Clin Rheumatol (2008) 27:827–831 DOI 10.1007/s10067-007-0796-6
ORIGINAL ARTICLE
Manganese superoxide dismutase Ala-9Val mitochondrial targeting sequence polymorphism in systemic lupus erythematosus in Poland Adam Sobkowiak & Margarita Lianeri & Mariusz Wudarski & Jan K. Łącki & Paweł P. Jagodziński
Received: 26 August 2007 / Revised: 1 November 2007 / Accepted: 9 November 2007 / Published online: 19 December 2007 # Clinical Rheumatology 2007
Abstract Systemic lupus erythematosus (SLE) is a chronic and progressive autoimmune disease in which reactive oxygen species contribute to pathogenesis. We analysed the distribution of manganese superoxide dismutase (MnSOD2) 47C>T (Ala-9Val) functional polymorphic variants within the mitochondrial targeting sequence in SLE patients (n= 102) and controls (n=199). We did not find significant differences in the distribution of MnSOD2 47C>T polymorphic variants in SLE patients and controls. However, we found that MnSOD2 Val/Val genotype (recessive model) showed a significant association with Raynaud’s phenomenon, odds ratio (OR)=12.000 [95% confidence interval (CI)=2.315–62.193], p=0.0015. We also found that the MnSOD2 Val/Val genotype contributes to immunologic manifestations, OR=2.957 (95% CI=1.207–7.243), p= 0.0222, and anti-dsDNA antibody presence OR=3.365 (95% CI=1.364–8.304), p=0.0107, in patients. Our observations indicate that MnSOD2 Val/Val variant can be linked to some clinical manifestations in patients with SLE. Keywords MnSOD2 . Polymorphisms . Systemic lupus erythematosus A. Sobkowiak : M. Lianeri : P. P. Jagodziński (*) Department of Biochemistry and Molecular Biology, Poznan University of Medical Sciences, 6 Święcickiego St., 60-781 Poznań, Poland e-mail:
[email protected] M. Wudarski : J. K. Łącki Institute of Rheumatology, Warsaw, Poland
Introduction Systemic lupus erythematosus (SLE) is a chronic and progressive autoimmune disorder characterized by a wide spectrum of clinical and immunological abnormalities [1, 2]. The pathogenesis of SLE is linked to defective function of CD4+ T cells, resulting in improper activation of B cells to produce an abundance of autoantibodies that form immune complexes [1, 3, 4]. SLE is also a clinical condition that also involves reactive oxygen species (ROS) contributing to its pathogenesis [5]. Patients with SLE exhibit increased lipid peroxidation in erythrocytes and blood plasma, as well as an increase of superoxide and hydrogen peroxide contents in peripheral leukocytes [6–9]. Peroxidation of low-density lipoprotein subfraction may contribute to severe and premature cardiovascular diseases in patients with SLE [10]. Increased production of ROS also can contribute to oxidative modification of DNA, which becomes more immunogenic and induces antibody (Ab) production directed against native DNA (nDNA) [11–13]. Oxidative stress indicates a disequilibrium between ROS and antioxidant protection [8]. Cells have several antioxidant enzymes to protect themselves from the damage caused by ROS. Superoxide dismutase (SOD) is the first line of protection, catalyzing the dismutation of superoxide anion into hydrogen peroxide. In mammals, SOD occurs in three isoforms: cytosolic (Cu-ZnSOD1), mitochondrial (MnSOD2) and extracellular (Cu-ZnSOD3) [8]. The MnSOD2 47C>T polymorphism is found on codon 16 and is responsible for Ala→Val substitution at position −9 in the mitochondrial targeting sequence of the mature enzyme [14]. Transport to the mitochondrion, and subsequent
828
Clin Rheumatol (2008) 27:827–831
MnSOD2 activity in this compartment, can be significantly reduced in the valine form of MnSOD2 [14–16]. An increase of lipid or DNA peroxidation in SLE patients can result from decreased activity of the antioxidant enzymes. Therefore, we analysed the distribution of functional MnSOD2 47C>T (Ala>Val) polymorphic variants in SLE patients (n=102) and controls (n=199).
Materials and methods Patients and controls Approximately 102 patients (women only) fulfilling the American College of Rheumatology Classification criteria for systemic lupus erythematosus [17, 18] were chosen for investigation at Institute of Rheumatology, Warsaw, Poland. In addition, the controls constituted 199 healthy women. The protocol of the study was approved by the Local Ethical Committee of Poznań University of Medical Sciences. Written consent was obtained from all participating subjects. Both patients and control groups were of Polish Caucasian origin. The mean age of SLE patients at diagnosis was 38± 11 years and of controls, 39±14 years. Genotyping DNA was isolated from peripheral blood lymphocytes by salt extraction. Polymorphic variants of MnSOD2 (47C>T, rs1799725) were identified using polymerase chain reaction (PCR) with primer pair 5′GCAGTGTGCGGGTGAGAA GAAAG3′and 5′CCTGGAGCCCAGATACCCCAAG3′; enzyme digestion followed the identification process [19]. The PCR fragments of MnSOD2 that were 338 bp in length were subjected to digestion with HaeIII (GG/CC) restriction enzyme. The 47C allele was cleaved into 210, 38, 33, 24, 23 and 10 bp fragments, whereas the 47T allele was cleaved into 233, 38, 33, 24 and 10 bp fragments. DNA fragments were separated on 10% polyacrylamide gels and stained by
silver method [19]. Confirmation of polymorphism was performed by sequencing analysis. Statistical analysis The distribution of genotypes in all groups was tested for deviation from Hardy–Weinberg equilibrium. Uncorrected chi-square test was used to determine differences in the genotypic and allelic distribution between patients and controls. Moreover, the odds ratio (OR) and 95% confidence intervals (CI) were calculated. A p value pT polymorphisms revealed no significant deviation from Hardy–Weinberg equilibrium in any group. We did not find significant differences in the distribution of MnSOD2 47C>T polymorphic variants in SLE patients and controls (Table 1). OR for SLE patients with 47TT (Val/Val) genotype was 1.504 (95% CI=0.8623–2.6230), p=0.1489; and OR of the 47TT (Val/Val) and 47CT (Ala/Val) genotypes was 1.413 (95% CI=0.7884 –2.532), p=0.2442 (Table 1). We also did not observe an association between the Val allele or Val/Val genotype with SLE disease activity. We observed a significant association between MnSOD2 Val/Val genotype (recessive model) and, respectively, Raynaud’s phenomenon, OR=12.000 (95% CI 2.315– 62.193), p=0.0015, and the p value remained statistically significant after Bonferroni correction (pcorr = 0.027; Table 2). However, the association of MnSOD2 Val/Val genotype (recessive model) with immunologic manifestations OR=2.957 (95% CI=1.207–7.243), p=0.0222, (pcorr = 0.400) and anti-dsDNA Ab presence OR=3.365 (95% CI=
Table 1 Genotype frequencies of MnSOD2 n
MnSOD2 47C>T
a
Controls 199 total SLE 102 total
Genotype distribution absolute number (frequency)
Allele absolute number (frequency)
47C/C
47C/T
47T/T
47C
47T
pa
51 (0.26)
108 (0.54)
40 (0.20)
210 (0.53)
188 (0.47)
0.1205
20 (0.20)
54 (0.53)
28 (0.27)
94 (0.46)
110 (0.54)
Uncorrected chi-square test. The odds ratio was calculated for patients homozygous carrying risk allele vs homozygous and heterozygous. c The odds ratio was calculated for patients homozygous and heterozygous carrying risk allele vs homozygous. b
Odds ratio (95% CI)
pa
1.504 (0.8623– 2.6230)b 1.413 (0.7884– 2.532)c
0.1489 0.2442
Clin Rheumatol (2008) 27:827–831
829
1.364–8.303), p=0.0107, (pcorr =0.193) in SLE patients did not remain statistically significant after Bonferroni correction (Table 2).
Discussion To date, the MnSOD2 valine homozygote genotype has been linked with nonfamilial idiopathic cardiomyopathy and has also been associated with diabetic nephropathy in Japanese patients with type II diabetes [20, 21]. Moreover, Valenti et al. [22] indicated that the valine allele was linked to reduced activity of MnSOD2 and increased the risk of cardiomyopathy in patients with hereditary hemochromatosis [22]. The inefficient valine form of MnSOD2 may also contribute to higher ROS levels and increased risk of cancer risk, while the alanine form has been found to be a risk factor of certain cancers, as well as Parkinson’s disease, motor neuron diseases, or schizophrenia [15, 23–27]. MnSOD2 is synthesized in the cytosol and posttranslationally modified for transport into the mitochondrion, where it catalyses the dismutation of two superoxide radicals [15]. Exploiting a Chou Fasman analysis, Shimoda-Matsubayashi et al. [15] envisaged that MnSOD2 47C>T (Ala>Val)
transition could change the secondary structure of the mitochondrial targeting sequence from an α-helical structure to a β-pleated sheet conformation. Rosenblum et al. [14] suggested that this change may impact on the cellular location of the enzyme and delivery of MnSOD2 into the mitochondrion. Recent research by Sutton et al. [16] indicates that the alanine form of MnSOD2 was targeted into the mitochondrial matrix, whereas the valine variant of this enzyme was partially retained in the inner mitochondrial membrane [16]. We observed a significant association of Raynaud’s phenomenon in the MnSOD2 Val/Val genotype. Bailey et al. [28] reported that changes of ROS activity in mitochondria of smooth muscle could initiate the coldinduced vasospasm seen in Raynaud’s phenomenon [28]. Since the MnSOD2 Val/Val genotype produces insufficient enzyme to remove superoxide anions in mitochondria, this ROS form may contribute to Raynaud’s phenomenon [28]. In our investigation, the MnSOD2 Val/Val genotype also exhibited an increased risk of immunological manifestations and production of anti-dsDNA Ab in SLE patients. Since most of these patients with a decrease in C3 and C4 complement also produced anti-dsDNA Ab, we presume that the association of MnSOD2 Val/Val genotype with immuno-
Table 2 The association of polymorphism MnSOD2 47C>T (Ala>Val) with clinical manifestations and production of autoantibodies in patients with SLE Characteristic
Central nervous system Vascular Raynaud’s phenomenon Vasculitis Thromboembolism Renal Musculoskeletal Serosal Dermal Immunologicd Constitutional (fever) Hematologic ANA Anti-dsDNA Anti-Smith Anti-snRNP Anti-Ro Anti-La Anti-Scl-70 a
Odds ratio (95% CI), pc
Genotype distribution Ala/Ala (20)a
Ala/Val (54)a
Val/Val (28)a
3 1 1 1 1 9 9 4 10 5 2 6 20 4 2 3 5 2 4
12 5 1 2 2 30 34 11 33 18 7 21 54 17 7 12 15 10 15
5 8 7 1 1 12 13 3 13 16 3 9 28 16 3 6 6 4 6
12.000 (2.315–62.193)b, p=0.0015
2.957 (1.207–7.243)b, p=0.0222
3.365 (1.364–8.304)b, p=0.0107
Absolute number of positive patients for Val/Val, Ala/Val, and Ala/Ala genotypes, respectively Absolute number of positive patients for Val/Val vs Ala /Val and Ala/Ala c Comparison of patients with clinical manifestations/autoantibody with patients without a manifestation/autoantibody was performed by Fisher exact test. d Patients with decrease in CH50, C3, or C4 below the lower limit and with most of them possessing anti-dsDNA Ab. b
830
logical manifestations was a consequence of the presence of anti-dsDNA Ab in the patient’s serum. The MnSOD2 valine form can be associated with protein oxidation, mitochondrial DNA mutations, and eventually lead to an increase in apoptosis of immune cells [29]. An increase in apoptosis of leucocytes and/or decreased clearance of apoptotic cells has been found in patients with SLE [30, 31]. Hepburn et al. [31] found many apoptotic bodies in the bone marrow of patients with SLE [31]. Insufficient removal of apoptotic cells results in the accumulation of necrotic cell DNA, which may become an immunogenic antigen following ROS modification [30– 32]. nDNA is not the antigen initiating the disease, since immunization with nDNA does not result in SLE-like manifestations. However, ROS-modified DNA induces the production of Ab, which also displays variable binding affinity to nDNA [11–13, 33]. Moreover, the anti-DNA Ab found in patients with SLE has been shown to exhibit a greater ability to recognize ROS-modified DNA than nDNA [32]. Despite the MnSOD2 A-9V amino acid substitution not being associated with incidence of SLE, our genetic results suggest that the MnSOD2 valine variant can be linked with some clinical manifestation in patients with SLE. However, to determine more precisely the associations of MnSOD2 valine variant to SLE manifestations, further investigation of these forms’ prevalence in other populations is needed. Acknowledgements The technical assistance of Ms. Agnieszka Mikuczewska is gratefully acknowledged.
References 1. Sekigawa I, Naito T, Hira K, Mitsuishi K, Ogasawara H, Hashimoto H, Ogawa H (2004) Possible mechanisms of gender bias in SLE: a new hypothesis involving a comparison of SLE with atopy. Lupus 13:217–222 2. Bombardier C, Gladman DD, Urowitz MB, Caron D, Chang CH (1992) Derivation of the SLEDAI. A disease activity index for lupus patients. The Committee on Prognosis Studies in SLE. Arthritis Rheum 35:630–640 3. Piotrowski PC, Duriagin S, Jagodzinski PP (2005) Expression of human endogenous retrovirus clone 4-1 may correlate with blood plasma concentration of anti-U1 RNP and anti-Sm nuclear antibodies. Clin Rheumatol 24:620–624 4. Januchowski R, Wudarski M, Chwalińska-Sadowska H, Jagodzinski PP (2008) Prevalence of ZAP-70, LAT, SLP-76, and DNA methyltransferase 1 expression in CD4(+) T cells of patients with systemic lupus erythematosus. Clin Rheumatol 27:21–27 5. Taysi S, Gul M, Sari RA, Akcay F, Bakan N (2002) Serum oxidant/antioxidant status of patients with systemic lupus erythematosus. Clin Chem Lab Med 40:684–688 6. Serban MG, Negru T (1998) Antioxidant protection in collagenvascular diseases. Rom J Intern Med 36:245–250 7. Túri S, Németh I, Torkos A, Sághy L, Varga I, Matkovics B, Nagy J (1997) Oxidative stress and antioxidant defense mechanism in glomerular diseases. Free Radic Biol Med 22:161–168
Clin Rheumatol (2008) 27:827–831 8. Ahsan H, Ali A, Ali R (2003) Oxygen free radicals and systemic autoimmunity. Clin Exp Immunol 131:398–404 9. Suryaprabha P, Das UN, Ramesh G, Kumar KV, Kumar GS (1991) Reactive oxygen species, lipid peroxides and essential fatty acids in patients with rheumatoid arthritis and systemic lupus erythematosus. Prostaglandins Leukot Essent Fat Acids 43:251– 255 10. Nuttall SL, Heaton S, Piper MK, Martin U, Gordon C (2003) Cardiovascular risk in systemic lupus erythematosus—evidence of increased oxidative stress and dyslipidaemia. Rheumatology 42:758–762 11. Ahmad R, Alam K, Ali R (2000) Antigen binding characteristics of antibodies against hydroxyl radical modified thymidine monophosphate. Immunol Lett 71:111–115 12. Ashok BT, Ali R (1999) Antigen binding characteristics of experimentally induced antibodies against hydroxyl radical modified native DNA. Autoimmunity 29:11–19 13. Ahmad J, Ashok BT, Ali R (1998) Detection of oxidative DNA damage by a monoclonal antibody: role of lysyl residues in antigen binding. Immunol Lett 62:87–92 14. Rosenblum JS, Gilula NB, Lerner RA (1998) On signal sequence polymorphisms and diseases of distribution. Proc Natl Acad Sci U S A 93:4471–4473 15. Shimoda-Matsubayashi S, Matsumine H, Kobayashi T, Nakagawa-Hattori Y, Shimizu Y, Mizuno Y (1996) Structural dimorphism in the mitochondrial targeting sequence in the human manganese superoxide dismutase gene. A predictive evidence for conformational change to influence mitochondrial transport and a study of allelic association in Parkinson’s disease. Biochem Biophys Res Commun 226:561–565 16. Sutton A, Khoury H, Prip-Buus C, Cepanec C, Pessayre D, Degoul F (2003) The Ala16Val genetic dimorphism modulates the import of human manganese superoxide dismutase into rat liver mitochondria. Pharmacogenetics 13:145–157 17. Tan EM, Cohen AS, Fries JF, Masi AT, McShane DJ, Rothfield NF, Schaller JG, Talal N, Winchester RJ (1982) The 1982 revised criteria for the classification of systemic lupus erythematosus. Arthritis Rheum 25:1271–1217 18. Hochberg MC (1997) Updating the American College of Rheumatology revised criteria for the classification of systemic lupus erythematosus. Arthritis Rheum 40:1725 19. Mostowska A, Hozyasz KK, Lianeri M, Piwowar W, Jagodzinski PP (2007) Polymorphic variants of genes encoding main antioxidant enzymes and the risk of CL/P-affected pregnancies. Clin Biochem 40:416–419 20. Hiroi S, Harada H, Nishi H, Satoh M, Nagai R, Kimura A (1999) Polymorphisms in the SOD2 and HLA-DRB1 genes are associated with nonfamilial idiopathic dilated cardiomyopathy in Japanese. Biochem Biophys Res Commun 261:332–339 21. Nomiyama T, Tanaka Y, Piao L, Nagasaka K, Sakai K, Ogihara T, Nakajima K, Watada H, Kawamori R (2003) The polymorphism of manganese superoxide dismutase is associated with diabetic nephropathy in Japanese type 2 diabetic patients. J Hum Genet 48:138–141 22. Valenti L, Conte D, Piperno A, Dongiovanni P, Fracanzani AL, Fraquelli M, Vergani A, Gianni C, Carmagnola L, Fargion S (2004) The mitochondrial superoxide dismutase A16V polymorphism in the cardiomyopathy associated with hereditary haemochromatosis. J Med Genet 41:946–950 23. Ambrosone CB, Freudenheim JL, Thompson PA, Bowman E, Vena JE, Marshall JR, Graham S, Laughlin R, Nemoto T, Shields PG (1999) Manganese superoxide dismutase (MnSOD) genetic polymorphisms, dietary antioxidants, and risk of breast cancer. Cancer Res 59:602–606 24. Mitrunen K, Sillanpää P, Kataja V, Eskelinen M, Kosma VM, Benhamou S, Uusitupa M, Hirvonen A (2001) Association
Clin Rheumatol (2008) 27:827–831
25.
26.
27.
28.
between manganese superoxide dismutase (MnSOD) gene polymorphism and breast cancer risk. Carcinogenesis 22:827–829 Woodson K, Tangrea JA, Lehman TA, Modali R, Taylor KM, Snyder K, Taylor PR, Virtamo J, Albanes D (2003) Manganese superoxide dismutase (MnSOD) polymorphism, α-tocopherol supplementation and prostate cancer risk in the α-tocopherol, ß-carotene cancer prevention study. Cancer Causes Control 14:518–518 Hung RJ, Boffetta P, Brennan P, Malaveille C, Gelatti U, Placidi D, Carta A, Hautefeuille A, Porru S (2004) Genetic polymorphisms of MPO, COMT, MnSOD, NQO1, interactions with environmental exposures and bladder cancer risk. Carcinogenesis 25:973–978 Van Landeghem GF, Tabatabaie P, Beckman G, Beckman L, Andersen PM (1999) Manganese-containing superoxide dismutase signal sequence polymorphism associated with sporadic motor neuron disease. Eur J Neurol 6:639–644 Bailey SR, Mitra S, Flavahan S, Flavahan NA (2005) Reactive oxygen species from smooth muscle mitochondria initiate cold-
831
29. 30.
31.
32. 33.
induced constriction of cutaneous arteries. Am J Physiol Heart Circ Physiol 289:H243–H250 Green DR, Reed JC (1998) Mitochondria and apoptosis. Science 281:1309–1312 Ren Y, Tang J, Mok MY, Chan AW, Wu A, Lau CS (2003) Increased apoptotic neutrophils and macrophages and impaired macrophage phagocytic clearance of apoptotic neutrophils in systemic lupus erythematosus. Arthritis Rheum 48:2888–2897 Hepburn AL, Lampert IA, Boyle JJ, Horncastle D, Ng WF, Layton M, Vyse TJ, Botto M, Mason JC (2007) In vivo evidence for apoptosis in the bone marrow in systemic lupus erythematosus. Ann Rheum Dis 66:1106–1109 Blount S, Griffiths HR, Lunec J (1989) Reactive oxygen species induce antigenic changes in DNA. FEBS Lett 245:100–104 Ara J, Ali R (1992) Reactive oxygen species modified DNA fragments of varying size are the preferred antigen for human antiDNA autoantibodies. Immunol Lett 34:195–200
