Fish & Shellfish Immunology 49 (2016) 493e504
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Multifunctional murrel caspase 1, 2, 3, 8 and 9: Conservation, uniqueness and their pathogen-induced expression pattern Venkatesh Kumaresan a, Gayathri Ravichandran a, b, Faizal Nizam a, Nagarajan Balachandran Dhayanithi c, Mariadhas Valan Arasu d, Naif Abdullah Al-Dhabi d, Ramasamy Harikrishnan e, Jesu Arockiaraj a, * a Division of Fisheries Biotechnology & Molecular Biology, Department of Biotechnology, Faculty of Science and Humanities, SRM University, Kattankulathur, 603 203, Chennai, Tamil Nadu, India b SRM Research Institute, SRM University, Kattankulathur, 603 203, Chennai, Tamil Nadu, India c Centre for Biotechnology, Anna University, Chennai, 600 025, Tamil Nadu, India d Department of Botany and Microbiology, Addiriyah Chair for Environmental Studies, College of Science, King Saud University, P. O. Box 2455, Riyadh, 11451, Saudi Arabia e Department of Zoology, Pachaiyappa's College for Men, Kanchipuram, 631 501, Tamil Nadu, India
a r t i c l e i n f o
a b s t r a c t
Article history: Received 24 November 2015 Received in revised form 4 January 2016 Accepted 7 January 2016 Available online 9 January 2016
Caspases are evolutionarily conserved proteases which play fundamental role in apoptosis. Invasion of pathogen triggers the activation of caspases-mediated pro-inflammatory and pro-apoptotic pathways, where multifunctional caspases are involved. In striped murrel Channa striatus, epizootic ulcerative syndrome (EUS) causes endemics resulting in huge economic loss. Aphanomyces invadans, an oomycete is the primary causative agent of EUS which further induces secondary bacterial infections especially Aeromonas hydrophila. In order to get insights into the caspase gene family in C. striatus during EUS infection, we performed various physicochemical and structural analyses on the cDNA and protein sequences of five different murrel caspases namely CsCasp 1, 2, 3, 8 and 9. Sequence analysis of murrel caspase proteins showed that in spite of the conserved CASC domain, each caspase embraces some unique features which made them functionally different. Tissue distribution analysis showed that all the murrel caspases are highly expressed in one of the immune organs such as liver, kidney, spleen and blood cells. Further, to understand the role of caspase during EUS infection, modulation in expression of each caspase gene was analysed after inducing fungal and bacterial infection in C. striatus. Pathogen-induced gene expression pattern revealed an interesting fact that the expression of all the caspase genes reached a maximum level at 24 h post-infection (p.i) in case of bacteria, whereas it was 48 h in fungus. However, the initiation of elevated expression differed between each caspase based on their role such as proinflammatory, initiator and executioner caspase. Overall, the results suggested that the caspases in murrel are diverse in their structure and function. Here, we discuss the similarities and differences of five different murrel caspases. © 2016 Elsevier Ltd. All rights reserved.
Keywords: Snakehead murrel Innate immunity Caspase Epizootic ulcerative syndrome Pathogen-induced gene expression
1. Introduction Cells of multicellular organisms are tightly regulated by controlled cell division and tissue homeostasis which is maintained by balancing live and dead cells. When cells became aged, infected
* Corresponding author. Division of Fisheries Biotechnology & Molecular Biology, Department of Biotechnology, Faculty of Science and Humanities, SRM University, Kattankulathur, 603 203, Chennai, Tamil Nadu, India. E-mail address:
[email protected] (J. Arockiaraj). http://dx.doi.org/10.1016/j.fsi.2016.01.008 1050-4648/© 2016 Elsevier Ltd. All rights reserved.
or injured; they commit suicide by activating a process called apoptosis or programmed cell death [1]. Apoptosis is termed from a Greek word meaning ‘falling off’ or ‘dropping off’. Apoptosis is carried out via two different pathways: the intrinsic (mitochondrial) or extrinsic (death receptor) pathway [2]. Apoptosis pathway is activated by various physiological processes such as embryogenesis and pathological processes especially pathogenic infections which eventually leads to the activation of proteolytic cascade resulting in cell shrinkage, membrane blebbing, cell membrane disruption, cytoskeletal rearrangement, chromatin condensation
494
V. Kumaresan et al. / Fish & Shellfish Immunology 49 (2016) 493e504
and DNA fragmentation [3]. Apoptosis is mediated by a group of intracellular cysteine proteases called caspases (cysteine-dependent aspartate-directed proteases) which cleave the target proteins exactly next to aspartate residues that are involved in inflammation and programmed cell death [4]. Caspases are quiet distinguishable from other proteases. In general, caspases are secreted as inactive zymogens comprising a pro-domain of variable length, followed by a larger subunit p20 and a smaller subunit p10. The p20 subunit comprises a conserved CyseHis catalytic diad that is responsible for substrate recognition and catalysis. Proteolytic cleavage between p20 and p10 units activates the caspase by assembling the p10 unit into an active hetero-tetramer [5]. To date 18 different caspase proteins (including caspase recruitment domain containing protein) from human and 8 caspases (1, 2, 3, 6, 7, 8, 9 and 10) from fish have been deposited in NCBI database. Functionally, caspases can be classified into two broad groups: i) pro-inflammatory and ii) pro-apoptotic. Pro-inflammatory caspases regulate cytokine maturation during inflammation, whereas pro-apoptotic caspases mediate cell death signalling transduction. Pro-apoptotic caspases are classified into two sub-groups: i) initiator caspases and ii) effector caspases. In pro-apoptotic proteolytic cascade, the initiator caspases are activated initially, which in turn activate the effector caspases. Initiator caspases possess long prodomains that contain one of the two characteristic proteineprotein interaction motifs, death effector domain (DED) or caspase recruitment domain (CARD) [6]. DED/CARD is involved in interacting with the upstream adapter molecules and cleaves their own precursors, other caspases and few other substrates. So far, over 400 caspase substrates have been identified [7]. The effector caspases with short pro-domains perform downstream execution steps of apoptosis by cleaving multiple cellular substrates which are typically processed and was activated by upstream caspases. Viruses, bacteria, fungi and protozoa display several pathogenspecific PAMPs which induce apoptosis in host by activating caspases [8]. Host responds against both intracellular and extracellular pathogens by inducing different caspase-mediated pyroptosis (or pro-inflammatory pathway) [9], extrinsic and intrinsic apoptosis pathways [10]. Pyroptosis (or caspase 1-dependent cell death) is crucial for controlling microbial infections. Caspase 1 destroys the bacteria released from macrophages by exposing them to reactive oxygen species (ROS) in neutrophils [11]. Simultaneously, caspase 1, an intracellular caspase targets an intrinsic initiator caspase 2, which further activates the executioner caspase 3 [12]. During pathogenic infection, various pathogen-recognition receptors (PRR) such as TNF-a receptor, Fas ligand (FasL) receptor and toll-like receptor (TLR) gets activated; and further they induce the activation of extrinsic initiator caspases 8 and 10, which subsequently activate caspase 3 [13e15]. Thus, caspase plays an indispensable role against pathogens and it would be interesting to understand the changes in caspase expression pattern during pathogenic infection. Caspases share some similar features among themselves however each caspase is unique on its own which makes them different from each other both structurally and functionally. Sakamaki and Satou [16] emphasize the universal and divergent functions of vertebrate caspases and their physiological roles in animals. The structural characteristic feature of caspases 3 is a short prodomain connected with a CASC which made them unable to form a complex with other molecules through their prodomain and they require other caspases such as caspase 8 and 9 to turn them active. Caspase 3 is a main effector caspase that cleaves the majority of the substrates in cells undergoing apoptosis [17]. So far, two orthologs of Caspase 3 has been reported with different expression pattern in Zebra fish embryo. Caspase 2, 8 and 9 are initiator caspases which are required for the execution of apoptosis. However, the structural
features of those caspases are different from each other. Caspase 2 is critical for mitochondrial outer membrane permeabilization and the release of apoptotic factors in response to DNA-damaging agents [18]. Caspase 2 is also activated for death receptors (DRs)mediated and heat shock-induced apoptosis [19]. Caspase 8 carries tandem DED motifs in the amino-terminal pro-domain and an active CASC protease domain at the carboxyl terminus [20] which play an established role as an initiator of DR-mediated apoptosis [21]. Sakata et al. [22] suggested that caspase 8 has evolved and diverged into four different genes (casp8, casp10, casp18 and cflar) in vertebrates. Caspase 9 was isolated as an initiator caspase containing a CARD motif at the N-terminus. This caspase plays an essential role in the mitochondria-mediated cell death pathway [23]. In bony fish, caspase 9 has been identified and characterized in Dicentrarchus labrax, and both increased expression and protease activity of caspase 9 were detected in the head kidney of D. labrax infected with Photobacterium damselae ssp. piscicida, suggesting the involvement in the advanced septicaemia [24]. Caspase 1 is the most different caspase which mainly involves in inflammatory reactions. Caspsae 1 was previously known as the interleukin (IL)-1bconverting enzyme (ICE) which acts as a major effector caspase in inflammation in all vertebrates. Fernandes-Alnemri et al. [25] suggest that caspase 1 is crucial for the maturation of inflammatory cytokines in inflammation and may also play a role as a proapoptotic molecule under pathologically adverse conditions. Fish are continuously exposed to various pathogens and their innate immune system plays a major role to fight against those pathogens. Channa striatus, commonly known as snakehead fish (or striped murrel) is a commercially important teleost, which is extensively affected by a disease called epizootic ulcerative syndrome (EUS) [26]. EUS is primarily caused by Aphanomyces invadans, an oomycete fungus which allows the growth of secondary bacterial pathogens especially Aeromonas hydrophila [27e29]. Many isoforms of caspases have been identified and characterized in fish including Danio rerio, D. labrax, Oncorhynchus mykiss, Paralichthys olivaceus, Oplegnathus fasciatus, Miichthys miiuy, Sparus aurata and Cyprinus carpio [30e37]. Till date there are no reports about the role of caspases in C. striatus except caspase 10 (CsCasp 10) [38] which we have characterized and reported recently. Moreover, no effort has been made to understand the distribution of different caspases among various tissues in fish, especially C. striatus; and their temporal expression at various time points during pathogen infection. Hence, we conducted this study to establish a comparative data on murrel caspases and examine their expression after bacterial and fungal infection. Here, we report a comprehensive comparative analysis of cDNA and protein sequences of five different murrel caspases designated as CsCasp 1, 2, 3, 8 and 9 including structural and evolutionary analysis. We have also reported the tissue distribution pattern of the five murrel caspases and their differential expression patterns after infection by EUS causing fungus, A. invadans and bacteria A. hydrophila. 2. Materials and methods 2.1. cDNA and protein sequence analysis Five caspase cDNA sequences were identified using BLAST search tool from the transcriptome dataset of C. striatus constructed from tissue pool. The full length of the sequences were obtained and confirmed by internal sequencing using ABI Prism-Bigdye Terminator Cycle Sequencing Ready Reaction kit. Translated and untranslated regions (UTR) were identified from the retrieved sequences using DNAssist Version 2.2. The cDNA sequences were translated using EXPASY translate tool (http://web.expasy.org/ translate/). The translated protein sequences were analysed for
V. Kumaresan et al. / Fish & Shellfish Immunology 49 (2016) 493e504
495
Fig. 1. Multiple sequence alignment of CsCasp 1, 2, 3, 8 and 9. Conserved residues are highlighted in black and similar residues are displayed in blue background. Conserved “KPKLFFIQAC” motif is showed within brown colour box and the conserved ‘His’ and ‘Cys’ residues are indicated in asterisk (*). The conserved Tyrosine residues among proapoptotic caspases are represented as hash tags (#). Double sided arrow mark indicate the ‘CASC domain’ region. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
various parameters such as molecular weight, theoretical pI, amino acid composition, atomic composition, extinction coefficient, estimated half-life, instability index, aliphatic index and grand average of hydropathicity (GRAVY) using Protparam (http://web.expasy. org/protparam/). NCBI Conserved domain database (http://www. ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi) was used to annotate the caspase domain architecture based on homologous sequences and the domain models were imported from external databases. Presence of signal peptide region was predicted using SignalP tool (http://www.cbs.dtu.dk/services/SignalP/) and transmembrane region was predicted using Memsat (http://www.sacs.ucsf.edu/cgibin/memsat.py). Cellular location of each the proteins were predicted using MultiLoc server and MultiLoc (Animal) 9 Locations prediction method (http://abi.inf.uni-tuebingen.de/Services/ MultiLoc/). To identify the conserved regions among the selected C. striatus caspases, multiple protein sequence alignment was performed using BioEdit sequence alignment editor (ver. 7.1.3.0). Based on the structures of homologous sequences derived from protein databank (PDB), two dimensional structures of each caspase genes
were predicted by Polyview (http://polyview.cchmc.org/) and their three dimensional structures were predicted by submitting the protein sequence to I-Tasser server (http://zhanglab.ccmb.med. umich.edu/I-TASSER/). The three dimensional protein structures were further validated by analysing the backbone dihedral angles j against 4 of amino acid residues using Ramachandran plot (http:// mordred.bioc.cam.ac.uk/~rapper/rampage.php) program and finally the structures were viewed in PyMOL 0.99 software. The images presented in the article were visually optimized using Adobe Photoshop (ver. 7.0) software. 2.2. Phylogenetic analysis Phylogenetic analysis was inferred by neighbour joining method using MEGA 5.0. The analysis involved 91 amino acid sequences which include 6 murrel caspases namely 1, 2, 3, 8, 9 and 10 along with other homologous caspase protein sequences from mammals, amphibians, birds and fish. Both pairwise and multiple alignment were performed using CLUSTAL W with Gonnet protein weight
496
V. Kumaresan et al. / Fish & Shellfish Immunology 49 (2016) 493e504
Fig. 2. Domain architecture and two dimensional structure of CsCasp 1, 2, 3, 8 and 9. Red zig-zag lines denote the helix region and green arrows indicate b-sheet. Blue colour lines represent the coil region. Black dotted circles represent the conserved helix region and red dotted box denote the conserved four-parallel b-sheet structure. In domain architecture, red colour boxes at N-terminal represent the location of the ‘CARD domain’ and red circles denote ‘death domain’. Blue boxes indicate the position of ‘CASC domain’. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
matrix. All positions containing gaps and missing data were eliminated. Gap opening penalty and gap extension values were set to default. Phylogeny test was carried out using bootstrap method with 1000 bootstrap replications. The evolutionary distances were computed using Poisson substitution model. The tree was viewed in two different styles one on radiation style (Fig. 4) and another on traditional (E-supplementary file 1). 2.3. Pathogens and disease challenge A. invadans was isolated from EUS infected C. striatus and stored on GP agar slants at 4 C until further use. The fungus was grown in GP broth at 23 C for 4 days and the spores were collected. The spores were counted using haemocytometer and adjusted to 102 spores/mL. A. hydrophila (MTCC#1739) is a Gram negative bacterium which causes secondary EUS infections in fish; was purchased from MTCC (IMTECH, Chandigarh, India) and maintained as glycerol stocks at 80 C. Overnight grown bacterial culture was inoculated in fresh Nutrient Broth Medium (HiMedia Labs, India) and allowed to grow at 37 C for 4e6 h to ensure that the cells are in exponential growth phase, then centrifuged at 5000 g for 5 min and adjusted to 106 CFU/mL using PBS. The concentration of bacterial cells and fungal spores and their growth media were optimized in our previous studies [28e30]. Bacterial challenge was induced by intra-peritoneal injection at 106 cells and fungal at 102 spores. One hundred ml of PBS was injected to the control. 2.4. Animal and tissue collection C. striatus with an average weight of 300 g were collected from Porur Lake (13.034223 N; 80.15065 E), Chennai, Tamil Nadu, India. They were transported to the aquarium at Division of Fisheries
Biotechnology and Molecular Biology, SRM University and acclimatised for a week. For each challenge, a batch of 30 fishes was experimented along with a set of control. Blood was collected in sterile syringes and other tissues such as gills, head kidney, trunk kidney, intestine, liver, skin, spleen, heart, brain and muscle were also collected from both control and challenged fishes at 6 different time points including 0, 3, 6, 12, 24, 48 and 72 h. Each tissue was collected from each group at each time point from three fishes. All the tissue samples were flash frozen in liquid nitrogen and then stored at 80 C until further analysis for molecular studies. 2.5. RNA extraction, cDNA synthesis and gene expression analysis Total RNA was extracted from the tissues using High Pure RNA Tissue Kit (Roche Diagnostics GmbH, Germany) and the purity and quantity of RNA was determined by UV-1800 Spectrophotometer (Shimadzu). cDNA was synthesized from the extracted total RNA as template and oligo(dT) primer using Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics GmbH, Germany) according to the manufacturer's protocol. To quantify the transcripts of caspases, RTqPCR analysis was performed in Light Cycler 96 Real Time PCR system using Fast SYBR® Green Master Mix (Roche Diagnostics GmbH, Germany). Relative quantification of each caspase was carried out along with b-actin as internal reference. Twenty ml RTqPCR mixture which consisted 4 ml cDNA tissue sample, 7.5 ml Fast SYBR® Green Master Mix, 0.5 ml PCR forward/reverse primers (10 mM) and 7.5 ml nuclease-free water used for the assay. The primer details were given in Table 1. The PCR assay was conducted at 95 C for 30 s, 40 cycles of 95 C for 5 s and 58 C for 60 s thermal profiles. Melting curve analysis of amplification products was performed at the end of each PCR to confirm that only one PCR product was amplified and detected. The efficiency of the RT-qPCR reactions
V. Kumaresan et al. / Fish & Shellfish Immunology 49 (2016) 493e504
497
Fig. 3. Three dimensional structures of CsCasp 1, 2, 3, 8 and 9. Red colour turns represent the helix region present at the N-terminal of CsCasp 2, 8 and 9. Pink colour region represents the CASC domain with conserved helices and four parallel b-sheets. The location of active residues ‘Cys’ and ‘His’ are represented as spheres, where ‘His’ residues are represented as red spheres and ‘Cys’ as blue colour spheres. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
was calculated based on the slope of the standard curve. The relative quantification of gene products were recorded as quantification cycle (Cq) values. The results were analysed and calculated using 2DDCT method [39]. 2.6. Data analysis All the relative expression data were submitted in SPSS (ver. 11.5) for statistical analysis. To study the significant level (at 5%) of the relative gene expression, the following statistics were applied: one-way ANOVA and Tukey's Multiple Range Test. 3. Results and discussion 3.1. Sequence analysis All the cDNA sequences and their corresponding protein sequences were submitted to EMBL database in the following order: CsCasp 1 (HF947511), CsCasp 2 (HF955398), CsCasp 3 (HF955036), CsCasp 8 (HF913727) and CsCasp 9 (HF947510). All the five caspase proteins and their characteristic features including sequence length, coding and non-coding regions, molecular mass, cellular location, isoelectric point and location of transmembrane regions were tabulated in Table 2. Further, the protein specific domains, active residues, common motifs and the nature of each caspase were provided in Table 3. 3.2. Conserved features of C. striatus caspases Though the murrel caspases are diverse in their structure and function, they share some conserved features. Multiple sequence
alignment showed that all the murrel caspases have a conserved ‘CASC’ domain architecture at their C terminal region along with the conserved active residues ‘His’ and ‘Cys’. The active residue ‘His’ was located between ‘Ser’ at N-terminal and ‘Gly’ at C terminal, which also remained conserved among all murrel caspases (Fig. 1). Similarly, another active residue ‘Cys’ was located at the end of a motif “KPKLFFIQAC” in the domain, which remain conserved among all the murrel apoptotic caspases. The motif ‘KPKLFFIQAC’ was involved in synthesizing siRNA to inhibit the apoptosis in malfunctioning cells [40]. According to our results, CsCasp 2, 8, 9 and 10 had more conserved residues, whereas CsCasp 1 had less conserved residues compared with its murrel caspase homologues. This is because CsCasp 1 is a pro-inflammatory caspase, whereas other C. striatus caspases (2, 3, 8 and 9) are pro-apoptotic. Interestingly, the pro-domain containing caspases (CsCasp 1, 2, 8 and 9) comprise conserved ‘Arg’ and ‘Leu’ residues in both CASP and DED pro-domain regions. These residues are specific for the endopeptidase cleavage activity of cysteine proteases that are involved in the activation of these caspases [41]. Thus, it is clear that these residues are responsible for caspase activation. Among the proapoptotic caspases (2, 3, 8 and 9), the conserved tyrosine residues present in the CASC domain is suggested to play critical role in downstream apoptosis activity (Fig. 1). Jia et al. [42] reported that the phosphorylation and dephosphorylation of tyrosine residues regulates the neutrophils survival during infection. Protein localisation and signal peptide prediction results showed that all the murrel caspases are intracellular and no signal peptide region was observed. Structural analysis showed that all the caspases contain two conserved b-sheet region in the CASC domain and each sheet is followed by two a-helices. Between these two conserved b-sheet
498
V. Kumaresan et al. / Fish & Shellfish Immunology 49 (2016) 493e504
Fig. 4. Phylogenetic tree of C. striatus caspases along with their homologous sequences. The tree is represented in radiation view to understand the distribution of different caspases. The percentage of replicate of phylogenetic trees in which the associated taxa clustered together in the bootstrap test is shown next to the branches. All the murrel caspase genes are represented as black dots. Each clade is described with the respective organism name; the sequence accession number is mentioned in bracket. The value 0.1 at the left bottom represents the scale of the phylogenetic tree.
regions, four parallel b-sheets are also present in murrel caspases except CsCasp 1 (Fig. 2). McLuskey [41] described that the conserved b-sheet is necessary for the structural integrity of
caspases. In all CsCasp, the CASC domain starts with a conserved bsheet and ends near another b-sheet structure; the active residues, ‘His’ and ‘Cys’ remained in a coil region within CASC domain (Fig. 3).
V. Kumaresan et al. / Fish & Shellfish Immunology 49 (2016) 493e504 Table 1 Forward and reverse primers of each caspase gene used for quantitative realtime PCR analysis. Primer name
Primer sequence (50 e 30 )
Csb-actin F1 Cs b-actin R2 CsCasp 1 F3 CsCasp 1 R4 CsCasp 2 F5 CsCasp 2 R6 CsCasp 3 F7 CsCasp 3 R8 CsCasp 8 F9 CsCasp 8 R10 CsCasp 9 F11 CsCasp 9 R12
TCTTCCAGCCTTCCTTCCTTGGTA GACGTCGCACTTCATGATGCTGTT GAGAGTCACAACAGAAGAGGTG GCTGTGAGGTTTGTGTGTTTC GAGTTGGACTGGGTGTTTGA CCACGACAGGCCTGAATAAA CAGACAGTGGACCAGATGAAA TCCGTGACTCAACAGAACAC GCTTCTTGTGTCAGGGTCTT GGAAGTAAGGGTTCTCCAACAG GTGGACGGACAATGTATCTCAG CCACATGCCTGGATGAAGAA
Moreover, CASC domain in the pro-apoptotic CsCasp 2, 3, 8 and 9 has more conserved helices which is absent in the proinflammatory caspase, CsCasp 1. Thus, it is clear that the structure of CASC domain remains conserved among pro-inflammatory caspases and these conserved features are responsible for the specific binding of caspases with the substrates and inhibitors [43]. However, the structure and function of CASC domain varies between pro-inflammatory and pro-apoptotic caspases.
3.3. Uniqueness of C. striatus caspases In spite of their conserved features, each C. striatus caspase has unique structural and functional features. Each caspase have their own domain architecture based on the function which they perform. The pro-inflammatory caspase, CsCasp 1, comprises a CARD pro-domain with 82 residues and a CASC domain with 252 amino acids. It involves in pyroptosis and activates apoptosis to
499
defend against intracellular pathogens. Among all the caspases, CsCasp 1 constitutes a putative transmembrane region which is unique for caspase 1 and no other caspase has the feature. The transmembrane region is located in the b-sheet region of CASC domain. The transmembrane protein involved in the activation of caspase-mediated apoptosis [44] and therefore it reduces the mitochondrial transmembrane potential [45]. However, the exact function of the transmembrane region has to be elucidated. In this study, we observed two types of initiator caspases; they are intrinsic (CsCasp 2 and 9) and extrinsic (CsCasp 8). Intrinsic initiator caspases contain a CARD domain in the N-terminal, which is made of 91 residues. Caspase 8 is activated by autocatalytic process which occurs upon dimerization of caspase zymogens [46,47] which further cleaves the effector caspases. Similarly, Caspase 2 gets activated by an autoproteolytic mechanism in which the disulphide linkage between the caspase 2 monomers plays an important role [48]. However, caspase 2 is functionally different from caspase 8. Unlike Caspase 8, Caspase 2 does not involve in direct cleavage of any effector caspase but they function to amplify the signal downstream of caspase 3 activation [49]. In case of extrinsic initiator caspase (CsCasp 8), two death domain receptors namely DED r1 and DED r2 were observed, which are made of 76 and 68 residues, respectively. These N-terminal domains are the specific targets for the upstream molecules to activate these caspases. CsCasp 8 is comparatively a larger protein than the other four caspases because of N-terminal DED tandem repeats whereas CsCasp 3 is the smallest caspase which does not have any N-terminal domain. Upon activation, initiator caspases such as CsCasp 2, CsCasp 8 and CsCasp 9 further stimulates the downstream caspasemediated apoptosis pathway which finally activates the executioner CsCasp 3. CsCasp 3 does not contain any N-terminal domains; however it activates the downstream signalling molecules such as ROCK and DFF40 that induces membrane blebbing and DNA damage in cells [50]. In addition, CsCasp 3 contains two arginine-
Table 2 Comparative table showing the physical properties of five murrel caspase cDNA and Protein sequences. S. No
Parameters
CsCasp 1
CsCasp 2
CsCasp 3
CsCasp 8
CsCasp 9
1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15.
Gene length (bp) ORF length (bp) 50 UTR (bp) 30 UTR (bp) Protein length (aa) Molecular weight (daltons) Isoelectric point (pI) Instability index (II) Extinction coefficients Estimated half-life (h) Aliphatic index Grand average of hydropathicity Signal peptide Cellular location Transmembrane region
1603 1266 334 3 422 47468.9 5.66 36.6 30285 30 82.96 -0.549 No Cytoplasmic 235e251
1362 1308 51 3 436 49600.5 6.05 53.68 28055 30 72.73 -0.538 No Nuclear No
912 855 54 3 285 31409.2 5.71 30.15 26400 30 64.98 -0.388 No Nuclear No
1605 1449 153 3 483 54965.7 5.41 39.05 28810 30 84.74 0.430 No Cytoplasmic No
1299 1296 e 3 432 48340.3 5.68 53.63 30870 30 73.31 -0.613 No Nuclear No
Table 3 Comparative table showing the structural parameters of five murrel caspase proteins. S. No
Parameters
CsCasp 1
CsCasp 2
CsCasp 3
CsCasp 8
CsCasp 9
1. 2. 3. 4. 5. 6. 7. 8. 9.
Pro-domain name Pro-domain interval (aa) CASC domain interval (aa) Active His residue position Active Cys residue position Type of caspase Pathway Highly expressed tissue RGD cell attachment sequence
CARD_CASP1 27e109 167e419 242 292 Pro-inflammatory Pro-inflammatory Blood N/A
CARD_CASP2 7e94 158e428 245 288 Initiator Intrinsic Blood N/A
e e 47e283 132 174 Executioner Executioner Spleen 17 e 19, 155 e 157
DED r1; DED r2 2e76; 91e173 231e481 315 358 Initiator Extrinsic Liver N/A
CARD_CASP9 5e87 162e429 246 296 Initiator Intrinsic Kidney N/A
500
V. Kumaresan et al. / Fish & Shellfish Immunology 49 (2016) 493e504
Fig. 5. Tissue distribution patterns of C. striatus caspases (5A, CsCasp 1; 5B, CsCasp 2; 5C, CsCasp 3; 5D, CsCasp 8 and 5E, CsCasp 9) by quantitative real time PCR analysis. Data presented for each tissue represent the ratio of CsCasp expression in those tissues to the expression level in minimum expressed tissue.
glycine-aspartate (RGD) cell attachment sequences which are involved in integrin-recognition. Buckley et al. [51] reported that RGD-containing peptides are able to directly induce apoptosis. 3.4. Evolution of murrel caspases Neighbour-Joining phylogenetic analysis of murrel caspases along with other mammalian homologous showed that they are classified into five different clusters (Fig. 4). CsCasp 1 along with other caspase 1 is positioned at the bottom of the phylogenetic tree and diverged from all other caspases. Followed by caspase 1, caspase 2 was formed as a separate clade. Further, they are branched into three clusters; among that caspase 3 and 9 were formed into two different separate clades and in the third clade, caspase 8 and 10 were clustered together. Caspase 8 and 10 of fish were clustered together and are diverged from mammalian Caspase 8 and 10. Caspase 1 grabbed the bottom position in the phylogenetic tree because they are pro-inflammatory and are different from other pro-apoptotic caspases. They were gathered in a cluster which further separated into two sub-clusters where fish and mammal caspases remained diverged. In the second cluster, caspase 2 formed a separate clade, which is also internally divided into fish and mammalian caspase 2. In this cluster, different isoforms from same organisms such as D. rerio, Esox lucius and
Astyanax mexicanus were grouped together stating that those isoforms are closer within them and diverged from other organisms. Caspase 2 is evolutionarily ancient, the most highly conserved caspase among animals and one of the earliest caspase discovered [52]. The third cluster is caspase 9 with three subclusters in which they belonged to fish, amphibians and mammals. The analysis indicated that the caspase 9 was evolved from caspase 2, since both the groups shared a common pro-domain CARD. In the tree, other three caspases including 3, 8 and 10 shared a sister clade with caspase 9. This is due to all these caspases belonged to pro-apoptic family. Caspase 3 remained as a separate cluster which could be because of the absence of prodomain region and a shorter protein length. Interestingly, caspase 8 and 10 are clustered together, since they have a similar architecture along with death domain; it is also indicated that fish caspase 8 are closely related with fish caspase 10, likewise mammalian caspase 8 and 10. The diversity between fish and mammals suggested that these caspases are evolved recently from each other. Also the function of caspase 8 and 10 differ between mammals and fish. Notably, Caspase 8 and 10 are located in chromosome 2 in human [53], 7 in Gallus gallus, Xenopus tropicalis and Canis familiaris, but in D. rerio, caspase 8 was located in LG6, whereas caspase 10 in linkage group 9 (LG9) and LG 11, which is unique to fish, not in other vertebrates [22]. This explains the evolution of caspase 8 and 10 from fish to higher vertebrates.
V. Kumaresan et al. / Fish & Shellfish Immunology 49 (2016) 493e504
501
Fig. 6. Fungal post-challenged gene expression pattern of CsCasp 1 (6A), CsCasp 2 (6B), CsCasp 3 (6C), CsCasp 8 (6D) and CsCasp 9 (6E). The time course of CsCasp gene expression in highly expressed tissue at 3, 6, 12, 24, 48 and 72 h post injection with Aphanomyces invadans. Data are expressed as a ratio to CsCasp gene in sample from control group.
3.5. Constitutive gene expression Tissue distribution analysis revealed that the mRNA expression level of CsCasp 1, 2, 3, 8 and 9 was different among various tissues as tested using real-time PCR assay (Fig. 5). It is interesting to note that all the caspases are significantly expressed in major immune organs such as spleen, liver and kidney. However, the gene product was expressed in other tissues also. Relative basal expression analysis showed that CsCasp 3 is the maximum expressed caspase in spleen, a major lymphoid organ of C. striatus. CsCasp 8 was highly expressed in liver and CsCasp 9 in trunk kidney followed by head kidney. CsCasp 1 and 2 are highly expressed in blood. The differences in expression pattern among C. striatus caspases suggested that each caspase might differ functionally. According to the tissue distribution analysis, CsCasp 1 and 2 are highly expressed in blood. Blood is the major circulating tissue and they carry immune cells such as neutrophils and other peripheral mononuclear cells which are responsible for inflammation. Inflammation is an important function involved during infection for eradicating the pathogen as well as damaged cells, thereby preventing the spread of infection to the neighbouring cells. Since, CsCasp 1 is involved in the activation of inflammatory pathway; it is obvious to observe these caspase in blood. Yamanaka [54] reported
that caspase 1 is constitutively expressed in blood cells and are involved in inducing inflammation. However, it is to be noted that CsCasp 1 has also been expressed significantly in other major immune organs such as liver and spleen. This suggested that CsCasp 1 is not specific to any particular tissue and they are expressed in all immune related tissues but their rate of expression differs based on the vicinity of infection. Caspase 2 is one of the initiator caspases that initiates the apoptosis especially in mitochondria which contains a long prodomain CARD. The pro-caspase 2 remains inactive because of the CARDeCARD interaction between two pro-caspases. Active caspase 2 permeabilize the outer membrane of mitochondria, thereby releasing the apoptotic factors in response to DNA damaging agents and heat stress [55]. The expression of CsCasp 2 in blood is supported by reports of many other researchers who have reported the constitutive expression of caspase 2 in blood immune cells [56,57]. Caspase 3 plays critical roles in execution of the apoptotic pathway. In C. striatus, the maximum expression of CsCasp 3 is observed in spleen, a typical lymphoid organ. CsCasp 3 is the most highly expressed caspase in C. striatus taken for analysis, which is 120 folds more than that of in muscle. Ren et al. [58] reported the expression of caspase 3 in spleen and liver of large yellow croaker (Pseudosciaena crocea). Also, orthologues of caspase 3 has been
502
V. Kumaresan et al. / Fish & Shellfish Immunology 49 (2016) 493e504
Fig. 7. Bacterial post-challenged gene expression pattern of CsCasp 1 (7A), CsCasp 2 (7B), CsCasp 3 (7C), CsCasp 8 (7D) and CsCasp 9 (7E). The time course of CsCasp gene expression in highly expressed tissue at 3, 6, 12, 24, 48 and 72 h post injection with Aeromonas hydrophila. Data are expressed as a ratio to CsCasp gene in sample from control group.
characterized in different fish species such as rainbow trout O. mykiss and zebrafish. In zebra fish, two orthologues of caspase 3 has been identified among which caspase 3A is expressed in trunk kidney, whereas caspase 3B in head kidney. CsCasp 8, an extrinsic initiator caspase was highly expressed in liver. Liedtke et al. [59] and Hatting et al. [60] reported the importance of hepatocyte-specific caspase 8 due to the induction of apoptosis. It is notable that the expression of CsCasp 8 is relatively lower than the intrinsic initiator caspases (CsCasp 2 and 9). However, the functional importance of this difference has to be elucidated in detail. Caspase 8 has a pair of pro-domain called death domain receptors namely DED r1 and DED r2; they initiate the apoptosis through extrinsic pathway. Binding of a ‘death ligand’ to these receptors changed the receptor conformation, thus allowing the recruitment of an adaptor protein such as FADD that forms a complex and resulting in auto-activation of caspase 8 [61]. Caspase 9 is an initiator caspase carrying a CARD domain at the N terminus which activates the effector caspases through the intrinsic cell death pathway. In C. striatus, CsCasp 9 is expressed more in both head and trunk kidneys. Their expressions in other organs are comparatively lower than that of observed in kidneys. Araki [62] discussed the vital role of Casp 9 during programmed cell
death in kidney. 3.6. Temporal variation in gene expression In C. striatus, the primary causative agent of EUS is A. invadans which causes ulcers in fish tissues. Ulcers are nothing but tissue damage which is primarily carried out by various necrosis and apoptotic components. These ulcers enhanced the growth of secondary bacterial pathogens especially A. hydrophila. Geissler et al. [63] reported that the bacterial and fungal virulent factors stimulate various signalling pathways involving initiator caspases such as caspase 2, 8, 9 and 10 which results the activation of executioner caspase 3 that ends up with DNA damage and membrane blebbing. Hence, it is important to understand the constitutive expression of each caspase gene and the pathogeninduced expression pattern. In a recent study, it has been proved that bacterial virulence factors such as LPS induces caspase 1 and NLRP3 inflammosome complex which results in pyroptosis activity [64]. Fungi are known to induce apoptosis by secreting toxins which induce apoptosis by forming inflammosomes and thereby activating caspase 1 mediated pyroptosis [65]. Viruses are known to produce anti-apoptotic
V. Kumaresan et al. / Fish & Shellfish Immunology 49 (2016) 493e504
proteins since apoptosis is a major threat for their existence, thus it is clear that the activation of caspase strongly affects the viral replication. In addition to apoptosis, effector caspases such as caspase 3 cleaves some viral proteins, therefore inhibiting their replication [66]. From these findings, it is clear that the bacterial, viral and fungal pathogens involved in the activation of apoptosis and they induced the cell death. In this study, we analysed the role of C. striatus caspases against bacterial and fungal pathogens. Both the pathogens induced significant temporal expression of all the five caspase transcripts. Maximum expression of all the caspases was observed at 48 h postinfection (p.i) of fungal infection (Fig. 6), whereas it is 24 h in bacterial infected individuals (Fig. 7). It is obvious that the time required for establishment of bacterial pathogenicity in a host is shorter than the fungus. Hence the expression of caspases during bacterial infection is earlier than the fungal infections. Though the highest expression is uniform among bacteria and fungi, the pattern of expression differed between each caspase and it is noteworthy that the differences in the expression pattern are based on the functional role of each caspase. However, the folds of increase in expression differed for each gene. It is important to note that fungal infection induced a maximum of 87 folds in CsCasp 8 and bacterial infection induced 62 folds of CsCasp 9. The significant increase in expression of caspases confirmed the potential role of those genes against bacterial and fungal pathogens. In case of CsCasp 1, the initial increase in expression was observed at 6 h p.i of bacteria and 12 h p.i of fungus. Miao et al. [67] demonstrated the crucial role of caspase 1 dependent pyroptosis during Salmonella sp infection in mice. Vojtech et al. [68] observed an increased expression of caspase 1 within 8 h p.i of Franscisella infection in zebrafish. The expression of extrinsic initiator caspase (CsCasp 8 at 3 h p.i) was earlier than the intrinsic initiator caspases (CsCasp 2 at 12 h p.i and CsCasp 9 at 6 h p.i). These results suggested that the extrinsic apoptosis pathway is initiated earlier than the death receptor pathway. Another interesting observation was that during bacterial infection, the intrinsic caspase (CsCasp 9) was highly expressed (Fig. 7), whereas during fungal infection, the extrinsic caspase (CsCasp 8) was highly expressed (Fig. 6). The possible reason is that A. hydrophila is an intracellular pathogen which could enter the cells and induced the mitochondrion-associated apoptotic signalling pathways. But, fungal pathogens are extracellular and the toxins are released by them which induced through extrinsic FASligand mediated apoptosis pathway. Ben-Abdallah [69] reported that Cryptococcus neoformans infection induced extrinsic apoptosis pathway in mice. Overall, it is clear that all the five caspases are critically involved against bacterial and fungal pathogens and the upstream activity of each caspase is varied from each other. Conclusively, it is well demonstrated that caspases play a major role in C. striatus and their primary involvement in proinflammatory and pro-apoptotic pathways. The structural and physico-chemical features described in this study may contribute to novel drug development. Also, this study conveyed a comparative report about all the available C. striatus caspases which discloses the uniqueness and conservation of murrel caspases. Pathogen-induced expression studies disclosed the critical involvement of caspases against invading bacterial and fungal pathogens. Acknowledgment The authors would like to extend their sincere appreciation to the Deanship of Scientific Research at King Saud University for its funding of this research through the Research Group Project No. RG-1435-071.
503
Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.fsi.2016.01.008. References [1] M. Raff, Cell suicide for beginners, Nature 396 (6707) (1998) 119e122, http:// dx.doi.org/10.1038/24055. [2] Z. Hongmei, Extrinsic and Intrinsic Apoptosis Signal Pathway Review, INTECH Open Access Publisher, 2012, http://dx.doi.org/10.5772/50129. [3] S. Elmore, Apoptosis: a review of programmed cell death, Toxicol. Pathol. 35 (4) (2007) 495e516, http://dx.doi.org/10.1080/01926230701320337. [4] E.S. Alnemri, D.J. Livingston, D.W. Nicholson, G. Salvesen, N.A. Thornberry, W.W. Wong, J. Yuan, Human ICE/CED-3 protease nomenclature, Cell 87 (1996) 171. [5] H.Y. Chang, X. Yang, Proteases for cell suicide: functions and regulation of caspases, Microbiol. Mol. Biol. Rev. 64 (4) (2000) 821e846. [6] B.C. Barnhart, J.C. Lee, E.C. Alappat, M.E. Peter, The death effector domain protein family, Oncogene 22 (53) (2003 Nov 24) 8634e8644. [7] A.U. Lüthi, S.J. Martin, The CASBAH: a searchable database of caspase substrates, Cell Death Differ. 14 (4) (2007 Apr) 641e650. [8] T.H. Mogensen, Pathogen recognition and inflammatory signaling in innate immune defenses, Clin. Microbiol. Rev. 22 (2) (2009) 240e273, http:// dx.doi.org/10.1128/CMR.00046-08. [9] E.A. Miao, J.V. Rajan, A. Aderem, Caspase-1 induced pyroptotic cell death, Immunol. Rev. 243 (1) (2011) 206e214, http://dx.doi.org/10.1111/j.1600065X.2011.01044.x. [10] H. Ashida, H. Mimuro, M. Ogawa, et al., Cell death and infection: a doubleedged sword for host and pathogen survival, J. Cell Biol. 195 (6) (2011) 931e942, http://dx.doi.org/10.1083/jcb.201108081. [11] T. Bergsbaken, S.L. Fink, B.T. Cookson, Pyroptosis: host cell death and inflammation, Nat. Rev. Microbiol. 7 (2009) 99e109, http://dx.doi.org/ 10.1038/nrmicro2070. [12] V. Jesenberger, K.J. Procyk, J. Yuan, S. Reipert, M. Baccarini, Salmonella-induced caspase-2 activation in macrophages: a novel mechanism in pathogenmediated apoptosis, J. Exp. Med. 192 (7) (2000) 1035e1046. [13] O. Micheau, J. Tschopp, Induction of TNF receptor I-mediated apoptosis via two sequential signaling complexes, Cell 114 (2003) 181e190. [14] N. Harper, M. Hughes, M. MacFarlane, G.M. Cohen, Fas-associated death domain protein and caspase-8 are not recruited to the tumor necrosis factor receptor 1 signaling complex during tumor necrosis factor-induced apoptosis, J. Biol. Chem. 278 (2003) 25534e25541. [15] N. Festjens, T. Vanden Berghe, S. Cornelis, P. Vandenabeele, RIP1, a kinase on the crossroads of a cell's decision to live or die, Cell Death Differ. 14 (3) (2007) 400e410. [16] K. Sakamaki, Y. Satou, Caspases: evolutionary aspects of their functions in vertebrates, J. Fish. Biol. 74 (4) (2009) 727e753. [17] U. Fischer, R.U. Janicke, K. Schulze-Osthoff, Many cuts to ruin: a comprehensive update of caspase substrates, Cell Death Differ. 10 (2003) 76e100. [18] B. Zhivotovsky, S. Orrenius, Caspase-2 function in response to DNA damage, Biochem. Biophys. Res. Commun. 331 (3) (2005) 859e867. [19] S. Tu, G.P. McStay, L.M. Boucher, T. Mak, H.M. Beere, D.R. Green, In situ trapping of activated initiator caspases reveals a role for caspase-2 in heat shock-induced apoptosis, Nat. Cell Biol. 8 (2006) 72e77. [20] K. Nakajima, A. Takahashi, Y. Yaoita, Structure, expression, and function of the Xenopus laevis caspase family, J. Biol. Chem. 275 (2000) 10484e10491. [21] U. Fischer, C. Stroh, K. Schulze-Osthoff, Unique and overlapping substrate specificities of caspase-8 and caspase-10, Oncogene 25 (2006) 152e159. [22] S. Sakata, Y. Yan, Y. Satou, et al., Conserved function of caspase-8 in apoptosis during bony fish evolution, Gene 396 (1) (2007) 134e148, http://dx.doi.org/ 10.1016/j.gene.2007.03.010. [23] P. Li, D. Nijhawan, I. Budihardjo, S.M. Srinivasula, M. Ahmad, E.S. Alnemri, X. Wang, Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade, Cell 91 (1997) 479e489. [24] M.I. Reis, A. do Vale, C. Pinto, D.S. Nascimento, C. Costa-Ramos, D.S. Silva, M.T. Silva, N.M. Dos Santos, First molecular cloning and characterisation of caspase-9 gene in fish and its involvement in a gram negative septicaemia, Mol. Immunol. 44 (2007) 1765e1775. [25] T. Fernandes-Alnemri, J. Wu, J.W. Yu, P. Datta, B. Miller, W. Jankowski, S. Rosenberg, J. Zhang, E.S. Alnemri, The pyroptosome: a supramolecular assembly of ASC dimers mediating inflammatory cell death via caspase-1 activation, Cell Death Differ. 14 (2007) 1590e1604. [26] S.A. Mastan, T.A. Qureshi, Observations on the histological alterations in various tissues of EUS affected fish, Channa striatus (Bloch), J. Environ. Biol. 24 (4) (2003) 405e410. [27] P. Bhatt, V. Kumaresan, R. Palanisamy, M.K. Chaurasia, A.J. Gnanam, M. Pasupuleti, J. Arockiaraj, Immunological role of C4 CC chemokine-1 from snakehead murrel Channa striatus, Mol. Immunol. 57 (2) (2014) 292e301. [28] V. Kumaresan, A.J. Gnanam, M. Pasupuleti, M.V. Arasu, N.A. Al-Dhabi, R. Harikrishnan, J. Arockiaraj, Comparative analysis of CsCu/ZnSOD defense role by molecular characterization: gene expression-enzyme activity-protein level, Gene 564 (1) (2015) 53e62, http://dx.doi.org/10.1016/
504
V. Kumaresan et al. / Fish & Shellfish Immunology 49 (2016) 493e504
j.gene.2015.03.042. [29] J. Arockiaraj, R. Palanisamy, A. Arasu, A. Sathyamoorthi, V. Kumaresan, P. Bhatt, M.K. Chaurasia, M. Pasupuleti, A.J. Gnanam, An anti-apoptotic B-cell lymphoma-2 (BCL-2) from Channa striatus: Sequence analysis and delayed and advanced gene expression in response to fungal, bacterial and poly I: C induction, Mol. Immunol. 63 (2) (2015) 586e594, http://dx.doi.org/10.1016/ j.molimm.2014.07.018. [30] W. Ji, H. Liang, W. Zhou, X. Zhang, Apoptotic responses of zebrafish (Danio rerio) after exposure with microcystin-LR under different ambient temperatures, J. Appl. Toxicol. 33 (8) (2013 Aug) 799e806, http://dx.doi.org/10.1002/ jat.2735. [31] M.I. Reis, D.S. Nascimento, A. do Vale, M.T. Silva, N.M. dos Santos, Molecular cloning and characterisation of sea bass (Dicentrarchus labrax L.) caspase-3 gene, Mol. Immunol. 44 (5) (2007 Feb) 774e783. [32] V. Rojas, F. Guzm an, C. Valenzuela, S. Marshall, L. Mercado, Development of a caspase-3 antibody as a tool for detecting apoptosis in cells from rainbow trout (Oncorhynchus mykiss), Electron. J. Biotechnol. 15 (2012) 1e11. [33] T. Kurobe, I. Hirono, H. Kondo, M. Yamashita, T. Aoki, Molecular cloning, expression, and functional analysis of caspase-10 from Japanese flounder Paralichthys olivaceus, Fish. Shellfish Immunol. 23 (6) (2007 Dec) 1266e1274. [34] D.A. Elvitigala, I. Whang, H.K. Premachandra, N. Umasuthan, M.J. Oh, S.J. Jung, S.Y. Yeo, B.S. Lim, J.H. Lee, H.C. Park, J. Lee, Caspase 3 from rock bream (Oplegnathus fasciatus): genomic characterization and transcriptional profiling upon bacterial and viral inductions, Fish. Shellfish Immunol. 33 (1) (2012 Jul) 99e110. [35] L. Ren, R. Wang, T. Xu, Three representative subtypes of caspase in miiuy croaker: genomic organization, evolution and immune responses to bacterial challenge, Fish. Shellfish Immunol. 40 (1) (2014 Sep) 61e68. pez-Castejo n, M.P. Sepulcre, I. Mulero, P. Pelegrín, J. Meseguer, V. Mulero, [36] G. Lo Molecular and functional characterization of gilthead seabream Sparus aurata caspase-1: the first identification of an inflammatory caspase in fish, Mol. Immunol. 45 (1) (2008 Jan) 49e57. [37] D. Gao, Z. Xu, X. Zhang, C. Zhu, Y. Wang, W. Min, Cadmium triggers kidney cell apoptosis of purse red common carp (Cyprinus carpio) without caspase-8 activation, Dev. Comp. Immunol. 41 (4) (2013 Dec) 728e737. [38] J. Arockiaraj, A.J. Gnanam, D. Muthukrishnan, M. Pasupuleti, J. Milton, A. Singh, An upstream initiator caspase 10 of snakehead murrel Channa striatus, containing DED, p20 and p10 subunits: molecular cloning, gene expression and proteolytic activity, Fish. Shellfish Immunol. 34 (2) (2013) 505e513. [39] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method, Methods 25 (4) (2001 Dec) 402e408. [40] M. Seki, W. Soussou, S. Manabe, S.A. Lipton, Protection of retinal ganglion cells by caspase substrate-binding peptide IQACRG from N-methyl-d-aspartate receptor-mediated excitotoxicity, Investig. Ophthalmol. Vis. Sci. 51 (2) (2010) 1198e1207, http://dx.doi.org/10.1167/iovs.09-4102. [41] K. McLuskey, J.C. Mottram, Comparative structural analysis of the caspase family with other clan CD cysteine peptidases, Biochem. J. 466 (Pt 2) (2015) 219e232. [42] S.H. Jia, J. Parodo, A. Kapus, O.D. Rotstein, J.C. Marshall, Dynamic regulation of neutrophil survival through tyrosine phosphorylation or dephosphorylation of caspase-8, J. Biol. Chem. 283 (9) (2008) 5402e5413. [43] Y. Wei, T. Fox, S.P. Chambers, J. Sintchak, J.T. Coll, J.M. Golec, L. Swenson, K.P. Wilson, P.S. Charifson, The structures of caspases-1, -3, -7 and -8 reveal the basis for substrate and inhibitor selectivity, Chem. Biol. 7 (6) (2000 Jun) 423e432. [44] C. Li, J. Wei, Y. Li, X. He, Q. Zhou, J. Yan, J. Zhang, Y. Liu, Y. Liu, H.B. Shu, Transmembrane Protein 214 (TMEM214) mediates endoplasmic reticulum stress-induced caspase 4 enzyme activation and apoptosis, J. Biol. Chem. 288 (24) (2013 Jun 14) 17908e17917. [45] N.J. Waterhouse, J.C. Goldstein, O. von Ahsen, M. Schuler, D.D. Newmeyer, D.R. Green, Cytochrome C maintains mitochondrial transmembrane potential and Atp generation after outer mitochondrial membrane permeabilization during the apoptotic process, J. Cell Biol. 153 (2) (2001) 319e328. [46] M. Chen, A. Orozco, D.M. Spencer, J. Wang, Activation of initiator caspases through a stable dimeric intermediate, J. Biol. Chem. 277 (2002) 50761e50767. [47] M. Donepudi, A.M. Sweeney, C. Briand, M.G. Grutter, Insights into the regulatory mechanism for caspase-8 activation, Mol. Cell. 11 (2003) 543e549.
[48] B.C. Baliga, S.H. Read, S. Kumar, The biochemical mechanism of caspase-2 activation, Cell Death Differ. 11 (2004) 1234e1241. [49] C.M. Troy, M.L. Shelanski, Caspase-2 redux, Cell Death Differ. 10 (2003) 101e107. [50] B. He, N. Lu, Z. Zhou, Cellular and nuclear degradation during apoptosis, Curr. Opin. Cell Biol. 21 (6) (2009) 900e912. [51] C.D. Buckley, D. Pilling, N.V. Henriquez, G. Parsonage, K. Threlfall, D. ScheelToellner, D.L. Simmons, A.N. Akbar, J.M. Lord, M. Salmon, RGD peptides induce apoptosis by direct caspase-3 activation, Nature 397 (6719) (1999) 534e539. [52] S. Kumar, M. Kinoshita, M. Noda, N.G. Copeland, N.A. Jenkins, Induction of apoptosis by the mouse Nedd2 gene, which encodes a protein similar to the product of the Caenorhabditis elegans cell death gene ced-3 and the mammalian IL-1 b-converting enzyme, Genes Dev. 8 (1994) 1613e1626. [53] J. Grenet, T. Teitz, T. Wei, V. Valentine, V.J. Kidd, Structure and chromosome localization of the human CASP8 gene, Gene 226 (2) (1999) 225e232. [54] K. Yamanaka, R. Clark, R. Dowgiert, D. Hurwitz, M. Shibata, B.E. Rich, K. Hirahara, D.A. Jones, S. Eapen, H. Mizutani, T.S. Kupper, Expression of interleukin-18 and caspase-1 in cutaneous T-cell lymphoma, Clin. Cancer Res. 12 (2) (2006 Jan 15) 376e382. [55] M. Enoksson, J.D. Robertson, V. Gogvadze, P. Bu, A. Kropotov, B. Zhivotovsky, S. Orrenius, Caspase-2 permeabilizes the outer mitochondrial membrane and disrupts the binding of cytochrome c to anionic phospholipids, J. Biol. Chem. 279 (48) (2004 Nov 26) 49575e49578. [56] Z. Estrov, P.F. Thall, M. Talpaz, E.H. Estey, H.M. Kantarjian, M. Andreeff, D. Harris, Q. Van, M. Walterscheid, S.M. Kornblau, Caspase 2 and caspase 3 protein levels as predictors of survival in acute myelogenous leukemia, Blood 92 (9) (1998 Nov 1) 3090e3097. [57] D. Siniscalco, A. Sapone, C. Giordano, A. Cirillo, V. de Novellis, L. de Magistris, F. Rossi, A. Fasano, S. Maione, N. Antonucci, The expression of caspases is enhanced in peripheral blood mononuclear cells of autism spectrum disorder patients, J. Autism Dev. Disord. 42 (7) (2012 Jul) 1403e1410. [58] L. Ren, R. Wang, T. Xu, Three representative subtypes of caspase in miiuy croaker: genomic organization, evolution and immune responses to bacterial challenge, Fish. Shellfish Immunol. 40 (1) (2014 Sep) 61e68. [59] C. Liedtke, J.M. Bangen, J. Freimuth, N. Beraza, D. Lambertz, F.J. Cubero, M. Hatting, K.R. Karlmark, K.L. Streetz, G.A. Krombach, F. Tacke, N. Gassler, D. Riethmacher, C. Trautwein, Loss of caspase-8 protects mice against inflammation-related hepatocarcinogenesis but induces non-apoptotic liver injury, Gastroenterology 141 (6) (2011 Dec) 2176e2187. [60] M. Hatting, G. Zhao, F. Schumacher, G. Sellge, M. Al Masaoudi, N. Gabler, M. Boekschoten, M. Müller, C. Liedtke, F.J. Cubero, C. Trautwein, Hepatocyte caspase-8 is an essential modulator of steatohepatitis in rodents, Hepatology 57 (6) (2013 Jun) 2189e2201. [61] M. Kruidering, G.I. Evan, Caspase-8 in apoptosis: the beginning of “the end”? IUBMB Life 50 (2) (2000 Aug) 85e90. [62] T. Araki, M. Hayashi, K. Nakanishi, N. Morishima, T. Saruta, Caspase-9 takes part in programmed cell death in developing mouse kidney, Nephron Exp. Nephrol. 93 (3) (2003) e117ee124. [63] A. Geissler, F. Haun, D.O. Frank, K. Wieland, M.M. Simon, M. Idzko, R.J. Davis, U. Maurer, C. Borner, Apoptosis induced by the fungal pathogen gliotoxin requires a triple phosphorylation of Bim by JNK, Cell Death Differ. 20 (10) (2013 Oct) 1317e1329. [64] J.M. Blander, A long-awaited merger of the pathways mediating host defence and programmed cell death, Nat. Rev. Immunol. 14 (9) (2014 Sep) 601e618. [65] C.N. Casson, S. Shin, Inflammasome-mediated cell death in response to bacterial pathogens that access the host cell cytosol: lessons from legionella pneumophila, Front. Cell. Infect. Microbiol. 3 (2013) 111. [66] S.M. Best, M.E. Bloom, Caspase activation during virus infection: more than just the kiss of death? Virology 320 (2) (2004 Mar 15) 191e194. [67] E.A. Miao, I.A. Leaf, P.M. Treuting, et al., Caspase-1-induced pyroptosis is an innate immune effector mechanism against intracellular bacteria, Nat. Immunol. 11 (12) (2010) 1136e1142. [68] L.N. Vojtech, N. Scharping, J.C. Woodson, J.D. Hansen, Roles of inflammatory caspases during processing of zebrafish interleukin-1b in Francisella noatunensis infection, B€ aumler AJ, ed, Infect. Immun. 80 (8) (2012) 2878e2885. re, P. Ave , A. Louise, F. Moyrand, F. Weih, [69] M. Ben-Abdallah, A. Sturny-Lecle met, Fungal-induced cell cycle impairment, chromosome G. Janbon, S. Me instability and apoptosis via differential activation of NF-kB, PLoS Pathog. 8 (3) (2012) e1002555.
