Mitochondrial DNA mutation and muscle pathology in mitochondrial myopathy, encephalopathy, lactic acidosis, and strokelike episodes

We sought a relationship between abnormalities of mitochondria1 DNA (mtDNA) and muscle pathology in patients with mitochondrial myopathy, encephalopathy, lactic acidosis, and strokelike episodes (MELAS) at the single fiber level, using histochemistry, in situ hybridization, and single fiber PCR. Most type 1 ragged-red fibers (RRF) showed positive cytochrome c oxidase (COX) activity at the subsarcolemmal region, while type 2 RRF showed little COX activity. However, there was no difference in the amount of total (mutant and wild-type) mtDNAs and the proportion of mutant mtDNA between type 1 RRF and type 2 RRF. These observations suggest that mitochondrial proliferation and nuclear factors affect muscle pathology, including COX activity, in MELAS. Total mtDNAs were greatly increased in RRF. The proportion of mutant mtDNA was significantly higher in RRF than in non-RRF. The amount of both wild-type and mutant mtDNAs was increased in RRF in MELAS, which fact does not support the contention of a replicative advantage of mutant mtDNA. The proportion of mutant mtDNA was significantly higher in the strongly succinate dehydrogenasereactive blood vessels (SSV) than in non-SSV. The similar morphological behavior in these vessels and fibers suggests that increased mutant mtDNA is responsible for mitochondrial proliferation and dysfunction in both tissues. It seems likely that systemic vascular abnormalities involving cerebral vessels lead to the evolution of strokelike episodes in MELAS. 0 1995 John Wiley & Sons, Inc. Key words: MELAS mutant mitochondrial DNA muscle pathology in situ hybridization single-fiber polymerase chain reaction MUSCLE & NERVE Suppl3:S113-S118 1995

MITOCHONDRIAL DNA MUTATION AND MUSCLE PATHOLOGY IN MITOCHONDRIAL MYOPATHY, ENCEPHALOPATHY, LACTIC ACIDOSIS, AND STROKELIKE EPISODES SHUJI MITA, MD, MAKOTO TOKUNAGA, MD, TOSHlHlDE KUMAMOTO, MD, MAKOTO UCHINO, YD, IKUYA NONAKA, MD, and MASAYUKl ANDO, MD

Mitochondria1 encephalomyopathies are classified into three main clinical subgroups: (1) chronic progressive external ophthalmoplegia (CPEO), includFrom the First Department of Internal Medicine, Kumamoto University School of Medicine, Kumamoto, Japan (Drs. Mita, Tokunaga, Kurnarnoto. Uchino, and Ando); Division of Ultrastructural Research, National Institute of Neuroscience, National Center of Neurology and Psychiatry, Tokyo, Japan (Dr. Nonaka). Dr. Kumamoto's present address is Third Department of Internal MediJapan. cine, Oita Medical University, Hasarna-rnachi, Oita 879-55, Acknowledgments: This work was supported in part by a grant (2A-2) for Studies on Nervous and Mental Disorders from the Ministry of Health and Welfare, Japan Address reprint requests to Dr Shuli Mita, First Department of Internal Medicine, Kurnarnoto University School of Medicine, 1-1-1 Honlo Kurnamoto 860,Japan CCC 0148-639X/95/S3SI 13-06 0 1995 John Wiley & Sons, Inc

rntDNA Mutations and M u s c l e Pathology in MELAS

ing Kearns-Sayre ~ y n d r o m e ' ~(2) ; mitochondrial myopathy, encephalopathy, lactic acidosis, and strokelike episodes (MELAS)"; and (3) myoclonus epilepsy associated with ragged-red fibers (MERRF).5 Pathogenic mtDNA mutations have " been ideAtified in each disease: large-scale deletions of mtDNA in CPEO ; transition mutation in the mitochondrial transfer RNA ( t ~ ~ ~ at ) L y sition 8344 (mtDNA numbering according to Anderson and coworkers') in MERRF25; and mutations in tRNALeU(UUR) at positions 3243 and 3271 in MELAS.7'8In each disease, the mutant mtDNAs coexist with wild-type (normal) mtDNA in muscle and other tissues at various proportions in a beteroplasmic fashion. Muscle fibers with an abnormal proliferation of mitochondria can be detected histochemically with

''

MUSCLE & NERVE

S u p p l e m e n t 3 1995

S113

~

modified Gomori trichrome stain as ragged-red fibers (RRF), a hallmark of mitochondrial encephalomyopathies; these are more clearly highlighted when succinate dehydrogenase (SDH) stain is used. Cytochrome c oxidase (COX) deficiency is also a pathologic feature of these mitochondrial encephalomyopathies. However, there are substantial differences in muscle pathology among the three diseases. One is the staining pattern for COX, which probably reflects mitochondrial function. RRF in CPEO and MERRF usually show no while in MELAS RRF are not COX necessarily defective in COX activity but frequently stain strongly positive.6 On the longitudinal section of these muscle fibers, defect of COX activity in CPEO is segmental with a sharply delineated border, while in MELAS and MERRF the border of COX deficiency is blurred and not well delineated.I6 Another difference is the presence of strongly SDH-reactive blood vessels (SSV).l o SSV are frequently seen in MELAS and MERRF, but are very rarely in CPE0.17 Therefore, it is very important to define the relationship between mtDNA abnormalities and muscle pathology, in order to elucidate pathoge-

netic mechanisms in these mitochondrial diseases. Recent studies on patients with CPEO have revealed that deleted mtDNAs are markedly increased in RRF and are transcriptionally active.9.18,19.27 The purpose of this article is to provide information on muscle pathology in MELAS, focusing on this issue using our data.28.29 HISTOCHEMISTRY

We investigated skeletal muscle biopsy specimens from 3 patients with 3243 MELAS mutation and 1 with 3271 MELAS mutation. No clinical differences were found between the two mutations, as described p r e v i ~ u s l y .Stainin ~~ was done for SDH, COX, and myosin ATPase! Muscle biopsies from patients with MELAS showed that most RRF were COX positive. To determine whether there is any difference in RRF and COX deficient fibers among fiber types, 500 adjacent muscle fibers were classified into type 1 or 2 fibers. RRF were more predominant in type 1 than in type 2 fibers. Most type 1 RRF had strong COX activity at the subsarcolemmal region of the fibers, while type 2 RRF had faint COX activity (Fig. 1).

FIGURE 1. Histochemistry and in situ hybridization (ISH) of muscle cross-sections of MELAS patients. Serial muscle sections of 8-p,m-thick SDH (a), COX (b), myosin ATPase pH 10.7 (c), and ISH to detect total mtDNAs (d) in a MELAS patient are shown. RRF (1, 2) had strong activity for SDH, and non-RRF (3, 4) had weak activity. Type 1 fibers (1, 3) remained white, while type 2 fibers (2, 4) stained black with myosin ATPase. (a)-(d) x64.

S114

mtDNA Mutations and Muscle Pathology in MELAS

MUSCLE 8, NERVE

Supplement 3 1995

mtDNA DETECTION BY IN SlTU HYBRIDIZATION

We used in situ hybridization procedure with mtDNA probe to detect mtDNA on each muscle fiber. The probe hybridized with total (mutant and wild-type) mtDNAs in MELAS. Muscle fibers with strong SDH activity (i.e., RRF) had an intense hybridization signal for total mtDNAs (Fig. 1). The SDH staining pattern appeared to parallel the intensity of the hybridization signal in MELAS. RRF had a significantly higher hybridization signal for total mtDNAs than did non-RRF. T o estimate quantitatively the relative number of total mrDNAs in each muscle fiber, we counted silver grains in the photographs. The average number of silver grains in RRF, as compared with non-RRF, was 5.3 times in type 1 fibers and 16.9 times in type 2 fibers. However, there was no definite difference in the number and distribution of hybridization signals between type 1 RRF and type 2 RRF.

'*

primer A (5'-AGGACAAGAGAAATAAGGCC; nt 3130-3149) and unlabeled primer B (5'CACGTTGGGGCCTTTGCGTA; nt 3423-3404). The 294-base-pair (bp) DNA fragment, digested with restriction enzyme Cfr 131, was electrophoresed through 5% nondenaturing polyacrylamide gel. I n addition to one Cf7 131 site in the region, the A to G mutation at position 3243 creates an additional Cfr 131 site which is diagnostic for the MELAS (3243) mutation (see Fig. 2). The labeled fragment generated by wild-type mtDNA was 283 bp (IZa3),and that from mutant mtDNA was 113 bp (Ill3). T h e proportion of mutant mtDNA was shown as 1113/(1113+ The proportion of mutant mtDNA was significantly higher in RRF than in non-RRF. There was no significant difference in the proportion of mutant mtDNA between type 1 and type 2 fibers, both in RRF and in non-RRF (Fig. 3A). ANALYSIS OF INTRAMUSCULAR ARTERIES

PROPORTION OF MUTANT mtDNA BY SINGLE-FIBER PCR

T o estimate the proportion of mutant and wildtype mtDNAs precisely, we employed single fiber PCR. After SDH staining, single fibers from 20pm-thick sections were isolated under a dissecting microscope using a sharp needle. Each fiber was placed directly into 10 pL of distilled water in a 250-pL Eppendorf tube, and PCR amplification was performed with [Y-~'P]ATPend-labeled

32p

4

3 3

294 U

1 2

3 4 5

6 7 +283

Digestion by Cfr 131

2

2

Histochemically, some blood vessels in the muscle of MELAS patients reacted strongly for SDH (i.e., SSV), while others did not stain (non-SSV). The intensity of the hybridization signal for total mtDNAs was much higher in SSV than in nonSSV. Intramuscular blood vessels isolated from the muscle sections were subjected to the same procedure as the single fiber PCR described above. The proportion of mutant mtDNA was significantly higher in SSV than in non-SSV (Fig. 3B).

p283 Normal ~ v113 Mutant

P

3243

--- U

Normal Mutant sing1e

fiber

294 283 113 bP

t113

FIGURE 2. Single-fiber PCR of MELAS patients. Scheme of single fiber PCR (left) and representative data (right) are shown. Complete digestion by restriction enzyme was confirmed by absence of the 294-bp undigested fragment (U). 1: undigested PCR product; 2: SSV; 3: non-SSV; 4-5: RRF; 6-7: non-RRF.

mtDNA Mutations and Muscle Pathology in MELAS

MUSCLE & NERVE

Supplement 3 1995

S115

determined by neuron innervation, the different behavior of COX activity in these fibers may also imply that nuclear factors affect muscle pathology, including COX activity and susceptibility of RRF formation in MELAS.

A

100

mtDNA HETEROPLASMY AND MITOCHONDRIAL FUNCTION

60

50

Total mtDNAs were much increased in RRF (about 5-17 times the signal as in non-RRF), whereas the proportion of wild-type mtDNA in RRF was approximately one third *that of nonRRF. Thus, the amount of wild-type mtDNA seems to be more increased in RRF than in nonRRF in MELAS. Chomyn and coworkers* found that wild-type mtDNA had a striking protective effect against the phenotypic manifestation of the MELAS mutation, with a sharp transition around an average wild-type mtDNA proportion of 6%, and with full protection by 10% wild-type mtDNA, as determined using cybrid cell clones. King and coworkers reported that even mutant mtDNA was reduced, but showed some COX activity in MELAS.15 However, our observation that type 2 RRF had more wild-type mtDNA but less COX activity, as compared to type 2 non-RRF, suggests that increased mutant mtDNA may interfere with mitochondrial functions, including COX activity. One possible explanation for this is the “ribosome stalling” model for the pathogenesis of MELAS, proposed by Schon and coworkers,26 in which a novel unprocessed 16s rRNA with tRNALe”‘UUR) plus ND1 gene derived from mutant mtDNA becomes rate limiting for translation. The proportion of mutant to wild-type mtDNA may be crucial for phenotypic expression and for the probable threshold effect, and the protective effect of wildtype mtDNA and the “ribosome stalling” effect of the mutant genome may sharpen the transition.

’ I

40

10 O

1

2

3

4

FIGURE 3. Proportion of mutant mtDNA in single muscle fibers (A) and intramuscular arteries (B). Dots denote the proportion of mutant mtDNA in each fiber or intramuscular artery from 3 MELAS patients. The average proportion of mutant mtDNA in the 3 patients was 88.1 2 5.5% in RRF, 63.2 f 21.6% in non-RRF, 83.2 f 4.2% in SSV, and 38.8 2 16.2% in non-SSV. There was a significant difference between RRF and non-RRF and between SSV and non-SSV in the 3 patients ( P < 0.005). Bar indicates mean r standard deviation. (A) 1 : type 1 RRF; 2: type 2 RRF; 3: type 1 non-RRF; 4: type 2 non-RRF. (B) 1 : SSV; 2: non-SSV.

FIBER TYPE DIFFERENCE IN COX ACTIVITY OF RRF

We obtained evidence that total mtDNAs were greatly increased in RRF and that the proportion of mutant mtDNA was higher in RRF than in nonRRF, indicating that mutant mtDNA was much more abundant in RRF. These findings are basically consistent with those of Moraes and coworkers.*’ Furthermore, we examined the mtDNA abnormality (the ratio of mutant and wild-type mtDNAs) in type 1 and 2 fibers, using COX as a marker of respiratory chain function. The finding that type 1 RRF had positive COX activity at the subsarcolemmal region, an area where compensatory mitochondrial proliferation was prominent and total mtDNAs were much increased, may imply that proliferated mitochondria are partly functional for COX activity in type 1 RRF and that the increase of mtDNAs is an important determinant of COX activity. Although type 2 RRF showed little COX activity, compared to type 1 RRF, there was no significant difference in either the hybridization signal for total mtDNAs or the proportion of mutant mtDNA between type 1 and type 2 RRF. Some type 2 RRF without COX activity had even more total mtDNAs than type 1 RRF with COX activity. Since fiber-type differentiation is basically

S116

rntDNA Mutations and Muscle Pathology in MELAS

MUTANT mtDNA IN REPLICATION

Our finding of more wild-type mtDNA in RRF than in non-RRF in MELAS muscle differs from previous reports on CPEO, in which the amount of wild-type mtDNA was lower in RRF than in nonRRF.9,’8*19 One possible explanation for this result is that deleted mtDNA has a marked replicative advantage over wild-type mtDNA in CPE0,30 while mutant mtDNA in MELAS may not have such a marked advantage. T h e proportion of mutant mtDNA is not always increased in all offsprin in cases of maternal inheritance of MELAS. Kawakami and coworker^'^ reported

F

that a female patient with mitochondrial myopa-

MUSCLE & NERVE

Supplement 3 1995

thy, who had 3243 MELAS mutation, clinically improved with age gradually, decreasing the proportion of mutant mtDNA and the number of RRF, as evidenced by comparison of two muscle biopsies obtained at an interval of 12.5 years. However, Yoneda and coworkers reported that mutant mtDNA has a marked replicative advantage over wild-type mtDNA in MELAS, as determined using cybrid cell clones.” This difference may be due to the different materials (single muscle fiber vs. cultured cybrid cells). DISTRIBUTION OF MUTANT mtDNA IN MUSCLE

In MELAS, the proportion of mutant mtDNA in non-RRF varied from fiber to fiber and was not necessarily lower than that in RRF, but overlapped on occasion. On the other hand, the proportion of deleted mtDNA in CPEO is higher in RRF but very little or nearly zero in COX-positive non-RRF. This difference suggests that mutant mtDNA in MELAS is diffusely distributed through muscle fiber, resulting in a COX activity defect, with a blurred and not well delineated border, while deleted mtDNA in CPEO tends to accumulate focally, occupying entire segments of fibers and resulting in a COX activity defect with sharply delineated border. BLOOD VESSEL INVOLVEMENT IN MELAS

Strokelike episodes secondary to vascular involvement are characteristic of MELAS. In MELAS, an increase in the number of mitochondria with occasional structural abnormalities is most prominent in pial arterioles and small arteries up to 250 pm in diameter.*l Abnormal proliferation of the mitochondria has been seen in smooth muscle cells not only in the brain but also in intramuscular small arteries,7723also demonstrated by the SDH stain, which labels SSV. l o Electron-microscopic examination confirmed SSV to be arteries containing markedly increased numbers of mitochondria in the smooth muscle cells.” The findings in MELAS that SSV have positive COX activity,’ and that total mtDNAs are greatly increased in SSV, are consistent with findings in RRF in MELAS. There is no apparent relationship between the SSV number and incidence of RRF. There is even a case without RRF, but with SSV alone in muscle biopsy specimens in MELAS, which may imply that SSV are the major pathologic change related to strokelike episodes8 Accordingly, the identification of SSV is a supportive and critical finding in diagnosing this disorder, and we suggest that increased mutant mtDNA in cerebral blood vessels may play an im-

mtDNA Mutations and Muscle Pathology in MELAS

portant role in the evolution of strokelike episodes in MELAS. REFERENCES

1 . Andersen S, Bankier AT, Barrel1 BG, de Bruijin MHL, Coulson AR, Drouin J, Eperon IC, Nierlich DP, Roe BA, Sanger F, Schreier PH, Smith AJH, Staden R, Young IG: Sequence and organization of the human mitochondrial genome. Nature 1981;290:457465. 2. Chomyn A, Martinuzzi A, Yoneda M, Daga A, Hurko 0, Johns D, Lai ST, Nonaka I, Angelini C, Attardi G: MELAS mutation in mtDNA binding site for transcription termination factor causes defects in protein synthesis and in respiration but no change in levels of upstream and downstream mature transcripts. Proc Natl Acad Sci U S A 1992;89: 42214225. Ciafaloni E, Ricci E, Shanske S, Moraes CT, Silvestri G, Hirano M, Simonetti, Angelini C, Donati MA, Garcia C, Martinuzzi A, Mosewich, R, Servidei S, Zammarchi E, Bonilla E, DeVivo DC, Rowland LP, Schon EA, DiMauro S: MELAS: clinical features, biochemistry, and molecular genetics. Ann Neurol 1992;31:391-398. Dubowitz V: Histological and histochemical stains and reactions, in Dubowitz V (ed): Muscle Biopsy: A Practical Approach (2nd ed). London, Balliere-Tindall, 1985, pp 1 9 4 0 . Fukuhara N, Tokiguchi S, Shirakawa K, Tsubaki T : Myoclonus epilepsy associated with ragged-red fibers (mitochondrial abnormalities): disease entity or a syndrome?J Neurol Sci 1980;47:117-133. Goto Y, Horai S, Matsuoka T, Koga Y, Nihei, K, Kobayashi M, Nonaka I: Mitochondria1 myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS): a correlative study of the clinical features and mitochondrial DNA mutation. Neurolom 1992;42:545-550. 7. Goto Y, Nonaka I,-Horai S: A mutation in the tRNAL“”(UUR’ gene associated with the MELAS subgroup of mitochondrial encephalomyopathies. Nature 1990;348:65 1-653. 8. Goto Y, Nonaka I, Horai S: A new mtDNA mutation associated with mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS). Biochzm Biaphys Acta 1991; 1097~238-240. 9. Hammans SR, Sweeney MG, Wicks DAG, Morgan-Hughes JA, Harding AE: A molecular genetic study of focal histochemical defects in mitochondrial encephalomyopathies. Brain 1992;115:343-365. 10. Hasegawa H , Matsuoka T , Goto Y, Nonaka I: Strongly succinate dehydrogenase-reactive blood vessels in muscles from patients with mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes. Ann Neurol 199 1 ;29:601 4 0 5 . 1 1 . Holt IJ, Harding AE, Morgan-Hughes JA: Deletions of muscle mitochondrial DNA in patients with mitochondrial myopathies. Nature 1988;33 1 :717-7 19. 12. Johnson MA, Turnbull DM, Dick DJ, Scherratt HSA: A partial deficiency of cytochrome c oxidase in chronic progressive external ophthalmoplegia. J Neural Sci 1983;60: 31-53. 13. Kawakami Y, Sakuta R, Hashimoto K, Fujino 0, Fujita T, Hida M, Horai S, Goto Y, Nonaka I: Mitochondria1 myopathy with progressive decrease in mitochondrial tRNA mutant genome. Ann Neurol 1994;35:370-373. 14. Kearns TP, Sayre GP: Retinitis pigmentosa, external ophthalmoplegia and complete heart block. Arch Ophthalmol 1958;60:280-289. 15. King MP, Koga Y, Davidson M, Schon EA: Defects in mitochondrial protein synthesis and respiratory chain activity segregate with the tRNALeU(UUR) mutation associated with mitochondrial myopathy, encephalopathy, lactic acidosis, and strokelike episodes. Mol Cell Biol 1992;12:480-490.

MUSCLE & NERVE

Supplement 3 1995

S117

16. Matsuoka T, Goto Y, Yoneda M, Nonaka I: Muscle histopathology in myoclonus epilepsy with ragged-red fibers (MERRF).J Neurol Scz 1991;106:193-1 98. 17. Matsuoka T,Hasegawa H, Nonaka I: Strongly succinate dehydrogenase-reactive blood vessels (SSV) in various neuromuscular diseases. Clin Neurol 1992;32:645-647. 18. Mita S, Schmidt B, Schon EA, DiMauro S, Bonilla E: Detection of “deleted” mitochondrial genomes in cytochrome-c oxidase-deficient muscle fibers of a patient with Kearns-Sayre syndrome. Proc Nutl Acad Scz USA 1989;86: 9509-9513. 19. Moraes CT, Ricci E, Bonilla E, DiMauro S, Schon EA: The mitochondrial tRNALe”(UUR) mutation in mitochondrial encephalomyopathy, lactic acidosis, and strokelike episodes (MELAS): genetic, biochemical, and morphological correlations in skeletal muscle. A m J Hum Genet 1992;50:934-949. 20. Moraes CT, Ricci E, Petruzzella V, Shanske S, DiMauro S, Schon EA, Bonilla E: Molecular analysis of the muscle pathology associated with mitochondrial DNA deletions. Nuture Genet 1992;1:359-367. 21. Ohama E, Ohara S, Ikuta F, Tanaka K, Nishizawa M, Miyatake T: Mitochondrial angiopathy in cerebral blood vessels of mitochondrial encephalomyopathy. Acta Neuropathol 1987;74:226-233. 22. Pavlakis SG, Phillips PC, DiMauro S, DeVivo DC, Rowland LP: Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes. Ann Neurol 1984;16:481-488. 23. Sakuta R, Nonaka I: Vascular involvement in mitochondrial myopathy. Ann Neurol 1989;25:594-601. 24. Sakuta R, Goto Y, Horai S, Nonaka I: Mitochondrial DNA mutations at nucleotide positions 3243 and 3271 in mito-

S118

mtDNA Mutations and Muscle Pathology in MELAS

chondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes: a comparative study. J Neurol Scz 1993; ii5:158-160. 25. Schoffner JM, Lott MT, Lezza AMS, Seibel P, Ballinger SW, Wallace DC: Myoclonic epilepsy and ragged-red fiber disease (MERRF) is associated with a mitochondrial DNA tRNALy”mutation. Cell 1990;61:931-937. 26. Schon EA, Koga Y, Davidson M, Moraes CT, King MP: The mitochondrial tRNALeU(UUR) mutation in MELAS: a model for pathogenesis. Bzochzm Bzophys Acta 1992;llOl: 206-209. 27. Shoubridge EA, Karpati G, Hastings KEM: Deletion mutants are functionally dominant over wild-type mitochondrial genomes in skeletal muscle fiber segments in mitochondrial disease. Cell 1990;62:4349. 28. Tokunaga M, Mita S, Murakami T , Kumamoto T , Uchino M, Nonaka I, Ando M: Single muscle fiber analysis of mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS). A n n Neurol 1994;35: 413419. 29. Tokunaga M, Mita S, Sakuta R, Nonaka I, Araki S: Increased mitochondrial DNA in blood vessels and raggedred fibers in mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS).Ann Neurol 1993;33:275-280. 30. Wallace DC: Mitochondrial DNA mutation and neuromuscular disease. Trends Genet 1989;5:9-13. 31. Yoneda M, Chomyn A, Martinuzzi A, Hurko 0,Attardi G: Marked replicative advantage of human mtDNA carrying a point mutation that causes the MELAS encephalomyopathy. Proc Nutl Acud Scz USA 1992;89:11,164-11,168.

MUSCLE & NERVE

Supplement 3 1995