FEMS Microbiology Letters 190 (2000) 341^347
www.fems-microbiology.org
Molecular characterisation of emergent multiresistant Salmonella enterica serotype [4,5,12:i:3] organisms causing human salmonellosis è ngeles Gonza¨lez-Hevia c , Beatriz Guerra a , Idoia Laconcha b , Sara M. Soto a , M. A M. Carmen Mendoza a; * a
è rea Microbiolog|¨a, Facultad de Medicina, Universidad de Oviedo, C/Julia¨n Claver|¨a s/n, 33006 Oviedo, Spain Departamento de Biolog|¨a Funcional, A b Departamento de Inmunolog|¨a, Microbiolog|¨a y Parasitolog|¨a, Facultad de Farmacia, Universidad del Pa|¨s Vasco, 01080 Vitoria-Gazteiz, Spain c Laboratorio de Salud Pu¨blica, Consejer|¨a de Sanidad, Principado de Asturias, 33001 Oviedo, Spain Received 24 May 2000 ; received in revised form 20 July 2000; accepted 21 July 2000
Abstract Salmonella multidrug-resistant clinical organisms identified as serotype [4,5,12:i:3] were typed using selected genetic procedures and compared with typhimurium organisms collected in the same Spanish region. Results showed a low genetic heterogeneity among [4,5,12:i:3] organisms, which generated identical ribotypes and similar but not identical XbaI PFGE, RAPD, and plasmid profiles. Multidrug resistance could be eliminated by curing and seems to be mediated by 140-kb (spvC+) and 120-kb (spvC3) non-self-transferable plasmids. The [4,5,12:i:3] organisms fall into a single genetic lineage, which emerged in 1997 and presents a different degree of genetic relationship with typhimurium lineages. ß 2000 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Salmonella [4,5,12:i:3]; Ribotyping; Polymerase chain reaction typing; Pulsed-¢eld gel electrophoresis; Plasmid; Antimicrobial resistance
1. Introduction In August 1997, the Spanish National Salmonella Reference Laboratory [Centro Nacional de Microbiolog|¨a, CNM, Majadahonda, Madrid] detected the emergence of Salmonella enterica subsp. enterica multidrug-resistant organisms with an atypical antigenic formula [4,5,12:i:3] which were assigned to a new serotype [1,2]. The cited paper [1] also reported that selected [4,5,12 :i:3] strains had been phage-typed according to the scheme of Anderson et al. [3] only being lysed by the additional Salmonella serotype typhimurium phage 10, and thus being ascribed to DT U302. This phage type has been considered closely related to DT104 [4]. The incidence of [4,5,12 :i:3] organisms increased rapidly, becoming in 1998 the fourth most frequently encountered Salmonella sp. serotype in Spain (4.3% annual incidence), and was associated with contaminated pork as the source [1,2]. In our laboratories during the last decade di¡erent mo-
* Corresponding author. Fax: +34 (9) 85103148; E-mail :
[email protected]
lecular methods have been used to distinguish Salmonella strains from di¡erent sources and serotypes and some of the methods proved to be accurate tools for phylogenetic and/or epidemiological purposes [5^10]. Ribotyping analyses the sequence divergence of the rRNA genes which are organised as polycistronic transcriptional units called rrn operons (5P^promoter^16S spacer region^23S spacer region^5S^3P) and together with their adjacent sequences form the rDNA regions. While the rRNA genes are highly conserved, the adjacent sequences and the intergenic spacer region between the 16S and 23S rRNA genes can show a signi¢cant degree of variation in length and sequence within a single species, and the di¡erences can be used to discriminate strains. The ribotyping procedures applied in this work were: analysis of restriction fragment length polymorphisms of rDNA regions generated with selected restriction endonucleases and Southern hybridisation with an rrn probe [5,6,8] ; and ampli¢cation by PCR and analysis of the intergenic spacer region using oligonucleotide primers complementary to conserved sequences of the 16S and 23S rRNA genes [11,12]. On the other hand, the random ampli¢ed polymorphic DNA segment analysis or RAPD-PCR and the pulsed-¢eld gel electrophoresis
0378-1097 / 00 / $20.00 ß 2000 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. PII: S 0 3 7 8 - 1 0 9 7 ( 0 0 ) 0 0 3 5 9 - 1
FEMSLE 9581 28-8-00
342
B. Guerra et al. / FEMS Microbiology Letters 190 (2000) 341^347
(PFGE) typing analyse the sequence divergence of total DNA. RAPD uses arbitrary oligonucleotides to promote DNA synthesis at low annealing temperatures and some oligonucleotides are useful tools to divulge Salmonella genomic diversity [6,7,13,14]. PFGE uses endonucleases that cut DNA at rare restriction sites generating large fragments and this technique is generally considered to be the `gold standard' in Salmonella typing [9,10,15]. For an accurate characterisation of pathogenic bacteria other features such as virulence, antimicrobial resistance and plasmid pro¢les should be determined and related, because virulence and resistance genes can be plasmid-mediated. The aims of the present study were: (i) the molecular characterisation of the organisms belonging to the emergent [4,5,12:i:3] serotype registered in the Laboratorio de Salud Pu¨blica (LSP) del Principado de Asturias during 1997^1998, using typing methods of proved value to di¡erentiate organisms between and within Salmonella serotypes [5^10,15], and (ii) to ascertain their genetic relationships between [4,5,12 :i:3] and typhimurium organisms, the latter having been previously characterised using the selected typing methods [5,7^9]. 2. Materials and methods 2.1. Salmonella strains This study was carried out with 16 isolates of Salmonella serotype [4,5,12 :i:3] collected during 1997^1998 in the microbiology laboratories of public hospitals situated in di¡erent localities of the Principality of Asturias, which were registered at the LSP (acting as Asturias Salmonella
Reference Centre) and identi¢ed by serotyping in the CNM. In these isolates an epidemiological correlation was not apparent, each of them being implicated in one sporadic case of human gastroenteritis. In addition, the ¢rst [4,5,12 :i:3] clinical isolate identi¢ed in the CNM (CNM9IC), as well as one [4,5,12 :i:3] pork meat isolate (CNM4IC) were used as human and pork type strains, respectively; and Salmonella serotype typhimurium ATCC 14028 (DT133) and LSP14/92 (DT104) were employed as outgroup strains. Escherichia coli K12 W3110 and J53, both rifampicin-resistant (Rif ), and Salmonella serotype Panama LSP291/98, nalidixic acid-resistant (Nal ), were used as plasmid recipients in mating experiments. Typhimurium LSP31/93 (DT104) carrying a selftransferable R-plasmid (encoding resistance to ampicillin, chloramphenicol, streptomycin, spectinomycin, sulfadiazine and tetracycline) of 140 kb was used as positive mating control. 2.2. Virulence, plasmid and antimicrobial resistance pro¢les In the detection of virulence genes pho, stn, invE/A, spvC [16^19] and slyA by PCR (as well as in the other PCRbased procedures used in this work) DNA template was attained from 15 Wl of a 10-fold distilled water dilution of a Luria^Bertani broth (LB, 10 g bacto-tryptone, 5 g bactoyeast extract and 10 g NaCl, pH 7, Merck, Germany) overnight culture as in [7]. Assays were performed in 50 Wl reaction mixture containing the 15 Wl of DNA template, 200 WM of each dNTP (Roche Diagnostics, Spain), 1 WM of each primer (Amersham Pharmacia Biotech, Spain), 2 U of Dynazyme II DNA polymerase and its ampli¢cation bu¡er (Finnzymes Oy, Finland). Ampli¢cations were car-
Table 1 Oligonucleotides used as primers in the present work PCR procedure
Target or purpose
Oligonucleotide primer Name
Sequence (5P-3P)
Reference
pho gene
[pho-F/B]
[16]
stn gene
[stn-F/B]
invE/A genes
[inv-F/B]
spvC gene
[spvC-F/B]
slyA gene
[sly-F/B]
[ATGCAAAGCCCGACCATGACG/ GTATCGACCACCACGATGGTT] [TTAGGTTGATGCTTATGATGGACACCC/ CGTGATGAATAAAGATACTCATAGG] [GCCCGAACGTGGCGATAATT/ TCACCGGCATCGGCTTCAAT] [ACTCCTTGCACAACCAAATGCGGA/ TGTCTTCTGCATTTCGCCACCATCA] [GCCAAAACTGAAGCTACAGGTG/ CGGCAGGTCAGCGTGTCGTGC]
SR pro¢le
[Rib-F/B]
[TTGTACACACCGCCCGTCA/ GGTACCTTAGATGTTTCAGTTC]
[11]
S pro¢le B pro¢le C pro¢le
S B (OPB-6) C (OPB-17)
[TCACGATGCA] [TGCTCTGCCC] [AGGGAACGAG]
[13] [14] [14]
Virulence pro¢le
[17] [18] [19] This worka
Ribotyping
RAPD typing
F/B : forward/backward. Primers designed from the gene sequence introduced in GenBank (accession number U03842).
a
FEMSLE 9581 28-8-00
B. Guerra et al. / FEMS Microbiology Letters 190 (2000) 341^347
ried out in Perkin-Elmer GeneAmp systems (models 9700 and 2400) as follows : a hot start cycle of 94³C for 5 min, followed by 25 cycles of 94³C for 30 s, 60³C for 30 s and 72³C for 40 s, and a ¢nal extension step of 72³C for 5 min. The primers used are compiled in Table 1. Plasmid content was determined following the alkaline lysis method [20]. Both mating and curing experiments were carried out using two selected [4,5,12 :i:3] strains: LSP389/97 (carrying a 140-kb spvC+ plasmid) and LSP272/98 (carrying a 120-kb spvC3 plasmid). Transfer of antibiotic resistance by mating was performed in liquid medium as in [21]. The mixture of donor and recipient strains was incubated at 37³C for 6^8 h and aliquots were taken out, vigorously shaken, and spread onto selective plates with ampicillin, gentamicin or trimethoprim together with rifampicin (100, 20, 10 and 30 Wg ml31 , respectively) for the Rif receptors, or the three former antimicrobials and nalidixic acid (60 Wg ml31 ) for the Nal receptor. Plasmid curing was carried out on LB medium containing 1% of SDS as described in [22]. Antimicrobial susceptibility was tested according to the guidelines of the National Committee for Clinical Laboratory Standards [23] for the disc di¡usion technique using Mu«ller-Hinton agar (Oxoid, Spain) and commercial discs (BioMe¨rieux and Oxoid, Spain). The antimicrobials and disc load in Wg tested were: amikacin 30 (Ak), ampicillin 10 (Ap), cefalotin 30 (Ce), ceftazidime 30 (Caz), chloramphenicol 30 (Cm), cipro£oxacin 5 (Cip), gentamicin 10 (Gm), imipenem 10 (Ip), kanamycin 30 (Km), streptomycin 10 (S), nalidixic acid 30 (Nal), tetracycline 30 (Tc), sulfadiazine 300 (Su), and trimethoprim^sulfamethoxazole 1.25/23.75 (Sxt). Susceptibility and resistance were delineated using the breakpoints and zone size criteria set by NCCLS [23]. When the strains presented intermediate resistance values, they were considered resistant strains. 2.3. DNA ¢ngerprinting analysis Isolation of genomic DNA and ribotyping were carried out as in [5,6]. The endonucleases HincII, PvuII and a mixture of PstI-SphI (Amersham Pharmacia Biotech, Spain) were selected to perform ribotyping because of their good discriminatory power within Salmonella serotype typhimurium [5,8]. In both single and double digestions, samples of 2 Wg DNA were digested overnight with 5 U of each enzyme. The hybridisation was performed using a non-radioactive DNA labelling and detection kit (Roche Diagnostics, Spain) and using a DNA fragment carrying the rrnB operon from E. coli as a probe. Ampli¢cation by PCR and analysis of the intergenic spacer region between 16S and 23S rRNA genes was carried out as cited above but with the following PCR conditions : a hot start cycle of 94³C for 5 min, followed by 30 cycles of 94³C for 30 s, 55³C for 1 min and 72³C for 1 min, and a ¢nal extension step of 72³C for 5 min. The primers used are compiled in Table 1.
343
RAPD typing was performed using three selected primers, labelled S, B and C (Table 1) as described in [7]. Ampli¢cation conditions were: two initial cycles of 94³C for 4 min, 35³C for 2 min and 72³C for 2 min, followed by 35 cycles of 94³C for 30 s, 35³C for 1 min and 72³C for 2 min, and a ¢nal extension step of 72³C for 5 min. For PFGE analysis, preparation of cells and fragmentation of the bacterial DNA using XbaI (Roche Diagnostics, Spain) was carried out as described in [10]. DNA fragments were subjected to PFGE in agarose (Agarose Molecular Grade, Bio-Rad Laboratories, Richmond, CA, USA) 1.2% w/v in 0.5UTBE (0.5 M Tris, 0.1 M boric acid, 0.2 mM EDTA, pH 8.0) bu¡er in a CHEF-DR II system (Bio-Rad), with the running conditions described in [9]: 6 V cm31 at 14³C for 26 h, with pulse times ramping from 5 to 15 s over 7 h, and from 15 to 60 s over 19 h, at 120³C. Polymerised phage V DNA was used as the molecular size marker (Sigma, St. Louis, MO, USA). Clustering analysis between PFGE patterns was made using Dice's similarity coe¤cient and unweighted pair group method with arithmetic averages (UPGMA) as reported in [5,6,9]. 3. Results and discussion 3.1. Virulence, plasmid and antimicrobial resistance pro¢les The presence of virulence genes for invasion (invE/A), production of enterotoxin (stn) and cytolysin (slyA), resistance within macrophages (pho) and the Salmonella plasmid virulence region (spvC), in the strains under study were tested by PCR. All [4,5,12 :i:3] and typhimurium strains were found to be positive for the genes of chromosomal location (invE/A, stn, slyA, and pho). Fourteen of the 18 [4,5,12:i:3] isolates and the typhimurium strains were positive for spvC whereas the four remaining strains, including the Salmonella [4,5,12:i:3] type strain CNM9IC, were negative. All Salmonella [4,5,12 :i:3] isolates carried three or four plasmids. The number and size of the plasmids carried by each isolate (Fig. 1) led us to di¡erentiate four plasmid pro¢les (PP), PPI being the most frequent (11 out of 18 strains, 61%). It is noteworthy that all pro¢les included large plasmids of about 140 kb (14 isolates, which generated positive ampli¢cation of spvC and represented three pro¢les : PPI, PPIII and PPIV) or 120 kb (four isolates, which generated negative ampli¢cation of spvC and represented PPII). The two typhimurium strains presented the serotype-characteristic virulence plasmid (spvC+) of 90 kb, alone (ATCC 14028) or together with two other small plasmids (LSP14/92), being assigned to PPVI and PPV, respectively. All experiments were carried out at least twice to ensure the reproducibility of the results. All [4,5,12:i:3] organisms were susceptible to Ak, Cef, Caz, Cip, Ip, Km, and Nal; and all except one presented
FEMSLE 9581 28-8-00
344
B. Guerra et al. / FEMS Microbiology Letters 190 (2000) 341^347
plasmids from the parent strains (Fig. 1) and the organisms derived from LSP389/97 conserved spvC. 3.2. DNA ¢ngerprinting analysis The 18 Salmonella [4,5,12:i:3] isolates and the outgroup typhimurium strains were analysed by DNA ¢ngerprinting procedures. All experiments were conducted at least twice to ensure the reproducibility of the results. Data were compiled and shown in Figs. 2^5. The analysis of Salmonella [4,5,12 :i:3] isolates by ribotyping performed separately with the endonucleases HincII, PvuII, and the PstI-SphI mixture yielded in every case a single band pro¢le (labelled H14, P10 and PS15 ribotype, respectively). These ribotypes (Fig. 2) were di¡erent to the ones generated by the typhimurium strains ATCC 14028 and LSP14/92 compared to which they showed di¡erent similarity coe¤cients (HincII: D = 0.96^0.74, PvuII : D = 0.9, and PstI-SphI: D = 0.84^071), the similarity being greater with the LSP14/92 ribotypes. When ribotypes generated by [4,5,12 :i:3] organisms were compared with the ones generated by typhimurium organisms also collected in the Principality of Asturias [5,8] two ¢ndings could be noteworthy: (i) neither H14, P10 nor PS15 ribotypes had been found among typhimurium organisms with which they preFig. 1. Plasmid pro¢les in S. enterica serotypes typhimurium and [4,5,12:i:3]. a: Typhimurium ATCC 14028; b, typhimurium LSP14/92; c, plasmid pro¢les from [4,5,12:i:3] isolates. Asterisks indicate organisms obtained by curing of PPI and PPII isolates. Lane C: molecular size standard plasmids. Chr: chromosomal DNA.
the same multidrug resistance pro¢le (RP) which included Ap, Cm, Gm, S, Su, Sxt and Tc (RPI). The other isolate (LSP272/98) was Tc-susceptible (RPII). Typhimurium LSP14/92 DT104 presented a typical DT104 ¢ve-drug resistance pro¢le [4,24], ApCmTcSSu (RPIII), and ATCC 14028 presented another less frequent one, ApCmTc (RPIV). In order to ascertain whether some or all of the resistance determinants of the [4,5,12 :i:3] isolates were plasmid-mediated, mating and curing experiments were done, using representative isolates of PPs with 140-kb spvC+ or 120-kb spvC3 plasmids (LSP389/97 and 272/ 98, respectively). The results from the mating experiments, using three di¡erent recipients, showed that no antimicrobial resistance from the Salmonella [4,5,12 :i:3] isolates tested could be transferred by mating. On the other hand, multidrug resistance and a 140-kb R-plasmid from the control strain (LSP31/93) were transferred to the three recipients. Conversely, from the curing experiments antibiotic-susceptible organisms from both [4,5,12 :i:3] isolates were obtained. These organisms had lost the resistance to ApCmGmSTp, but none of them had lost the resistance to Su or Tc (when this resistance was present in the parent strain). Cured organisms continued carrying large plasmids although these were smaller in size than the
Fig. 2. Ribotypes generated with HincII, PvuII and PstI-SphI in S. enterica serotypes typhimurium and [4,5,12:i:3]. a: Typhimurium ATCC 14028; b, typhimurium LSP14/92; c, [4,5,12:i:3] LSP389/97. Lanes A and B: DNA of phage V digested with PstI and HindIII, respectively.
FEMSLE 9581 28-8-00
B. Guerra et al. / FEMS Microbiology Letters 190 (2000) 341^347
Fig. 3. Amplicon pro¢les generated in S. enterica serotypes typhimurium and [4,5,12:i:3]. S, B, and C show RAPD pro¢les generated with S, B, and C primers, respectively. SR shows pro¢les (or ribotypes) generated by the ampli¢cation of the spacer region between 16S and 23S rRNA genes. a, Typhimurium ATCC 14028; b, typhimurium LSP14/92; c: [4,5,12:i:3] LSP389/97; d: [4,5,12:i:3] LSP468/98. Lane A: DNA of phage V digested with PstI.
sented a di¡erent degree of similarity ; (ii) among typhimurium strains the most frequent ribotypes, H1, P1, and PS1 (34.72%, 62.5% and 35%, respectively), were represented mainly by DT104 or non-phage-typeable (NT) multidrugresistant strains, and they are represented in the present work by LSP14/92. By the ampli¢cation of the spacer region (SR) between 16S and 23S rRNA genes, the Salmonella [4,5,12:i:3] isolates generated a single amplicon pro¢le (SR1), also generated by the typhimurium ATCC 14028 but not by LSP14/92 DT104 which generated SR2 (Fig. 3). In a previous work carried out in our laboratory, 72 typhimurium strains had been di¡erentiated into three SR pro¢les (SR1^SR3), and it was also seen that SR1 appeared less frequently than SR2 (16.7 and 41.7%, respectively). Most of the multidrug-resistant DT104 and NT strains generated SR2 (unpublished data). By RAPD typing, performed with the primers labelled S and B, the [4,5,12 :i :3] isolates generated single amplicon pro¢les with each primer (Fig. 3) which were identical to the S12 and B3 pro¢les previously found among typhimurium strains [7]. With primer C two amplicon pro¢les were generated, one (17 isolates) identical to C12 and another, labelled C41 (one isolate), di¡erent to those reported within typhimurium [7]. Typhimurium LSP14/92 and ATCC 14028 generated C12 and C11 pro¢les, respectively. It is noticeable that most of the typhimurium DT104 strains were also S12 B3 C12 [7]. By PFGE with XbaI within [4,5,12:i:3] serotype nine pro¢les (labelled X27^X35) could be de¢ned considering the fragments with sizes larger than 30 kb (Fig. 4). In these pro¢les, the upper region, which included eight fragments larger than 220 kb, was identical, and di¡erences were only found in the lower region, which included fragments smaller than 120 kb. Four pro¢les were represented by more than one strain (X32 and X33 by four, X27 by three and X34 by two strains). The [4,5,12 :i:3] pro¢les were di¡erent from the ones (X1 and X18) presented by the two outgroup typhimurium strains which showed di¡erences in both upper and lower regions of the gel. Di¡erences
345
in both regions are also shown in all PFGE pro¢les (X1^ X26) found in a series of typhimurium analysed previously [9]. In this series X1 was the most frequent pro¢le (26.4%) being represented only by DT104 and NT multidrug-resistant strains. Polymorphisms revealed by PFGE appear a useful tool for phylogenetic purposes [9,10,15], and so, in the present study data from PFGE pro¢les were used to trace a similarity dendrogram (Fig. 5). The PFGE patterns generated from the [4,5,12:i:3] organisms presented a D s 0.9 (more than 90% similarity). This ¢nding, together with the high degree of homogeneity in the data obtained from the other typing methods, supports the fact that [4,5,12 :i:3] organisms are closely related and are members of a single clone or lineage into which 13 subtypes or strains fall (Fig. 5). Success in epidemiological surveillance studies of pathogenic bacteria could be related to the typing procedures applied to di¡erentiate or to cluster organisms. In fact, the usefulness of a trait for typing depends on its stability in a given strain and its diversity among the strains forming one species. For this, the typing methods are based on the premise that clonally related organisms share traits that can di¡erentiate them from other unrelated organisms. In this work, the high homology in the traits screened by genetic and phenotypic procedures supports the clustering of [4,5,12 :i:3] isolates into a clonal lineage in which several subtypes or strains fall. This lineage seems to be closely related to some contemporary typhimurium lineages also causing human salmonellosis, and organisms falling
Fig. 4. PFGE patterns generated by XbaI in S. enterica serotypes typhimurium and [4,5,12:i:3]. X: XbaI PFGE patterns generated by (a) typhimurium ATCC 14028, (b) typhimurium LSP14/92 and (c) Salmonella [4,5,12:i:3] organisms. Lanes A: 50-kb DNA ladder. Only bands larger than 30 kb (arrowhead) were considered to de¢ne the PFGE patterns.
FEMSLE 9581 28-8-00
346
B. Guerra et al. / FEMS Microbiology Letters 190 (2000) 341^347
Fig. 5. Single linkage dendrogram showing results of cluster analysis of XbaI PFGE patterns generated by S. enterica serotypes typhimurium and [4,5,12:i:3]. PFGE: XbaI pro¢les. RAPD: pro¢les generated with C, S, and B primers. Ribotyping: SR, amplicon pro¢les of spacer region between 16S and 23S rRNA genes; H, P, and PS, HincII, PvuII and PstI-SphI hybridisation pro¢les of rDNA regions. RP: resistance pro¢les. PP: plasmid pro¢les. Subtypes (number of isolates when s 1) and type strains representing each subtype were: 1 (3), LSP389/97; 11 LSP410/98; 10 LSP390/97; 9 LSP384/97; 3 (3), CNM91C; 4, LSP457/98; 5, CNM41C; 6, LSP132/98; 7, LSP272/98; 8, LSP468/98; 13, LSP461/98; 12, LSP427/98; 2 (2), LSP196/98. D: similarity coe¤cient.
into it show an additional typical feature: multidrug resistance mediated by large non-self-transferable plasmids. Acknowledgements We thank Dr M.A. Usera and A. Echeitia for the [4,5,12:i:3] type strains and serotyping, Dr H-P. Kroll (Bayer AG, PH-R, Wuppertal, Germany) and Dr M. Alvarez (Hospital Xeral de Vigo, Spain) for E. coli W3110 and J53, respectively. We are also indebted to the personnel of the Microbiology Laboratories of the `Hospital Central de Asturias' (Oviedo), `Hospital San Agust|¨n' (Avile¨s), `Hospital Carmen y Severo Ochoa' (Cangas del Narcea), `Hospital de Jarrio' (Coan¬a), `Hospital de Cabuen¬es' and `Hospital de Jove' (Gijo¨n) for their invaluable collaboration with the LSP in registering clinical isolates of Salmonella. This work has been supported by a grant from the `Fondo de Investigacio¨n Sanitaria' (Ref. 00/ 1084). S.M.S. is the recipient of a grant from the `Formacio¨n de Personal Investigador' (Ref. AP98) of the Spanish Ministry of Culture and Education. References [1] Echeitia, M.A., Aladuen¬a, A., Cruchaga, S. and Usera, M.A. (1999) Emergence and spread of an atypical Salmonella enterica subsp. enterica serotype 4,5,12:i:3 strain in Spain. J. Clin. Microbiol. 37, 3425. [2] Usera, M.A., Aladuen¬a, A., D|¨ez, R., de la Fuente, M., Gutie¨rrez, R., Cerda¨n, P. and Echeitia, A. (1999) Ana¨lisis de las cepas de Salmonella spp. aisladas de muestras cl|¨nicas de origen humano en Espan¬a en el an¬o 1998. Bol. Epidemiol. Semanal. 7, 45^56.
[3] Anderson, E.S., Ward, L.R., de Saxe, M.J. and de Sa, J.D.H. (1977) Bacteriophage typing designations of Salmonella typhimurium. J. Hyg. 78, 297^300. [4] Briggs, C.E. and Fratamico, P. (1999) Molecular characterization of an antibiotic resistance gene cluster of Salmonella typhimurium DT104. Antimicrob. Agents Chemother. 43, 846^849. [5] Guerra, B., Landeras, E., Gonza¨lez-Hevia, M.A. and Mendoza, M.C. (1997) A `three-way ribotyping scheme' for Salmonella typhimurium: usefulness for phylogenetic and epidemiological purposes. J. Med. Microbiol. 46, 307^313. [6] Landeras, E. and Mendoza, M.C. (1998) Evaluation of PCR-methods and ribotyping performed with a mixture of PstI and SphI to di¡erentiate strains of Salmonella serotype Enteritidis. J. Med. Microbiol. 47, 427^434. [7] Soto, S.M., Guerra, B., Gonza¨lez-Hevia, M.A. and Mendoza, M.C. (1999) Potential of a three-way randomly ampli¢ed polymorphic DNA analysis as a typing method within twelve Salmonella serotypes. Appl. Environ. Microbiol. 65, 4830^4836. [8] Mendoza, M.C., Guerra, B., Landeras, E. and Mart|¨n, M.C. (1999) Potential of ribotyping performed by double digestion with PstI and SphI as a method to di¡erentiate strains of Salmonella serotypes Enteritidis, Typhimurium and Virchow. In: COST Action 97. Pathogenic Microorganisms in Poultry and Eggs (Sesma et al., Eds.), pp. 45^51. O¤ce for O¤cial Publications of the European Communities, Luxembourg. [9] Guerra, B., Schroers, P. and Mendoza, M.C. (2000) Application of PFGE with XbaI to an epidemiological and phylogenetic study of Salmonella serotype Typhimurium. Relationships between genetic types and phage types. Microbiologica 23, 11^20. [10] Laconcha, I., Baggesen, D.L., Rementeria, A. and Garaizar, J. (2000) Genotypic characterisation by PFGE of S. enterica serotype Enteritidis phage types 1, 4, 6, and 8, isolated from animal and human sources in three European countries. Vet. Microbiol. (in press). [11] Kostman, J.R., Elliot, T.D., LiPuma, J.J. and Stull, T.L. (1992) Molecular epidemiology of Pseudomonas cepacia determined by polymerase chain reaction ribotyping. J. Clin. Microbiol. 30, 2084^2087. [12] Nastasi, A. and Mammina, C. (1995) Epidemiological evaluation by PCR ribotyping of sporadic and outbreak-associated strains of Salmonella enterica serotype Typhimurium. Res. Microbiol. 146, 99^106.
FEMSLE 9581 28-8-00
B. Guerra et al. / FEMS Microbiology Letters 190 (2000) 341^347 [13] Williams, J.G.K., Kubelin, A.R., Livak, K.J., Rafalski, J.A. and Tingey, S.V. (1990) DNA polymorphisms ampli¢ed by arbitrary primers are useful as genetic markers. Nucleic Acids Res. 18, 6531^ 6535. [14] Lin, A.W., Usera, M.A., Barret, T.J. and Goldsby, R.A. (1996) Application of random ampli¢ed polymorphic DNA analysis to di¡erentiate strains of Salmonella enteritidis. J. Clin. Microbiol. 34, 870^ 876. [15] Olsen, J.E., Skov, M.N., Angen, O., Threlfall, E.J. and Bisgaard, M. (1997) Genomic relationships between selected phage types of Salmonella enterica susp. enterica serotype Typhimurium de¢ned by ribotyping, IS200 typing and PFGE. Microbiology 143, 1471^1479. [16] Way, J.S., Josephson, K.L., Pillai, S.D., Abbaszadegan, M., Gerba, C.P. and Pepper, I.L. (1993) Speci¢c detection of Salmonella spp. by multiplex polymerase chain reaction. Appl. Environ. Microbiol. 59, 1473^1479. [17] Prager, R., Fruth, A. and Tscha«pe, H. (1995) Salmonella enterotoxin (stn) gene is prevalent among strains of Salmonella enterica, but not among Salmonella bongori and other Enterobacteriaceae. FEMS Immunol. Med. Microbiol. 12, 47^50. [18] Stone, G.G., Oberts, R.D., Hays, M.H., McVey, S. and Chengappa, M.M. (1995) Combined PCR-oligonucleotide ligation assay for rapid detection of Salmonella serovars. J. Clin. Microbiol. 33, 2888^2893.
347
[19] Chiu, Ch. and Ou, J.T. (1996) Rapid identi¢cation of Salmonella serovars in faeces by speci¢c detection genes, invA and spvC, by an enrichment broth culture-multiplex PCR combination assay. J. Clin. Microbiol. 34, 2619^2622. [20] Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. [21] Mendoza, M.C., Garc|¨a, J.M., Llaneza, J., Me¨ndez, F.J., Hardisson, C. and Ortiz, J.M. (1980) Plasmid-determined resistance to fosfomycin in Serratia marcescens. Antimicrob. Agents Chemother. 18, 215^ 219. [22] Villar, C.J., Mendoza, M.C. and Hardisson, C. (1981) Characterisation of two resistance plasmids from a clinical isolate of Serratia marcescens. Microbiol. Lett. 18, 87^96. [23] National Committee for Clinical Laboratory Standards (1999) Performance standards for antimicrobial disk susceptibility tests. Approved standard M2-A5. National Committee for Clinical Laboratory Standards, Wayne, PA. [24] Guerra, B., Soto, S.M., Cal, S. and Mendoza, M.C. (2000) Antimicrobial resistance and spread of Class 1 integrons among Salmonella serotypes. Antimicrob. Agents Chemother. 44 (in press).
FEMSLE 9581 28-8-00
