EBV status or the presence/absence of MYC translocation. Differences in gene expression were calculated using the Ct method. Error bars represent standard deviation. (b) Expression of hsa-mir-34b was evaluated by qRT-PCR. Primary BL cases negative for MYC translocation showed low levels of this miRNA compared with reactive lymph nodes and cases positive for translocation. This down-regulation is independent of EBV, as EBV-negative sporadic BL cases also showed strong up-regulation of hsa-mir-34b. LCLs showed intermediate levels of expression
lacking the MYC translocation. hsa-mir-34b is a member of the mir-34 family, which has been identified as a direct target of p53 that possesses antiproliferative potential. Low levels of hsa-mir-34s have been observed in human tumours and cancer cell lines, which have a high frequency of functional p53 deficiency [20]. In our cases, we found this miRNA to be down-regulated, independently of p53 and EBV status. Intriguingly, no mutations in the hsa-mir-34b gene sequence were found in these cases, suggesting that mechanisms other than genetic alterations may explain the hsa-mir-34b down-regulation observed in MYC-translocation-negative cases. Further studies will
be necessary to elucidate the molecular mechanism underlying this down-regulation; one possibility to be exploited is that this may depend on hsa-mir-34b hypermethylation, as recently demonstrated in colorectal cancer [21]. Our in vitro experiments demonstrated for the first time that hsa-mir-34b has an impact on c-Myc regulation. In fact, we found a significant dose-dependent decrease of c-Myc in lymphoblastoid cell lines transfected with a synthetic hsa-mir-34b. Conversely, transfection of hsa-mir-34b inhibitor resulted in an increase of c-Myc expression. These results provide evidence for a novel mechanism of c-Myc over-regulation in
J Pathol 2008; 216: 440–450 DOI: 10.1002/path Copyright 2008 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.
Role of microRNAs in the diagnosis and pathogenesis of Burkitt lymphoma
447
Figure 5. (a–f) Regulation of c-Myc by hsa-mir-34b in LCL. (a) Expression level of hsa-mir-34b after transfection of increasing amounts of a synthetic hsa-mir-34b, checked by qRT-PCR. (b) After transfection of increasing amounts of a synthetic hsa-mir-34b, c-Myc transcript was checked by qRT-PCR. The more miRNA transfected, the stronger repression of c-Myc expression observed. (c) Protein levels of c-Myc in cells transfected with a synthetic hsa-mir-34b were detected by immunofluorescence. A progressive decrease in the c-Myc protein level is observed upon increasing doses of hsa-mir-34b. Nuclei are stained blue by DAPI; c-Myc was revealed by staining with Alexafluor568 (RED). (d) The expression level of hsa-mir-34b in LCL was checked by qRT-PCR after transfection of 50 nM hsa-mir-34b inhibitor or 50 nM negative control (I NC). Transfection of the inhibitor specifically reduces the expression of hsa-mir-34b. (e) The expression of c-Myc was checked by qRT-PCR after transfection of 50 nM hsa-mir-34b inhibitor or 50 nM negative control (I NC). Transfection of the miRNA inhibitor is able to increase c-Myc expression. (f) Immunofluorescence for c-Myc in cells transfected with hsa-mir-34b inhibitor or its negative control (I NC). c-Myc up-regulation is clearly visible after hsa-mir-34b inhibitor transfection. Nuclei are stained blue by DAPI; c-Myc was revealed by staining with Alexafluor568 (RED). The picture is representative of three different experiments
BL cases lacking the translocation, as the more common aberrant control exercised by the immunoglobulin enhancer locus. On the other hand, the overexpression of hsa-mir-34b in cases carrying the translocation may be due to the loss of regulation on c-Myc by hsamir-34b in this context. In this condition, hsa-mir-34b
could not be effective in regulating c-Myc expression, as c-Myc is under transcriptional control of the immunoglobulin gene promoters. This hypothesis is further strengthened by the observation that a synthetic hsa-mir-34b does not affect c-Myc levels in BL cell lines, but transfection of mir-34b inhibitor in BL
J Pathol 2008; 216: 440–450 DOI: 10.1002/path Copyright 2008 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.
448
E Leucci et al
Figure 6. (a–f) Effect of hsa-mir-34b on c-Myc expression in an EBV-positive BL cell line. (a) The expression of hsa-mir-34b was checked by qRT-PCR in Raji cells after transfection of 50 nM synthetic hsa-mir-34b, normalized on the endogenous level of hsa-mir-34b in this cell line. (NC = negative control, used at the concentration 10 nM for transfections.) (b) The expression level of c-Myc was evaluated by qRT-PCR after transfection of 50 nM synthetic hsa-mir-34b. (NC = negative control, used at the concentration 10 nM for transfections.) (c) Protein level of c-Myc in Raji cells, detected by immunofluorescence, after transfection of 50 nM synthetic hsa-mir-34b. Nuclei are stained blue by DAPI; c-Myc was revealed by staining with Alexafluor568 (RED). (d) Expression level of hsa-mir-34b, detected by qRT-PCR, in Raji cells after transfection of an hsa-mir-34b inhibitor and its negative control (I NC, 10 nM). (e) Expression level of c-Myc mRNA, detected by qRT-PCR, in Raji cells after transfection of an hsa-mir-34b inhibitor and its negative control (I NC, 10 nM). (f) Expression of c-Myc at the protein level in Raji cells, detected by immunofluorescence, after transfection of an hsa-mir-34b inhibitor and its negative control (I NC, 10 nM). Nuclei are stained blue by DAPI; c-Myc was revealed by staining with Alexafluor568 (RED). The picture is representative of three different experiments
J Pathol 2008; 216: 440–450 DOI: 10.1002/path Copyright 2008 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.
Role of microRNAs in the diagnosis and pathogenesis of Burkitt lymphoma
449
Figure 7. (a–f) Effect of hsa-mir-34b on c-Myc expression in an EBV-negative BL cell line. (a) The expression of hsa-mir-34b was checked by qRT-PCR in Ramos cells after transfection of 50 nM synthetic hsa-mir-34b, normalized on the endogenous level of hsa-mir-34b in this cell line. (NC = negative control, used at the concentration 10 nM for transfections.) (b) The expression level of c-Myc was evaluated by qRT-PCR after transfection of 50 nM synthetic hsa-mir-34b. (NC = negative control, used at the concentration 10 nM for transfections.) (c) Protein level of c-Myc in Ramos cells, detected by immunofluorescence, after transfection of 50 nM synthetic hsa-mir-34b. Nuclei are stained blue by DAPI; c-Myc was revealed by staining with Alexafluor568 (RED). (d) Expression level of hsa-mir-34b, detected by qRT-PCR, in Ramos cells after transfection of an hsa-mir-34b inhibitor and its negative control (I NC, 10 nM). (e) Expression level of c-Myc mRNA, detected by qRT-PCR, in Ramos cells after transfection of an hsa-mir-34b inhibitor and its negative control (I NC, 10 nM). (f) Expression level of c-Myc at the protein level in Ramos cells, detected by immunofluorescence, after transfection of an hsa-mir-34b inhibitor and its negative control (I NC, 10 nM). Nuclei are stained blue by DAPI; c-Myc was revealed by staining with Alexafluor568 (RED). The picture is representative of three different experiments
J Pathol 2008; 216: 440–450 DOI: 10.1002/path Copyright 2008 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.
450
cell lines still modulates c-Myc expression, supporting the finding that c-Myc is directly regulated by this miRNA. Our findings suggest that different pathogenetic mechanisms may underlie the same clinico-pathological entity. They give a molecular explanation for the occurrence of BL cases negative for translocation and further confirm the occurrence of such cases. Currently, BL cases negative for MYC translocation are not clearly designated and are often treated as diffuse large B-cell lymphoma (DLBCL). BL is an aggressive B-cell neoplasm that requires accurate diagnosis so that the patient can receive appropriately intensive treatment. A recent publication reports that patients with classical Burkitt morphological features and a very high proliferation fraction but without the MYC translocation who received less aggressive therapy usually given for DLBCL had a poor outcome compared with patients with BL [22]. Therefore, the demonstration of a specific molecular alteration in lymphomas with typical BL morphology, but negative for MYC translocation may be useful in identifying those cases that may benefit from more aggressive therapy. In conclusion, our study shows that c-Myc upregulation, due to an alternative mechanism, is the key event in Burkitt lymphomagenesis, even in cases without c-Myc translocation. In the future, identification of the complete signature of miRNA expression in additional BL cases may improve the diagnosis and will be of help in designing novel tailored therapies.
References 1. Swerdlow SH, Campo E, Harris NL, Jaffe E, Pileri S, Stein H, et al (eds) WHO Classification of Tumours of the Haematopoietic and Lymphoid Tissue. IARC: Lyon (in press). 2. Haralambieva E, Schuuring E, Rosati S, van Noesel C, Jansen P, Appel I, et al. Interphase fluorescence in situ hybridization for detection of 8q24/MYC breakpoints on routine histologic sections: validation in Burkitt lymphomas from three geographic regions. Genes Chromosomes Cancer 2004;40:10–18. 3. Hummel M, Bentink S, Berger H, Klapper W, Wessendorf S, Barth TF, et al. A biological definition of Burkitt’s lymphoma from transcriptional and genomic profiling. N Engl J Med 2006;354:2419–2430. 4. van Rijk A, Mason D, Jones M, Cabe¸cadas J, Crespo M, Cruz Cigudosa J, et al. Validation of a robust protocol for translocation detection in lymphoma diagnosis by split-signal FISH. J Hematopathol (in press).
E Leucci et al
5. Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 2004;116:281–297. 6. He L, Hannon GJ. MicroRNAs: small RNAs with a big role in gene regulation. Nature Rev Genet 2004;5:522–531. 7. Calin GA, Sevignani C, Dumitru CD, Hyslop T, Noch E, Yendamuri S, et al. Human microRNA genes are frequently located at fragile sites and genomic regions involved in cancers. Proc Natl Acad Sci U S A 2004;101:2999–3004. 8. Lu J, Getz G, Miska EA, Alvarez-Saavedra E, Lamb J, Peck D, et al. MicroRNA expression profiles classify human cancers. Nature 2005;435:834–838. 9. Volinia S, Calin GA, Liu CG, Ambs S, Cimmino A, Petrocca F, et al. A microRNA expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci U S A 2006;103:2257–2261. 10. De Falco G, Leucci E, Lenze D, Piccaluga PP, Claudio PP, Onnis A, et al. Gene expression analysis identifies novel RBL2/p130 target genes in endemic Burkitt’s lymphoma cell lines and primary tumors. Blood 2007;110:1301–1307. 11. Bellan C, Lazzi S, Hummel M, Palummo N, de Santi M, Amato T, et al. Immunoglobulin gene analysis reveals 2 distinct cells of origin for EBV-positive and EBV-negative Burkitt lymphomas. Blood 2005;106:1031–1036. 12. Sethupathy P, Corda B, Hatziegeorgiou AG. TarBase: a comprehensive database of experimentally supported animal microRNA targets. RNA 2006;12:192–197. 13. Ambros V, Bartel B, Bartel DP, Burge CB, Carrington JC, Chen X, et al. A uniform system for microRNA annotation. RNA 2003;9:277–279. 14. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the C(T) method. Methods 2001;4:402–408. 15. Esquela-Kerscher A, Slack FJ. Oncomirs — microRNAs with a role in cancer. Nature Rev Cancer 2006;6:259–269. 16. Calin GA, Croce CM. Investigation of microRNA alterations in leukemias and lymphomas. Methods Enzymol 2007;427:191–213. 17. Pasquinelli AE, Reinhart BJ, Slack F, Martindale MQ, Kuroda MI, Maller B, et al. Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature 2000;408:86–89. 18. Johnson SM, Grosshans H, Shingara J, Byrom M, Jarvis R, Cheng A, et al. RAS is regulated by the let-7 microRNA family. Cell 2005;120:635–647. 19. Sampson VB, Rong NH, Han J, Yang Q, Aris V, Soteropoulos P, et al. MicroRNA let-7a down-regulates MYC and reverts MYC-induced growth in Burkitt lymphoma cells. Cancer Res 2007;67:9762–9770. 20. He L, He X, Lim LP, de Stanchina E, Xuan Z, Liang Y, et al. A microRNA component of the p53 tumour suppressor network. Nature 2007;447:1130–1134. 21. Toyota M, Suzuki H, Sasaki Y, Maruyama R, Imai K, Shinomura Y, et al. Epigenetic silencing of microRNA-34b/c and B-cell translocation gene 4 is associated with CpG island methylation in colorectal cancer. Cancer Res 2008;68:4123–4132. 22. Sevilla D, Gong JZ, Goodman BK, Buckley PJ, Rosoff P, Gockerman JP, et al. Clinicopathologic findings in high-grade B-cell lymphomas with typical Burkitt morphologic features but lacking the MYC translocation. Am J Clin Pathol 2007;128:981–991.
J Pathol 2008; 216: 440–450 DOI: 10.1002/path Copyright 2008 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.
