Journal of Invertebrate Pathology 90 (2005) 59–63 www.elsevier.com/locate/yjipa
Short communication
Manganese superoxide dismutase from Biomphalaria glabrata Younghun Jung 1, Thomas S. Nowak, Si-Ming Zhang, Lynn A. Hertel 9, Eric S. Loker ¤, Coen M. Adema Department of Biology, University of New Mexico, Albuquerque, NM 87131, USA Received 18 February 2005; accepted 13 June 2005 Available online 2 August 2005
Abstract The investigation of the response of Biomphalaria glabrata snails to Echinostoma paraensei (digenea) at 2 days post-exposure by suppression subtractive hybridization yielded a partial sequence of the anti-oxidant enzyme manganese superoxide dismutase (MnSOD). Full-length MnSOD (669 nt) from M line and BS-90 strains of B. glabrata diVered by one synonymous nucleotide replacement. B. glabrata has 1–4 MnSOD loci (Southern hybridization). Both snail strains expressed MnSOD at equal baseline levels (quantitative PCR). Susceptible snails increased expression of MnSOD following infection with E. paraensei or Schistosoma mansoni, and expression was reduced in the incompatible combination (BS-90 B. glabrata and S. mansoni). Thus, MnSOD did not determine resistance or susceptibility for these parasites, but expression of MnSOD is consistent with its involvement in a stress response of B. glabrata. 2005 Elsevier Inc. All rights reserved. Keywords: Host–parasite immunobiology; Subtraction suppressive hybridization; Schistosoma mansoni; Echinostoma paraensei
Digenean parasites are common pathogens for gastropod molluscs (Adema and Loker, 1997). Infection may reduce the Wtness of snails by aVecting their internal (neuro-) physiology, possibly leading to parasitic castration (Sorensen and Minchella, 2001). Additionally, snails can transmit these parasites to vertebrates, causing extensive veterinary and medical problems (Lockyer et al., 2004). The suitability of snails as hosts for digeneans is determined genetically (Lewis et al., 2001). The underlying genetics remain to be characterized. Toward gaining insight into the immunology, physiology, and pathology of snail-digenean interactions, a gene discovery project was undertaken to document genes that were expressed by the snail Biomphalaria glabrata in response to the digenean para*
Corresponding author. Fax: +1 505 277 0304. E-mail address:
[email protected] (E.S. Loker). 1 Present address: Periodontics/Prevention/Geriatrics, University of Michigan School of Dentistry, Ann Arbor, MI 48109, USA. 9 Deceased 2 April 2005. 0022-2011/$ - see front matter 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.jip.2005.06.014
site Echinostoma paraensei. Suppression subtractive hybridization (SSH; Diatchenko et al., 1996) was used to enrich for expressed sequence tags (ESTs) of gene transcripts that were diVerentially expressed by snails in response to parasite infection. One sequence encoding for manganese superoxide dismutase (MnSOD) was encountered and characterized further. M line strain B. glabrata (6–8 mm shell diameter) were individually exposed to 20 miracidia of E. paraensei (Loker and Hertel, 1987). At 2 days post-exposure (dpe), infection was conWrmed by microscopic observation of sporocysts in the heart of snails. For other experiments, M line snails (susceptible for E. paraensei and Schistosoma mansoni) and snails of the BS-90 strain (susceptible for E. paraensei, but resistant to S. mansoni; Nowak et al., 2004) were similarly exposed to E. paraensei or to S. mansoni (Stibbs et al., 1979). M line snails infected with E. paraensei or uninfected (n D 10 for both groups) were processed to prepare SSH-ESTs (see Nowak et al., 2004). BrieXy, shells were removed and RNA was extracted from head–foot tissues (Trizol; MRC). At 2 dpe, parasites have
60
Y. Jung et al. / Journal of Invertebrate Pathology 90 (2005) 59–63
remained small and contribute minimally to RNA samples from infected snails. Residual DNA was removed (RQ-1 DNAse, Promega) and mRNA was puriWed (Micro fasttrack, Invitrogen). The PCR-select method (BD-Clontech) was used to enrich for parasite-responsive mRNA sequences from infected snails by subtraction of sequences that were shared with the control snails. Resulting cDNAs were cloned, screened against 16S rRNA-derived contaminants, and sequenced (see Nowak et al., 2004) The SSHESTs were compared to GenBank databases (BLAST, Altschul et al., 1997). On the basis of SSH results (see below), the upstream and downstream cDNA termini of an MnSOD gene were PCR ampliWed from a pre-existing cDNA library (Adema et al., 1997) and sequenced. Primers were designed from the M line data to amplify the complete MnSOD cDNA sequence from BS-90 B. glabrata by reverse transcription PCR (RT-PCR; Omniscript, Qiagen; TaqGold, ABI). DNA was extracted (CTABbased method; Winnepenninckx et al., 1993) from individual M line B. glabrata and digested with HindIII, PstI, HaeIII, or PvuIII. Southern hybridization was performed by probing with the 32P-labelled SSH-EST sequence for MnSOD (Southern-max, Strip-EZ, Ambion; Zhang and Loker, 2004). The expression levels of MnSOD in both M line and BS-90 snails were determined before and following exposure to parasites by qPCR (random hexamer primers, ABI; Omniscript reverse transcriptase, Invitrogen; SYBR Green PCR core reagents kit; PRISM 7000 sequence detection system, ABI). The primer design (Primer Express 2.0, ABI) for MnSOD yielded:(5⬘–3⬘) BgSODQs: GCCGCTGTAGATAAGGGTGA and BgSODQa: GGACCTTGCCTGTAGCTGGA. Two pools each of M line and BS-90 (n D 3) were tested in duplicate, representing untreated controls and snails exposed to S. mansoni or E. paraensei at 12 h post-exposure and 1, 2 dpe. Baseline expression was calculated with the 2¡cT method, 2¡(cT) was used to determine fold increase relative to 18S (Hertel et al., 2005). For statistical analysis, second or third order curves were Wtted to averaged values (norms of residuals for the
Wttings 61.69 £ 10¡14) using the polyWt function of Matlab software (Mathwork Inc), and data were resampled at 6 h intervals. The MnSOD expression curves of the snail strains in response to parasites were compared against baseline expression (value D 1) using Kurskal– Wallis one-way ANOVA on ranks with Student –Newman–Keuls method testing for multiple comparisons (Sigmastat, Jandel). Analysis of a set of 60 SSH-ESTs yielded 50 unique sequences (Table 1). Twenty-Wve novel sequences had no similarities with known sequences. Among other SSHESTs that represented potential immune- or stress response factors (FREP2, FREP4, endo-1,4- glucanase, carboxypeptidase, and serine protease) was a 258 nt sequence with similarity to MnSOD. Characterization of cDNA ends yielded a contig of 879 nt (Fig. 1A; GenBank Accession No. AY500813) that included a 672 nt open reading frame (ORF), encoding a polypeptide of 223 amino acids (24.9 kDa predicted molecular weight). The complete ORF showed further similarities with known MnSOD sequences. The inferred MnSOD protein lacks a predicted signal peptide (SignalP, Nielsen et al., 1997) and is likely to remain intracellular (Nielsen and Krogh, 1998). The full-length MnSOD-encoding cDNA recovered from uninfected BS-90 B. glabrata was identical to that from M line snails, except for a single synonymous nucleotide replacement (GenBank Accession No. AY500814; see Fig. 1A). No amplicons were observed when these MnSOD-speciWc primers were used in eVorts to recover MnSOD sequences by PCR from genomic snail DNA (see below for interpretation). Southern hybridization with the MnSOD SSH-EST revealed between 1 and 4 probe-reactive bands in genome of B. glabrata (Fig. 1B). qPCR disclosed that uninfected snails of M line (susceptible for E. paraensei and S. mansoni) and BS-90 (susceptible for E. paraensei, resistant to S. mansoni) strains expressed MnSOD at similar baseline levels (Fig. 1C). Concordant with recovery as SSH-EST, MnSOD was expressed at increased levels in M line snails following
Table 1 Sequence similarities of SSH-EST sequences recovered from M line Biomphalaria glabrata infected with Echinostoma paraensei (2 dpe) GenBank Accession No.
Sequence similarity
Clones recovered
Remarks
CV878465 CV878466-8 CV878469 CV878470 CV878471 CV878472-3 CV878474 CV878475 CV878476-85 CV878486-510 CV878511 CV878512-14 Total
MnSOD (3) BgMFREP2 (3⬘ UTR of) BgMFREP4 Adenosylhomocysteine Carboxypeptidase (2) endo-1–4--Glucanase Serine protease Molluscan insulin-related peptide (10) Ribosomal proteins (25) Novel sequences Reverse transcriptase (3) Mitochondrial proteins 50 Unique
6 3 3 1 1 2 1 1 10 28 1 3 60
Identical 3 variant sequences 3 identical sequences
2 diVerent sequences
L7a, L8, L13, L35, L39, S5, S13, S15, S23, 60S acidic protein P1 3 (partial) replicate sequences recovered COI, COII, COIII
Y. Jung et al. / Journal of Invertebrate Pathology 90 (2005) 59–63
61
Fig. 1. (A) Sequence of MnSOD from Biomphalaria glabrata, at nucleotide and inferred amino acid levels. The UTR sequences are shown in lower case. The sequence shown is from M line snails, the BS-90 sequence lacks the terminal nucleotides shown in bold italics. The original SSH-EST sequence is underlined, start and stop codons are underlined double. The boxed codon shows the synonymous nucleotide diVerence between the sequences from M line (GCC) and BS-90 (GCA). (B) Southern hybridization of genomic DNA of one M line snail, restriction digested with (1) HindIII, (2) PstI, (3) HaeIII, and (4) PvuIII. The number of probe-reactive bands indicates between 1 and 4 loci for MnSOD in the genome of B. glabrata. (MW indicated in kD) (C) Expression levels of MnSOD, measured by qPCR relative to 18S, were not signiWcantly diVerent (Kruskal– Wallis one-way ANOVA on ranks, P D 0.33) for control M line and BS-90 B. glabrata (n D 2, mean and range shown). (D) Expression levels of MnSOD (determined by qPCR) for M line and BS-90 B. glabrata at 12 h, 1d, and 2d post-exposure to E. paraensei (Ep) or Schistosoma mansoni (Sm). The MnSOD responses of M line increased signiWcantly following infection with Ep and Sm (P D 0.003 each). Despite heightened MnSOD expression at 2 dpe, the response of BS-90 to Ep as a whole was not signiWcantly increased (P D 0.67). The MnSOD expression of BS-90 was signiWcantly reduced following infection with Sm (P D 0.003). The results are depicted as mean and range of values (n D 2 for each time point).
infection with E. paraensei. Expression of MnSOD was also elevated in other compatible combinations where parasites successfully established infection in the snail. In BS-90 snails however, the increased MnSOD level at 2 dpe was detected only after an initial decrease following exposure to E. paraensei. For this particular combination, the MnSOD expression over time as a whole did not change signiWcantly. In the only incompatible combination, where BS-90 snails prevent infection by immune elimination of S. mansoni, the expression of MnSOD was reduced following exposure (Fig. 1D).
Gene discovery based on SSH-ESTs yielded sequences that are potentially involved in the interaction between M line B. glabrata and the parasite E. paraensei. Some of the sequences recovered here (FREPs, endoglucanase, and reverse transcriptase) are emerging as common features associated with anti-digenean responses of B. glabrata (see Hertel et al., 2005; Mitta et al., 2005; Nowak et al., 2004; Raghavan et al., 2003). Further functional characterization of such sequences and ongoing genomics studies of B. glabrata (see http:// biology.unm.edu/biomphalaria-genome/index.html) will
62
Y. Jung et al. / Journal of Invertebrate Pathology 90 (2005) 59–63
beneWt a more comprehensive understanding of antipathogen responses in the near future. Here, an MnSOD-encoding sequence (with elevated expression conWrmed by qPCR), was analyzed further. The anti-oxidant enzyme MnSOD is a major component of cellular defense mechanisms against oxidative stress (Kops et al., 2002). MnSOD is inducible by oxidative stress and the expression may vary with various challenges including infection, nutritional status (Berger et al., 2004), and environmental pollution (Geret et al., 2003). Also SOD activity may have relevance for immune defense as described below. The recovery of full-length sequence also from uninfected snails (BS-90 strain) conWrmed that the MnSOD sequence originated from B. glabarata and not from the parasite E. paraensei. It should be noted that the actual number of loci for MnSOD in B. glabrata may be toward the lower end of the estimated range (1–4 loci). Likely, the inability to generate MnSOD-speciWc PCR amplicons from genomic DNA (using primers that functioned in RT-PCR) is due to the presence of (long) intronic sequences in the MnSOD gene. Possibly, the contribution of additional restriction sites within the gene by such introns leads to greater numbers of restriction fragments than predicted from the coding sequence alone. This yields an overestimation by Southern analysis of the number of loci for MnSOD. DiVerential levels of superoxide dismutase activity in B. glabrata have been hypothesized to co-determine resistance or susceptibility for S. mansoni parasites (Bayne et al., 2001). Superoxide dismutase activity converts superoxide, the Wrst cytotoxic ROI generated during the respiratory burst response from snail defense cells against pathogens, to hydrogen peroxide which is highly toxic for S. mansoni (Hahn et al., 2001). Disruption or lowered expression of superoxide dismutase in a susceptible snail may prevent hydrogen peroxide from accumulating to levels that are suYcient to kill parasites (Bayne et al., 2001; Goodall et al., 2004). It seems more likely that structurally distinct, extracellular and/or cytoplasmic Cu/Zn superoxide dismutases (Zelko et al., 2002) function in this cytotoxic process, instead of MnSOD that is encoded by the nuclear genome and transported to mitochondria where it confers protection from oxidative damage (Murakami et al., 1998). This assumption was supported by the expression patterns of MnSOD in response to digenean parasites. In combination, the similar baseline expression in both snail strains, the elevated expression in response to successful digenean infection, and lowered expression in case of resistance (BS-90/S. mansoni), (Figs. 1C and D) did not indicate a functional correlation of MnSOD with resistance or susceptibility of B. glabrata for these parasites. Rather, the elevated MnSOD expression (in mitochondria) likely reXects a response to increased oxidative metabolism following successful parasite infection. The
delayed increase in MnSOD expression from BS-90 snails infected with echinostomes (at 2 dpe) may be due to a slower rate of parasite development as compared to M line B. glabrata. Alternatively, the orchestration of a gene expression proWle that represents a defensive eVort (even if it is ultimately unsuccessful) may reduce the expression level of constitutively expressed genes such as MnSOD, as observed in BS-90 B. glabrata infected with S. mansoni, and with E. paraensei at 12 h and 1 dpe. In conclusion, MnSOD is a general stress response factor that can be monitored to determine metabolic stress resulting from, e.g., environmental problems (Choi et al., 1999, 2000; Geret et al., 2003), and as shown here, from digenean infection in B. glabrata.
Acknowledgments This work was supported in part by the NIH Grants AI24340 (E.S.L.) and AI052363 (C.M.A.). Younghun Young received support from the Inha University, Korea. Shibin Qui, Computer Science, University of New Mexico, provided assistance with the data analysis. Technical support was provided by the University of New Mexico’s Molecular Biology Facility which is supported by NIH Grant No. 1P20RR18754 from the Institute Development Award (IDeA) Program of the National Center for Research Resources.
References Adema, C.M., Hertel, L.A., Miller, R.D., Loker, E.S., 1997. A family of Wbrinogen-related proteins that precipitates parasite-derived molecules is produced by an invertebrate after infection. Proc. Natl. Acad. Sci. USA 94, 8691–8996. Adema, C.M., Loker, E.S., 1997. SpeciWcity and immunobiology of larval digenean-snail associations. In: Fried, B., Graczyk, T.C. (Eds.), Advances in Trematode Biology. CRC Press, Boca Raton, Florida, pp. 230–263. Altschul, S.F., Madden, T.L., SchäVer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389–3402. Bayne, C.J., Hahn, U.K., Bender, R.C., 2001. Mechanisms of molluscan host resistance and of parasite strategies for survival. Parasitology 123, S159–S167. Berger, M.M., Jia, X.Y., Legay, V., Aymard, M., Tilles, J.G., Lina, B., 2004. Nutrition- and virus-induced stress represses the expression of manganese superoxide dismutase in vitro. Exp. Biol. Med. 229, 843–849. Choi, J.H., Roche, H., Caquet, T., 1999. Characterization of superoxide dismutase activity in Chironomus riparius Mg. (Diptera, Chironomidae) larvae—a potential biomarker. Comp. Biochem. Physiol. C Comp. Pharmacol. Toxicol. 124, 73–81. Choi, J.H., Roche, H., Caquet, T., 2000. EVects of physical (Hypoxia, Hyperoxia) and chemical (potassium dichromate, fenitrothion) stress on antioxidant enzyme activities in Chironomus riparius Mg. (Diptera, Chironomidae) larvae: Potential biomarkers. Environ. Toxicol. Chem. 19, 495–500. Diatchenko, L., Lau, Y.F., Campbell, A.P., Chenchik, A., Moqadam, F., Huang, B., Lukyanov, S., Lukyanov, K., Gurskaya, N., Sverdlov,
Y. Jung et al. / Journal of Invertebrate Pathology 90 (2005) 59–63 E.D., Siebert, P.D., 1996. Suppression subtractive hybridization: a method for generating diVerentially regulated or tissue-speciWc cDNA probes and libraries. Proc. Natl. Acad. Sci. USA 93, 6025–6030. Geret, F., SeraWm, A., Bebianno, M.J., 2003. Antioxidant enzyme activities, metallothioneins and lipid peroxidation as biomarkers in Ruditapes decussatus? Ecotoxicology 12, 417–426. Goodall, C.P., Bender, R.C., Broderick, E.J., Bayne, C.J., 2004. Constitutive diVerences in Cu/Zn superoxide dismutase mRNA levels and activity in hemocytes of Biomphalaria glabrata (Mollusca) that are either susceptible or resistant to Schistosoma mansoni (Trematoda). Mol. Biochem. Parasitol. 137, 321–328. Hahn, U.K., Bender, R.C., Bayne, C.J., 2001. Killing of Schistosoma mansoni sporocysts by hemocytes from resistant Biomphalaria glabrata: Role of reactive oxygen species. J. Parasitol. 87, 292–299. Hertel, L.A., Adema, C.M., Loker, E.S., 2005. DiVerential expression of FREP genes in two strains of Biomphalaria glabrata following exposure to the digenetic trematodes Schistosoma mansoni and Echinostoma paraensei. Dev. Comp. Immunol. 29, 295–303. Kops, G.J., Dansen, T.B., Polderman, P.E., Saarloos, I., Wirtz, K.W., CoVer, P.J., Huang, T.T., Bos, J.L., Medema, R.H., Burgering, B.M., 2002. Forkhead transcription factor FOXO3a protects quiescent cells from oxidative stress. Nature 419, 316–321. Lewis, F.A., Patterson, C.N., Knight, M., Richards, C.S., 2001. The relationship between Schistosoma mansoni and Biomphalaria glabrata: genetic and molecular approaches. Parasitology 123, S169–S179. Lockyer, A.E., Jones, C.S., Noble, L.R., Rollinson, D., 2004. Trematodes and snails: an intimate association. Can. J. Zool. 82, 251–269. Loker, E.S., Hertel, L.A., 1987. Alterations in Biomphalaria glabrata plasma induced by infection with the digenetic trematode Echinostoma paraensei. J. Parasitol. 75, 503–513. Mitta, G., Galinier, R., Tisseyre, P., Allienne, J.F., Girerd-Chambaz, Y., Guillou, F., Bouchut, A., Coustau, C., 2005. Gene discovery and expression analysis of immune-relevant genes from Biomphalaria glabrata hemocytes. Dev. Comp. Immunol. 29, 393–407. Murakami, K., Kondo, T., Kawase, M., Li, Y.B., Sato, S., Chen, S.F., Chan, P.H., 1998. Mitochondrial susceptibility to oxidative stress
63
exacerbates cerebral infarction that follows permanent focal cerebral ischemia in mutant mice with manganese superoxide dismutase deWciency. J. Neurosci. 18, 205–213. Nielsen, H., Krogh, A., 1998. Prediction of signal peptides and signal anchors by a hidden Markov model. In: Proc. Int. .Conf. Intell. Syst. Mol. Biol. (ISMB 6). AAAI Press, Menlo Park, California, pp. 122–130. Nielsen, H., Engelbrecht, J., Brunak, S., von Heijne, G., 1997. IdentiWcation of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Eng. 10, 1–6. Nowak, T.S., Woodards, A.C., Jung, Y., Adema, C.M., Loker, E.S., 2004. IdentiWcation of transcripts generated during the response of resistant Biomphalaria glabrata to Schistosoma mansoni infection using suppression subtractive hybridization. J. Parasitol. 90, 1034–1040. Raghavan, N., Miller, A.N., Gardner, M., FitzGerald, P.C., Kerlavage, A.R., Johnston, D.A., Lewis, F.A., Knight, M., 2003. Comparative gene analysis of Biomphalaria glabrata hemocytes pre- and postexposure to miracidia of Schistosoma mansoni. Mol. Biochem. Parasitol. 126, 181–191. Stibbs, H.H., Owczarzak, A., C.J., Bayne, P., Dewan, 1979. Schistosome sporocyst-killing amebas isolated from Biomphalaria glabrata. J. Invertebr. Pathol. 33, 159–170. Sorensen, R.E., Minchella, D.J., 2001. Snail-trematode life history interactions: past trends and future directions. Parasitology 123, S3–S18. Winnepenninckx, B., Backeljau, T., De Wachter, R., 1993. Extraction of high molecular weight DNA from molluscs. Trends Genet. 9, 407. Zelko, I.N., Mariani, T.J., Folz, R.J., 2002. Superoxide dismutase multigene family: A comparison of the CuZn-SOD (SOD1), Mn-SOD (SOD2), and EC-SOD (SOD3) gene structures, evolution, and expression. Free Radic. Biol. Med. 33, 337–349. Zhang, S.M., Loker, E.S., 2004. Representation of an immune responsive gene family encoding Wbrinogen-related proteins in the freshwater mollusc Biomphalaria glabrata, an intermediate host for Schistosoma mansoni. Gene 341, 255–266.
