Veterinary Immunology and Immunopathology 89 (2002) 133–148
Limited effect of recombinant porcine interleukin-12 on porcine lymphocytes due to a low level of IL-12 beta2 receptor G.I. Solano-Aguilar*, D. Zarlenga, E. Beshah, K. Vengroski, L. Gasbarre, D. Junker, M. Cochran, C. Weston, D. Valencia, C. Chiang, H. Dawson, J.F. Urban, J.K. Lunney Nutrient Requirement and Functions Laboratory, BHNRC-ARS-USDA, 10300 Baltimore Avenue, Building 307, Room 228, Beltsville, MD 20705, USA Received 4 January 2002; received in revised form 30 May 2002; accepted 19 June 2002
Abstract The cytokine interleukin-12 (IL-12) is a key molecule in the regulation of CD4 þ T cell development and specifically potentiates T helper 1 responses in mouse and man. However, biological effects mediated by IL-12 have not been well defined in pigs. Herein, recombinant porcine IL-12 (rPoIL-12) was expressed in a swine poxvirus system as a biologically active heterodimer and used to stimulate bovine or swine lymphoblast cells. After 3 days of incubation, only bovine blasts were responsive to the rPoIL-12 treatment as monitored by cell proliferation in several independent trials. Similarly, i.m. administration of rPoIL-12 in the hind leg of 3-week-old pigs indicated a reduction in the number of interferon-g (IFN-g) producing lymphocytes isolated from inguinal lymph nodes. The porcine IL-12R beta2 (IL-12Rb2) sequence was cloned and results generated by reverse transcriptase polymerase chain reaction (RT-PCR) demonstrated that the expression of IL-12R on porcine blasts as measured by the relative levels of IL-12Rb2 mRNA was less than that in bovine blasts and are in agreement with the reduced proliferation response of swine blast cells to rPoIL-12 treatment. Real time PCR analysis demonstrated that after PBMC stimulation, bovine blasts had an 11-fold increase in IL-12Rb2 mRNA levels while porcine blasts had almost no change. These data support a mechanism for IL-12 stimulation in swine inconsistent with that observed in conventional models. # 2002 Elsevier Science B.V. All rights reserved. Keywords: Interleukin-12; IL-12 receptor; Porcine cellular immunity; IFN-g; Swine poxvirus
1. Introduction Acute and chronic infections in swine originating from viral, bacterial and parasitic organisms affect profitability in the industry due to morbidity, mortality, * Corresponding author. Tel.: þ1-301-504-8068; fax: þ1-301-504-9062. E-mail address:
[email protected] (G.I. Solano-Aguilar).
imposed restrictions on trade, and increased use of vaccinations and drug treatments. Immune responses involved in protecting swine from infection are not well understood; however, the potential role of cytokines has received considerable attention in this regard. Of particular interest has been the participation of interleukin-12 (IL-12) in enhancing IFN-g dependent immune responses that resist infection with many intracellular pathogens. IL-12 plays a central role in both the initiation and regulation of cell mediated
0165-2427/02/$ – see front matter # 2002 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 5 - 2 4 2 7 ( 0 2 ) 0 0 2 0 5 - 2
134
G.I. Solano-Aguilar et al. / Veterinary Immunology and Immunopathology 89 (2002) 133–148
immune responses by exerting a number of effects on T and NK cells (Trinchieri, 1995) through the induction of IFN-g, the development of differentiated Th1 cells, and the enhancement of T and NK cytotoxicity (Trinchieri, 1995; Cho et al., 1996). The biological activities of IL-12 are mediated through a specific, high affinity receptor that is expressed primarily on activated T cells and freshly isolated NK cells (Gately et al., 1998). In human and murine systems, the cDNA for the two IL-12 receptor (IL-12R) subunits have been cloned from T cells and designated IL-12Rb1 and IL-12Rb2 (Presky et al., 1996). Studies on both humans and experimental animal models have demonstrated that the responsiveness to IL-12 treatment correlate with the differential expression of the signaling component of the IL-12 receptor; the IL-12Rb2 chain (Szabo et al., 1997; Rogge et al., 1997). Expression of IL-12Rb2 mRNA on CD4þ and CD8þ T cells in human and mouse cells is differentially regulated by IFN-g and IFN-a, respectively (Rogge et al., 1997; Szabo et al., 1997), and is independent of endogenous IL-12 (Wu et al., 2000). Recombinant IL-12 has limited efficacy as an enhancer of the swine immune response. Administration of recombinant human IL-12 (rHuIL-12) or recombinant murine IL-12 (rMuIL-12) resulted in enhancement of porcine NK cytotoxicity and secretion of tumor necrosis factor-alpha (TNF-a) (Cho et al., 1996). Single-chain porcine IL-12 (scpIL-12) expressed in Pichia pastoris induced proliferation of human lymphoblasts in vitro and IFN-g production from cultured lymphocytes isolated from pig mesenteric lymph nodes. Although scpIL-12 and rHuIL-12 induced similar levels of proliferation in human lymphoblasts, no proliferative activity was reported for isolated porcine cells (Foss et al., 1999). Furthermore, recent studies by Domeika et al. (2002) showed that the ability of IL-12 to induce IFN-g production in peripheral blood mononuclear cells (PBMC) in vitro was dependent on the presence of interleukin-18 (IL-18). rHuIL-12 when used as an adjuvant in swine, may be important in improving the immune response against certain viral infections (Zuckermann et al., 1998) and in enhancing humoral immune responses at the mucosal level (Foss et al., 1999). However, the level of enhancement of the immune response as reported for other species, has not been demonstrated in swine. The purpose of these studies was to
investigate the effects of rPoIL-12 treatment on cellular immune responses in pigs by comparing the in vivo and in vitro bioactivity of heterodimeric recombinant porcine IL-12 (rPoIL-12) on the homologous porcine system. Our study suggests that extrapolating data on IL-12 induced pathways from mouse, bovine and human models to immune mechanisms in swine should be done carefully, since the expression of IL-12R seems to be regulated differently.
2. Materials and methods 2.1. Recombinant interleukin-12 production and purification Recombinant bovine IL-12 (rBoIL-12) and recombinant porcine IL-12 (rPoIL-12) were expressed in both swine poxvirus (SPV) and raccoon poxvirus (RPV) systems. SPV (VR-363) and RPV (VR-838) strains were obtained from the American Type Culture Collection and designated SPV-001 and RPV-001, respectively. The genes encoding the p35 and p40 subunits of porcine were generated from cDNA using primers derived from the IL-12 p35 (L35765) and IL12 p40 (U08317) sequences. Bovine IL-12, previously cloned by Zarlenga et al. (1995a), was subcloned by PCR. All cloned fragments were sequenced for verification. The cloned p35 and p40 genes were engineered to be under the control of separate synthetic poxvirus late promoters. Viral DNAs, genetically modified to contain either the porcine or bovine IL-12 genes in a unique BglII restriction site in the I5L ORF of the SPV HindIII DNA fragment (US Patent 6,033,904), were transfected into ESK-4 cells (CL-184) previously infected with the SPV-001 parent strain. The Escherichia coli b-galactosidase (lacZ) marker gene, regulated by a synthetic poxvirus promoter, was incorporated into all recombinant viruses to aid in their identification. Following homologous recombination, recombinant viruses expressing active b-galactosidase were identified by staining infected monolayers of ESK-4 cells with BluogalTM (Bethesda Research Labs, Bethesda, MD). Positive swinepox recombinant viruses producing rPoIL-12 and rBoIL12 were plaque purified and designated SPV-278 and SPV-165, respectively. Racoon pox viral recombinant, RPV-043, containing the porcine p35 and p40 subunits
G.I. Solano-Aguilar et al. / Veterinary Immunology and Immunopathology 89 (2002) 133–148
was similarly constructed and purified using feline kidney cells (CRFK). Insertions were made into a unique XbaI restriction site in the O1L ORF of the RPV HindIII DNA fragment. IL-12 expression and secretion from SPV-165, SPV-278, and RPV-043 infected cell monolayers was confirmed by Western blot analysis of conditioned media using IL-12 specific serological reagents (Endogen, Woburn, MA). The supernatants from these cultures were harvested when maximal cytopathic effects developed (5–6 days). rPoIL-12 was purified from culture fluids by cation exchange chromatography followed by hydrophobic interaction chromatography. Approximately 200 ml of SPV-278 cell culture supernatant was diluted with 1 L of 50 mM NaH2PO4, pH 6.0 (Buffer A). The insoluble material was removed by filtration through a 3 mm A/D glass fiber filter (Gelman Sciences, Ann Arbor, MI) and then filtered through a 1 mm A/B extra thick glass fiber filter (Gelman Sciences, Ann Arbor, MI). The sample was applied to an XK16/20 column containing approximately 24 ml SP fast flow sepharose at a flow rate of 10 ml/min. After washing with approximately two column volumes of Buffer A, a step gradient was utilized to elute bound proteins. The peak, containing primarily IL-12, was eluted at 52% Buffer B (50 mM NaH2PO4, 1 M NaCl, pH 6.0). IL-12 containing SP fractions were pooled and brought to 1.3 M (NH4)2SO4 by adding an equal volume of 2.3 M (NH4)2SO4 in 50 mM NaH2PO4, pH 6.0. The resulting solution was applied to a HR 10/10 column containing approximately 10 ml butyl sepharose previously equilibrated in Buffer C (50 mM NaH2PO4, 1.3 M (NH4)2SO4, pH 6.0). The column was washed with approximately two column volumes of 82% Buffer C and IL-12 eluted as a single peak at 33% Buffer C. To check the approximate molecular weight of the IL-12 eluted from the butyl sepharose column, a 1 ml portion of the butyl sepharose pool was applied to a HiPrep 16/ 60 Sephacryl S200 High Resolution column. Proteins migrate through this resin in a manner inversely proportional to their molecular weights. Purified porcine IL-12 generated from conditioned media of SPV278 infected ESK-4 cells was analyzed by sodium dodecylsulfate-polyacrylamide gel electorphoresis (SDS-PAGE) and Western blot analysis using standard techniques (Towbin et al., 1979). Infected cell lysates were fractionated on 10, 1.5 mm well, NuPageTM mini
135
gels (Invitrogen, Carlsbad, CA) in 1 MES buffer (Invitrogen). Proteins were transferred onto nitrocellulose paper (Invitrogen) in 1 transfer buffer (Invitrogen) and blocked with 5% dried milk in 1 TS. Nitrocellulose blots were probed with antibodies (described above) diluted in 5% dried milk. Blots were reacted with NBT/BCIP alkaline phosphatase substrate. Proliferation assays to test bioactivity of purified products were run in parallel with supernatants from cultures infected with wild type SPV (SPV-001) or RPV (RPV-001) or the commercially available p40 subunit of rPoIL-12 (com p40) (Endogen, Woburn, MA) as negative controls. Commercially available rPoIL-12 (com p70) (Endogen, Woburn, MA), rPoIL-12 (com rPoIL-12) (R&D systems, Minneapolis, MN) and rHuIL-12 (R&D systems, Minneapolis, MN) were used as positive controls. The purified rPoIL-12 protein concentration was determined using the Bradford reagent (Sigma Chemical, St. Louis, MO) according to manufacturer protocol. 2.2. Experimental design and animals Nine Yorkshire X Polland China outbred pigs aged 3–5 months, and nine 12-month-old cattle were randomly selected from the experimental farm at the Animal and Natural Resources Institute in Beltsville. Healthy animals unexposed to known antigenic stimulation were used as blood donors for all in vitro experiments. In vivo experiments were performed with 5-week-old outbred pigs that had been acclimatized for 2 weeks after weaning. Pigs were injected in the left hind leg with 23 mg of rPoIL-12 (2.0 mg/kg body weight) diluted in sterile PBS. This dose was five-fold higher than the one used on a previous experiment were IL-12 has been tested as an adjuvant (Zuckermann et al., 1998). An equal volume of sterile diluent only was injected on the contralateral right hind leg as a control. ILN were also collected for the isolation of lymphocytes. For the isolation of peripheral blood mononuclear cells (PBMC), blood samples were collected in EDTA tubes. 2.3. IL-12 bioassay Porcine PBMC were isolated using lymphocyte separation media (LSM) (Organon Teknika Cappel, Durham, NC, USA) (Solano-Aguilar et al., 2000).
136
G.I. Solano-Aguilar et al. / Veterinary Immunology and Immunopathology 89 (2002) 133–148
Bovine PBMC were separated using Ficoll hypaque (Canals et al., 1997). Cells collected from the interface were washed twice with RPMI-1640 medium and resuspended in blastogenic media (RPMI-1640, 200 mM L-glutamine, 100 mg/ml Pen-Strep, 5 105 M 2-ME, 10% FBS, 25 mM HEPES, pH 7.2). Cell viability was assessed by Trypan Blue exclusion. Porcine and bovine blasts were generated after modifications of a method (Gately and Chizzonite, 1992) used to measure proliferation of PHA-activated human lymphoblasts in response to rHuIL-12. Such modifications included the culture of PBMC (1 106 cells/ml) in blastogenic media containing 5 ng/ml of PMA (Sigma, St. Louis, MO, USA) and 2.5 mg/ml of Con A (Sigma Chemical, St. Louis, MO, USA) to provide the formation of small clusters of proliferating cells characteristic of blast formation. Lymphoblasts were separated in a discontinuous 25:40:50:70 percoll gradient (Ficoll, Amersham Pharmacia Biotech AB, Uppsala, Sweden), washed twice with RPMI, then plated at 2:5 104 cells per well in a 96-well flat bottom plate (Corning, NY) and treated with different dilutions of rPoIL-12 (SPV-278, RPV-043), rBoIL-12 (SPV-165), commercially available rPoIL-12 (com p70, com rPoIL-12) and rHuIL-12 for 3, 4 or 5 days. Proliferation of lymphoblasts was measured by [3H] thymidine incorporation (1.0 mCi/ well) uptake for the final 12 h of incubation. Cells were harvested on nitrocellulose filters and the incorporated [3H] thymidine determined as counts per minute (cpm). 2.4. IL-12Rb2 cloning and measurement of mRNA levels The mRNA sequence encoding the b2 subunit of the interleukin-12 receptor (IL-12Rb2) was cloned using PCR primers derived from regions conserved among human (Genbank U64199) and mouse (Genbank U64198) sequences and from the swine IL-12Rb2 receptor chain fragment previously produced during the construction of a competitor molecule for RT-PCR (Solano-Aguilar et al., 2001). Oligo dT-primed cDNA from mitogen stimulated, lymphoblast derived mRNA was used to amplify four partially overlapping cDNA fragments which were subsequently cloned and subjected to automated sequencing. Specific primers 5 0 -TAT-CAT-CAT-GTC-ACT-CTT-GGT-TAA-GG
and 50 -CAC-CCC-ATC-TTC-AAC-TGA-TCC-AGAGTC proximal to the 50 and 30 termini, respectively, were used to amplify a single PCR product of 2526 bp in length, which was inserted into pCR 2.1 by AT cloning and sequenced. PCR conditions required a 3 min extension at 60 C, 40 cycles, advantage 2 polymerase mix (Clontech, CA) and buffers as recommended by the manufacturer. Alignment of swine, bovine, human and mouse predicted amino acid sequences was performed using the Clustal W program (Thompson et al., 1994) and program defined default values. IL-12Rb2 receptor mRNA levels were determined by competitive reverse transcriptase polymerase chain reaction (RT-PCR) (Zarlenga et al., 1995b) using the competitor molecule previously generated (SolanoAguilar et al., 2001). Total RNA was isolated from stimulated lymphoblasts using Trizol (GIBCO, BRL, Life technologies, Grand Island, NY) according to manufacturer recommendations. cDNA was synthesized in 20 ml using 5 mg of total RNA. PCR amplifications were performed in 25 ml containing 1 ml of cDNA, 0.2 mM of each primer, 1.5 mM MgCl2, 200 mM dNTP, 0.5 U of Taq gold polymerase and a single concentration of plasmid competitor determined empirically to permit quantification of competitor and cDNA fragments. The resulting PCR products were separated on 1.8% Metaphor: 0.2% GTG agarose gels and stained with ethidium bromide. Amplification of hypoxanthine phosphoribosyltransferase (HPRT) from cDNA in the presence of the corresponding competitor molecule was used to normalize cDNA synthesis. Intensities of fluorescent bands from scanned gels were quantitated (Sigmagel software, Jandel, San Rafael, California) and the ratios of amplified cDNA to competitor (cDNA/comp) were calculated and normalized to HPRT values. Ratios are represented as relative intensity values and do not necessarily reflect absolute differences in the amount of receptor mRNA between any two samples. Additional comparisons using real time PCR were performed in a set of lymphoblast generated from stimulated PBMC from three cows and three pigs. Real-time PCR primer and probe sequences for bovine HPRT (AF176419) or IL-12Rb2 (BTA308426) and porcine HPRT (U69731) or IL-12Rb2 (AF448143) were designed by using the computer program Primer Express 1.5 (Applied Biosystems, Foster City, CA) and synthesized by Keystone DNA/Biosource International
G.I. Solano-Aguilar et al. / Veterinary Immunology and Immunopathology 89 (2002) 133–148
137
Table 1 Primer sequences Sequence R primer (50 –30 )
Gene
F primer (nM)
R primer (nM)
Probe (nM)
Sequence F primer (50 –30 )
poHPRT
300
300
200
TGCTCGAGATGT- CCAGCAGGTCGATGAAAGAGA AGCAAAGAATT
poIL-12Rb2
300
300
100
GGCCAGGAAAGGGACAAAG
boHPRT
300
900
150
TTATGGACAGGA- CAGGTCGGCAACCGAACGG AGAACTTATAGC
50
300
250
CTAGTTACACAG- CCTCACTATGTCTCAAGGTTACCAGCAATGTGA TGCTATCA
boIL-12Rb2
(Foster City, CA). Working dilutions and primer sequences are summarized on Table 1. Five micrograms RNA equivalent of cDNA was used for PCR amplification. PCR reactions were performed in optically-clear 96 well microtiter plates and caps (Abgene, Marsh, Rochester, NY) on an ABI PRISM 7700 Sequence Detector System (Applied Biosystems). PCR was performed using a commercial available kit (Brilliant kit, Stratagene, La Jolla, CA). Amplification conditions were as follows 50 8C for 2 min; 95 8C for 10 min; 40 cycles of 95 8C 15 s and 60 8C for 1 min. Fluorescence signals measured during amplification were processed post-amplification and were regarded as positive if the fluorescence intensity was 10-fold greater than the standard deviation of the baseline fluorescence. This level is defined as the threshold cycle (Ct). The Ct value for HPRT was subtracted from the Ct value for each message to normalize for RNA content. This value is defined as DCT. To evaluate the effects of stimulation, DCTstimulation was subtracted from DDCtcontrol. This value is defined as DDCT. The relative fold increase or decrease was then calculated as 2DDCT (Livak and Schmittgen, 2001). 2.5. Capture Elisa for IFN-g production and Elispot assay A sandwich Elisa was used to detect the level of IFN-g produced in the supernatant of cells cultured
CCCCAGCACCTTGTACAGATC
Sequence probe (50 –30 )
Genbank accession number
VIC-TCACATCGTAGCCCTCTGTGTGCTCAA-TAMRA 6FAM-AGTCCACCACCTCCAAGGGCTCTCAC-TAMRA TET-TCACATTGTGGCCCTCTGTGCGCTCAA-BHQ1 FAM-CTTGGGAGTGCTTCTTCATTTCCATTCTCAT-TAMRA
SSU69731
AF448143
AF176419
BTA308426
with 0.5 ng/ml of rPoIL-12, and mitogens such as PMA/ConA or PHA for 24 h in culture media (Mateu de Antonio et al., 1998). An IFN-g Elispot assay was adapted from Morris et al. (1994) and Zuckermann et al. (1998) and used to measure the number of IFN-g producing cells per 1 106 PBMC. Immunolon-2 plates (96-well) were coated overnight with 100 ml/ well of capture antibody P2G10 at 4 mg/ml final concentration in carbonate–bicarbonate buffer (0.5 M) pH 9.6. Wells were washed three times with PBS–0.05% Tween 20 (PBST) followed by three additional washes with plain PBS. Wells were blocked with 200 ml of RPMI–5% FCS for a minimum of 1 h at 37 C. After removing the blocking agent, wells were set-up as serial four-fold dilutions starting at a concentration of 1 107 ml1. PHA-M (Sigma Chemical, St. Louis, MO) was added as the stimulant at a final concentration of 10 mg/ml. After incubation with a final volume of 200 ml/well at 37 8C overnight, wells were washed three times with PBS followed by three times with PBST. The biotinlylated secondary antibody P2C11 (100 ml/well) was added at 2 mg/ml in RPMI-5% FCS, and incubated at 37 8C for 1–2 h. After washing with PBS/PBST, 100 ml of Streptavidin alkaline phosphatase (Zymed, San Francisco, CA) diluted 1:1000 in RPMI–5% FCS was added and incubated for 1 h. After five washes with PBS, 100 ml of a 0.1 M 2-amino-2-methyl-1-propanol (2A2M1P) buffer, pH 10.5 containing BCIP (5-bromo-4-chloro-3-indolyphosphate) (Sigma Chemical, St. Louis, MO) tablets
138
G.I. Solano-Aguilar et al. / Veterinary Immunology and Immunopathology 89 (2002) 133–148
and SeaPlague agarose (BioWhittaker Molecular Applications, Rockland, ME) at 0.6% final concentration were added quickly to wells without moving the plate. Plates were covered and allowed to solidify for at least 3–4 h in the dark, then placed at 4 8C in the dark. Plates were scored under a dissecting scope after 16 h.
3. Results 3.1. IL-12 bioactivity A Western blot run under non-reducing conditions demonstrated that the purified rPoIL-12 eluted from the butyl sepharose column contained distinguishable bands. Three of them at approximately 80, 75 and 40 kDa probably corresponding to the p40 homodimer, the 75 heterodimer and the p40 subunit of the IL-12 (Fig. 1, lane 1). The 75 kDa band and 40 kDa band were very similar to the bands found in the com rPoIL-12 (Fig. 1, lane 2) and rHuIL-12 (Fig. 1, Lane 4). Only a 70 kDa band was detected on the com p70 recombinant (Fig. 1, lane 3). The bioactivity of the rPoIL-12 (SPV-278), rBoIL-12 and rHuIL-12 was tested by comparing their effects on the proliferation of cultured bovine lymphoblasts derived from stimulated PBMC. Results from repetitive experiments showed a substantial increase in proliferation of bovine lymphoblasts when rPoIL-12 (SPV-278, RPV-043), rBoIL-12 (SPV-165) or rHuIL-12 were used as stimulants. No proliferation was seen when viral supernatants from the poxvirus vector (RPV-014)
in the absence of cloned IL-12 sequences were used. The level of proliferation was very similar for all recombinant IL-12 products and was dose dependent (Fig. 2A). No differences in proliferation were observed between crude (SPV-278) and purified rPoIL-12 (pur SPV-278) constructs or with other commercial recombinant IL-12 tested (com rPoIL-12, com p70, rHuIl-12) (data not shown). In several repeats, using porcine lymphoblasts for the IL-12 bioactivity assay, the addition of rPoIL-12 (SPV-278), purified rPoIL-12 (pur SPV-278), com rPoIL-12, com p70 or rHuIL-12 produced only minimal proliferative activity. Cells stimulated with the com p40 or with the viral supernatant from the poxvirus vector in the absence of cloned IL-12 sequences showed no proliferative response (Fig. 2B). A small increase in proliferation was seen with the more concentrated dilutions of the same stimulants when tested on porcine lymphoblast that were generated with a combination of PHA and IL-2 (Fig. 2C). No differences in proliferation were found on blasts from days 4 or 5 as compared to day 3 or when porcine blasts were generated and cultured in the presence of homologous or purified porcine serum (data not shown). To validate porcine blast responsiveness, homologous supernatants from PMA/ConA stimulated cells were added to porcine lymphoblasts cultured in the presence of varying amounts of rPoIL-12 (pur SPV-278). Results shown in Fig. 3 indicate that proliferation of lymphoblasts at day 3 was dependent on the concentration of PMA/ConA supernatant and independent of the addition of rPoIL-12. Higher
Fig. 1. Immunoblot of recombinant porcine IL-12 (rPoIL-12). Purified rPoIL-12 eluted from the butyl sepharose column containing the 80, 75 and 40 kDa fractions of IL-12 (lane 1), commercial rPoIL-12 (com rPoIL-12) (R&D systems) with the 75 and 40 kDa fractions (lane 2), commercial rPoIL-12 (com p70) (Endogen) with 70 kDa fraction (lane 3), and commercial rHuIL-12 (R&D systems) with the 75 and 40 kDa fractions (lane 4) were electrophoresed in a 12% NuPAGE Bis–Tris gel, transferred to a membrane and immunoblotted with rabbit Anti-Pig IL-12 polyclonal antibody (Endogen). Commercial rPoIL-12 and rHuIL-12 are shown for comparison.
Fig. 2. Interleukin-12 bioassay. (A) Bovine blasts were produced as described in Section 2. Blasts were stimulated with two-fold-dilutions of rHuIL-12 (starting at 500 ng/ml) or with two-fold dilutions of supernatants from cells infected with vector alone (RPV-014), rPoIL-12 from raccoon poxvirus (RPV-043), rPoIL-12 from swine poxvirus (SPV-278) or rBoIL-12 from swine poxvirus (SPV-165). Infection media without any cloned product was used as negative control. Data points represent the mean 1 standard deviation of counts per minute (cpm) from triplicate wells; (B) proliferation of porcine blasts after stimulation with different rPoIL-12 as described in Section 2. Commercial p40 subunit (com p40), commercial rPoIL-12 p70 (com p70), commercial rPoIL-12 (com rPoIL-12), and purified rPoIL-12 were compared with rHuIL-12 and media as positive and negative controls, respectively. Data points represent the mean 1 standard deviation of cpm from triplicate wells; (C) proliferation of porcine blasts produced with PHA and rHuIL-2. Blasts were stimulated with two-fold dilutions of different rPoIL-12. Data points represent the mean 1 standard deviation of cpm from triplicate wells.
140
G.I. Solano-Aguilar et al. / Veterinary Immunology and Immunopathology 89 (2002) 133–148
Fig. 3. Proliferation of porcine blasts. Porcine blast proliferation when cultured with two-fold-dilutions of homologous PMA/ConA supernatants (1:2–1:64). Addition of different dilutions of rPoIL-12 (SPV-278) (1:8000–1:512,000) did not have an effect in proliferation activity. Media and PHA supernatant derived from stimulated cells were used as negative and non-homologous supernatant controls, respectively. Bars represent the mean 1 standard deviation of cpm from triplicate wells.
concentrations of rPoIL-12 appear to have an inhibitory effect on proliferation derived from PMA/ConA supernatant (see supernatant dilution 1:2–1:8). Very low proliferation was seen when blasts were cultured with a non-homologous supernatant derived from PHA-stimulated PBMC. 3.2. mRNA levels of IL-12Rb2 subunit in bovine and porcine stimulated cells The aligned predicted amino acid sequences for the IL-12Rb2 receptor chain for swine (GenBank AF448143), human, bovine and mouse are shown in Fig. 4. The 11 amino acids in lower case at the 50 terminus and the two amino acids similarly shown at the 30 terminus reflect unconfirmed sequences due to binding sites of conserved human and mouse primer sequences used in the amplification process. Results indicate similarity indices of 84, 78 and 64% when comparing swine with bovine, human and mouse nucleotide sequences, respectively. The relative levels of IL-12Rb2 subunit mRNA were evaluated by RT-PCR in bovine and swine PBMC. Representative data from three different pigs and cows is summarized in Fig. 5A. Results indicated a small increase in
the relative mRNA levels between porcine PBMC (samples P1, P2 and P3) and corresponding porcine lymphoblasts (samples P4, P5 and P6) after mitogen stimulation. When the same comparison was performed on bovine PBMC (samples B1, B2 and B3) and their corresponding lymphoblasts (samples B4, B6 and B7) levels of the IL-12Rb2 mRNA could not be measured with the established cDNA amount and competitor level used (2.3 fg per lane) for analysis of porcine samples (Fig. 5B). Consequently, the cDNA competitor was increased to compensate for the higher levels of BoIL-12Rb2. As shown in Fig. 5C, when the amount of competitor was increased between 5–15 times (11.5, 23.0 or 34.5 fg per reaction), readable equivalent bands were detected for all bovine samples. An additional set of PBMC isolated from three cows and three pigs were cultured with PMA/ConA as described in Section 2 for real time PCR analysis. Bovine lymphoblasts from all cows have a higher mRNA levels as compared to porcine lymphoblasts (P ¼ 0:038). Bovine lymphoblasts exhibited an 11-fold increase in IL-12Rb2 mRNA levels. Porcine IL-12Rb2 mRNA remained low after stimulation. One of the three pigs showed a reduction in the receptor levels after stimulation while the other two showed almost no change (Fig. 6).
G.I. Solano-Aguilar et al. / Veterinary Immunology and Immunopathology 89 (2002) 133–148
141
Fig. 4. Alignment of IL-12Rb2 receptor chain. IL-12Rb2 sequences for swine (sw), bovine (bo), human (hu) and mouse (mu). Dots indicate similarity. Gaps are defined by dashes. Clustal W program.
3.3. mRNA levels of IL-12Rb2 subunit in porcine PBMC after in vivo injection of purified rPoIL-12 To examine IL-12Rb2 mRNA levels in young animals, 5-week-old piglets were injected i.m. with
purPoIL-12. The level of IL-12Rb2 mRNA in PBMC was compared over time (0–66 h). Results showed that there was an increase in IL-12Rb2 mRNA in PBMC (Fig. 7A). Increases also were observed when PBMC isolated from these IL-12-treated pigs were cultured in
142
G.I. Solano-Aguilar et al. / Veterinary Immunology and Immunopathology 89 (2002) 133–148
Fig. 5. Relative IL-12Rb2 mRNA levels in stimulated porcine and bovine PBMC. (A) IL-12Rb2 mRNA levels from swine PBMC and blasts produced after three day culture with PMA/ConA were compared by competitive RT-PCR. Signal ratios of cDNA to competitor are summarized; (B) representative samples of RT-PCR are shown (upper panel). It is specified when the signal (upper band) was relatively lower () than the established level of competitor (2.3 fg per lane). Amplification of HPRT from cDNA in the presence of the corresponding competitor molecule was used to normalize cDNA synthesis (lower panel) as described in Section 2; (C) IL-12Rb2 mRNA levels in bovine blasts. Three levels of competitor were used with every cDNA sample tested (11.5, 23 and 34.5 fg per reaction) and were substantially greater than that required for the analysis on swine blasts.
the presence of PMA/ConA for lymphoblast production (Fig. 7B). Conversely, there was no change in proliferation when lymphoblasts from these pigs were cultured for an additional 72 h in different dilutions of purPoIL12 (data not shown). IL-12Rb2 mRNA levels were not determined in ILN cells due to a limited cell yield.
3.4. Interferon gamma production in porcine cells As a functional correlate of IL-12Rb2 mRNA levels, IL-12 responsiveness was assessed in vitro by induction of IFN-g in PBMC stimulated with 0.5 ng/ml of rPoIL-12, and/or mitogens such as PMA/ConA for
G.I. Solano-Aguilar et al. / Veterinary Immunology and Immunopathology 89 (2002) 133–148
143
Fig. 6. IL-12Rb2 mRNA levels in porcine and bovine blasts after PMA/ConA treatment. IL-12Rb2 mRNA levels were compared among porcine and bovine blasts. Real time PCR analysis showed an 11-fold increase in the IL-12Rb2 mRNA levels in bovine blasts as compared to porcine blasts. Bars represent the mean 1 standard deviation of three animals.
Fig. 7. IL-12Rb2 mRNA levels in PBMC and blasts isolated from young pigs after IM administration of rPoIL-12. (A) IL-12Rb2 mRNA levels in swine PBMC were compared at 0, 8, 18, 24 and 66 h after IM treatment with purPoIL-12. Data points represent the mean 1 standard deviation of cDNA/competitor ratios from replicates; (B) blasts were produced from swine PBMC isolated at 0, 8 and 24 h after treatment. IL-12Rb2 mRNA levels were determined and expressed as the ratio cDNA/competitor.
144
G.I. Solano-Aguilar et al. / Veterinary Immunology and Immunopathology 89 (2002) 133–148
Fig. 8. IFN-g production by PBMC. Swine PBMC were stimulated with a PMA (100 or 50 ng), ConA (46 mg), or rPoIL-12 (500 fg). Elisa readings (OD-405) were performed 24 h after treatment. IFN-g production was calculated from a standard IFN-g curve. Bars represent the mean 1 standard deviation of duplicate wells.
24 h in culture media. Results indicated poor production of rPoIL-12 induced IFN-g compared to that from mitogens alone (Fig. 8). Additional observations from in vivo experiments demonstrated that the number of specific IFN-g producing cells detected by Elispot was reduced in peripheral blood as early as 8 h after a single i.m. injection in the left hind leg with 23 mg of
rPoIL-12 (2.0 mg/kg body weight) diluted in sterile PBS (205 versus 103) (P ¼ 0:031) (data not shown). After 24 h of rPoIL-12 treatment, there was a significant reduction (P ¼ 0:034) in the number of IFN-g producing cells in the periphery (Fig. 9). When the number of specific IFN-g producing cells was measured in lymphocyte populations isolated from the left
Fig. 9. IFN-g producing cells. Lymphoid cells were isolated from peripheral blood and ILN from young pigs after IM treatment with 23 mg of purPoIL-12 in the left hind leg and an equivalent volume of PBS in the right hind leg. Bars represent the mean 1 standard deviation of three animals.
G.I. Solano-Aguilar et al. / Veterinary Immunology and Immunopathology 89 (2002) 133–148
and right inguinal draining lymph nodes of three pigs, a significant reduction in IFN-g (P ¼ 0:032) producing cells was seen in lymphocytes isolated and cultured from the draining left ILN (treated side) relative to the right ILN (Fig. 9).
4. Discussion The cytokine IL-12 manifests its biological activity via interactions with the high affinity IL-12 receptor complex present on activated T cells and NK cells. The high affinity receptor complex includes the induced IL-12Rb2 chain in conjunction with the constitutively produced low affinity IL-12Rb1 chain (Trinchieri and Scott, 1995). Expression of IL-12Rb2 may be affected by heterodimeric p70 IL-12 which has been shown to maintain IL-12Rb2 expression (Szabo et al., 1997), while the homodimeric p40 IL-12 have been shown to antagonize the binding of the IL-12 p70 to the IL-12Rb2 or decrease its binding (Gately et al., 1996; Presky et al., 1998). The similar responses in bioactivity found in both species for all recombinant IL-12 (including our purified product) demonstrated that the presence of the p40 subunit (40 kDa) or the p40 homodimer (80 kDa) as evidenced by immunoblot (Fig. 1) did not interfere with the active heterodimer (70 or 75 kDa) or reduced its activity. Repeated experiments have consistently demonstrated that despite the increase in proliferation in bovine activated cells with the different rPoIL-12 available, the addition of the same rPoIL-12 products in the pig did little in the way of proliferative responses (Fig. 2A versus B) or IFN-g production using peripheral lymphoid cells or lymphoid cells from ILN (Figs. 8 and 9). To date, there are limited published reports that examine the effects of IL-12 in the immune response of swine. One study (Cho et al., 1996) that examined the effects of rHuIL-12 and rMuIL-12 on cultured porcine PBMC, demonstrated a significant enhancement of NK cytotoxicity and TNF-a production; however, neither the production of IFN-g nor cell proliferation was directly evaluated. In another study, Foss et al. (1999), generated a single chain porcine IL12 construct (scpIL-12) and showed it to immunoregulate IL-2 pretreated human cells by inducing proliferation of lymphoblasts. In this same study, the authors clearly noted that under the same experimental
145
conditions the magnitude of the proliferation in porcine system was limited and substantially lower than that induced in the heterologous human system. In the present in vitro experiments, the ability of porcine lymphoblasts to proliferate in response to filtered supernatants from PMA/ConA stimulated cells was demonstrated, eliminating the possibility that the unresponsiveness of porcine lymphoblasts to rPoIL-12 treatment was due to isolation or culture procedures. Both, the rPoIL-12 and the two commercially available rPoIL-12 and rHuIL-12 were bioactive on bovine lymphoblasts suggesting that porcine cells (resting or previously activated with mitogens) are low responders to IL-12 stimulus. One possible explanation for the low proliferative response may be a low level of IL-12Rb2 expression. This hypothesis was supported by the molecular data generated herein which demonstrates that when resting lymphoid cells are stimulated, a relatively higher level of IL-12Rb2 mRNA is observed in bovine lymphoblasts (Fig. 5A). Furthermore, the high proliferative response after restimulation with IL-12 was only detected in bovine lymphoblasts. Additional data generated by real time PCR indicated that bovine blasts contained 11 more IL-12Rb2 mRNA relative to the porcine blasts after stimulation. It has been demonstrated that the priming of NK cells with IL-2 before treatment with IL-12 leads to elevated expression of the IL-12R enhancing the response to IL-12 treatment (Wu et al., 2000). The limited enhancement of in vitro proliferation when swine lymphoblasts were produced in the presence of rHuIL-2 (2–4-fold increase) may be explained by a possible increase in IL-12R in NK cells as previously reported in other species. Nonetheless, the data generated from these experiments suggest that IL-12R expression may be more restricted in porcine or may require unique elements within the regulatory pathway of IL-12 in swine. By extrapolating from other models, and based upon indirect evidence from porcine viral infectious models, (Zuckermann et al., 1998), conventional wisdom indicates that IFN-g influences the effects of IL-12 through regulation of its receptor expression. Some studies (Rogge et al., 1997; Szabo et al., 1997) have reported that the expression of IL-12Rb2 mRNA levels in human and mouse cells is differentially regulated by IFN-g and IFN-a, respectively, by enhancing IL-12Rb2 levels on CD4þ and CD8þ T cells.
146
G.I. Solano-Aguilar et al. / Veterinary Immunology and Immunopathology 89 (2002) 133–148
In human T and NK cells, this enhancing effect was demonstrated to be independent of endogenous IL-12 (Chang et al., 2000). A similar phenomenon may account for IL-12 induced IFN-g production on lymphoid cells isolated from a highly antigen-exposed site such as MLN as reported on a previous porcine study (Foss et al., 1999). The ability of IL-12 to induce IFN-g has been implicated as an important factor leading in the elimination of intracellular pathogens in humans and mice (Heinzel et al., 1993; Gazzinelli et al., 1993; Trinchieri and Scott, 1999), and as a potent IFN-g inducer in these and other species. In bovine, for example, increased production of IFN-g was observed in PBMC after the addition of IL-12 in the absence of antigen, or in combination with different antigens (Collins et al., 1998, 1999). In vivo experimentation in swine has demonstrated that T-lymphocytes producing IFN-g in response to IL-12 treatment may be important in improving the immune response against certain viral infections. Zuckermann et al. (1998) showed that in the Pseudorabies virus (PRV) infection model in swine after homologous challenge, the injection of rHuIL-12 alone does not stimulate a PRV-specific immunity. However, its use as an adjuvant in combination with an inactivated PRV vaccine enhanced the strength of the cellular immune response over that induced by the inactivated vaccine alone. This increase in cellmediated immunity was evidenced by an elevation in the frequency of virus-specific IFN-g secreting cells, and by protective immunity clinically manifested by positive weight differences in the group where rHuIL-12 was used as an adjuvant. In another study (Vandenbroeck et al., 1998), the addition of IFN-g to an inactivated SHV-1 vaccine (Suid herpesvirus-1 phylaxia strain) enhanced the measurable virus neutralizing antibodies and increased the retained average net body mass only in animals covaccinated with IFN-g. This enhancement of antiviral effects by IFN-g alone was demonstrated for other swine pathogens as well including, vesicular stomatitis virus (Charley et al., 1988), and porcine reproductive and respiratory syndrome virus (PRRSv) (Bautista and Molitor, 1999). Taken together, these results suggests that the enhanced effect of IL-12 reported in swine only when it is used as an adjuvant, may be dependent on the level of IFN-g induced after viral exposure. IFN-g may increase the responsiveness
to IL-12 treatment, by inducing the expression of IL-12Rb2 as has been described for other species (Rogge et al., 1997; Szabo et al., 1997). Additional controlled studies using animals where no viral exposure is present and different variables such as age and different lymphoid subsets are considered should validate this hypothesis. Data generated in vitro from our experiments show that the treatment of IL-12 on lymphoid cells isolated from young animals that have not been exposed to viral antigens, induced a reduction in the levels of IFN-g mRNA. Similarly, in vivo IL-12 treatment also reduced the number of IFN-g producing cells in lymphoid cells isolated from inguinal lymph nodes. These results suggest that in porcine, the expression of IFN-g may be negatively affected when elevated levels of IL-12 are present. Additional experiments should test if this inhibitory effect is maintained when lower doses of IL-12 are used. Alternatively, as suggested by Domeika et al. (2002), other cytokines, such as IL-18, may be needed to induce appropriate IFN-g production on porcine cells.
5. Conclusion In conclusion, our results show that in pig, rPoIL-12 alone was a poor inducer of proliferation or IFN-g production in PBMC. The in vitro and vivo experiments showed little change in lymphocyte proliferation and a decrease in the number of IFN-g producing lymphocytes in ILN after i.m. administration of rPoIL12. Clearly, additional experiments are needed to elucidate differences in responses among lymphocyte populations from different reactive immunological sites (i.e. mesenteric lymph nodes, Peyer Patches, tonsils, etc.). An alternate mechanism or second stimulus, i.e. cytokine acting synergistically with IL-12, may be necessary to invoke both proliferation of naı¨ve porcine lymphoid cells and production of IFN-g to substantially see an improvement in immune responses and protection against diseases.
Acknowledgements The research work was supported by Biotechnology Research Development Corporation (BRDC) project
G.I. Solano-Aguilar et al. / Veterinary Immunology and Immunopathology 89 (2002) 133–148
35-7-537. The authors acknowledge Tonya Ledbetter for her technical support with RNA quantification. References Bautista, E.M., Molitor, T., 1999. IFN-g inhibits porcine reproductive and respiratory syndrome virus replication in macrophages. Arch. Virol. 144, 1–10. Canals, A., Gasbarre, L.C., Boyd, P.C., Almeria, S., Zarlenga, D.S., 1997. Cloning and expression of bovine interleukin-15: analysis and modulation of transcription by exogenous stimulation. J. Interferon Cytokine Res. 17, 473–480. Chang, J.T., Segal, B., Nakanishi, K., Okamura, H., Shevach, E.M., 2000. The costimulatory effect of IL-18 on the induction of antigen-specific IFN-g production by resting T cells is IL-12 dependent and is mediated by up-regulation of the IL-12 receptor b2 subunit. Eur. J. Immunol. 30, 1113–1119. Charley, B., McCullough, K., Martinod, S., 1988. Antiviral and antigenic properties of recombinant interferon gamma. Vet. Immunol. Immunopathol. 19, 95–103. Cho, D., Lee, W., Halloran, P., Trinchieri, G., Kim, Y., 1996. Enhancement of porcine natural killer cell activity by recombinant human and murine IL-12. Cell. Immunol. 172, 29–34. Collins, R.A., Camon, E.B., Chaplin, P.J., Howard, C.J., 1998. Influence of IL-12 on interferon-g production by bovine leucocyte subsets in response to bovine respiratory syncitial virus. Vet. Immunol. Immunopathol. 63, 69–72. Collins, R.A., Howard, C.J., Duggan, S.E., Werling, D., 1999. Bovine interleukin-12 and modulation of IFN-g production. Vet. Immunol. Immunopathol. 68, 193–207. Domeika, K., Berg, M., Eloranta, M.L., Alm, G.V., 2002. Porcine interleukin-12 fusion protein and interleukin-18 in combination induce interferon-gamma production in porcine natural killer cells and T cells. Vet. Immunol. Immunopahol. 86, 11–21. Foss, D.L., Moody, M.D., Murphy, K.P., Pazmany, C., Zilliox, M.J., Murtaugh, M.P., 1999. In vitro and in vivo bioactivity of single chain interleukin-12. Scand. J. Immunol. 50, 596–604. Gately, M.K., Chizzonite, R., 1992. Measurement of human and mouse interleukin-12. In: Coligan, J.E., Kruisbeek, A.M., Margulies, H.E., Shevach, E.M., Strober, W. (Eds.), Current Protocols in Immunology. Wiley, New York, pp. 6.16.1–5. Gately, M.K., Carvajal, D.M., Connaughton, S.E., Gillessen, S., Warrier, R.R., Kolinsky, K.D., Wilkinson, V.L., Dwyer, C.M., Higgins Jr., G.F., Podlaski, F.J., Faherty, D.A., Familletti, P.C., Stren, A.S., Presky, D.H., 1996. Interleukin-12 antagonist activity of mouse interleukin-12 p40 homodimer in vitro and in vivo. Ann. NY Acad. Sci. 795, 1–12. Gately, M.K., Renzetti, L.M., Magram, J., Stern, A.S., Adorini, L., Gubler, U., Presky, D.H., 1998. The interleukin-12/interleukin12 receptor system: role in normal and pathologic immune response. Annu. Rev. Immunol. 16, 495–521. Gazzinelli, R.T., Hieny, S., Wynn, T.A., Wolf, S., Sher, A., 1993. IL-12 is required for the T-lymphocyte independent induction of interferon-gamma by an intracellular parasite and induces
147
resistance in T cell-deficient hosts. Proc. Natl. Acad. Sci. U.S.A. 90, 6115–6119. Heinzel, F.P., Schoenhaut, D.S., Rerko, R.M., Rosser, L.E., Gately, M.K., 1993. Recombinant interleukin-12 cures mice infected with Leishmania major. J. Exp. Med. 177, 1505–1509. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real time quantitative PCR and the 2DDCT method. Methods 25, 402–408. Mateu de Antonio, E., Husmann, R.J., Hansen, R., Lunney, J.K., Strom, D., Martin, S., Zuckermann, F.A., 1998. Quantitative detection of porcine interferon-gamma in response to mitogen superantigen and recall viral antigen. Vet. Immunol. Immunopathol. 27, 265–277. Morris, S.C., Madden, K.B., Adamovicz, J.J., Gause, W.C., Hubbard, B.R., Gately, M.K., Finkelman, F.D., 1994. Effects of IL-12 on in vivo cytokine gene expression and Ig isotype selection. J. Immunol. 152, 1047–1056. Presky, D.H., Yang, H., Minetti, L.J., Chua, A.O., Nabavi, N., Wu, C.Y., Gately, M.K., Gubler, U., 1996. A functional interleukin12 receptor is composed of two b-type cytokine receptor subunits. Proc. Natl. Acad. Sci. U.S.A. 93, 14002–14007. Presky, D.H., Minetti, L.J., Gillessen, S., Wilkinson, V.L., Wu, C.Y., Gubler, U., Chizzonite, R., Gately, M.K., 1998. Analysis of the multiple interactions between IL-12 and the high affinity IL-12 receptor complex. J. Immunol. 160, 2174–2179. Rogge, L., Barberis Maino, L., Biffi, M., Passini, N., Presky, D.H., Gubler, U., Sinigaglia, F., 1997. Selective expression of an interleukin-12 receptor component by human T helper 1 cells. J. Exp. Med. 185, 825–831. Solano-Aguilar, G.I., Vengroski, K., Beshah, E., Lunney, J.K., 2000. Isolation and purification of lymphocyte subsets from gut associated lymphoid tissue in neonatal swine. J. Immun. Meth. 241, 185–199. Solano-Aguilar, G.I., Beshah, E., Vengroski, K.G., Zarlenga, D., Jauregui, L., Cosio, M., Douglass, L.W., Dubey, J.P., Lunney, J.K., 2001. Cytokine and lymphocyte profile after Toxoplasma gondii infection in miniature swine. Int. J. Parasitol. 31, 187–195. Szabo, S., Dighe, A.S., Gubler, U., Murphy, K.M., 1997. Regulation of the interleukin IL-12Rb2 subunit expression in developing T helper 1 (Th1) and Th2 cells. J. Exp. Med. 185, 817–824. Thompson, J.D., Higgins, D.G., Gibson, T.G., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucl. Acids Res. 22, 4673– 4680. Towbin, H.T., Staehelin, Gordon, J., 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. U.S.A. 76, 4350–4354. Trinchieri, G., 1995. Interleukin-12: a proinflammatory cytokine with immunoregulatory functions that bridge innate resistance and antigen specific adaptive immunity. Ann. Rev. Immunol. 13, 251–276. Trinchieri, G., Scott, P., 1995. Interleukin-12: a proinflammatory cytokine wiyh immunoregulatory functions. Res. Immunol. 146, 423–431.
148
G.I. Solano-Aguilar et al. / Veterinary Immunology and Immunopathology 89 (2002) 133–148
Trinchieri, G., Scott, P., 1999. Interleukin-12: basic principles and clinical applications. Curr. Top. Microbiol. Immunol. 238, 57–78. Vandenbroeck, K., Nauwynck, H., Vanderpooten, A., Van Reeth, K., Goddeeris, B., Billiau, A., 1998. Recombinant porcine IFNg potentiates the secondary IgG and IgA responses to an inactivated Suid Herpesvirus-1 Vaccine and reduces postchallenge weight loss and fever in pigs. J. Interferon Cytokine Res. 18, 739–744. Wu, C.Y., Gadina, M., Wang, K., O’Shea, J., Seder, R.A., 2000. Cytokine regulation of IL-12 receptor b2 expression: differential effects on human T and NK cells. Eur. J. Immunol. 30, 1364–1374.
Zarlenga, D.S., Canals, A., Aschenbrenner, R.A., Gasbarre, L.C., 1995a. Enzymatic amplification and molecular cloning of cDNA encoding the small and large subunits of bovine interleukin-12. Biochem. Biophys. Acta 1270, 215–217. Zarlenga, D.S., Canals, A., Gasbarre, L.C., 1995b. Methods for constructing internal standards for use in competitive PCR. Biotechniques 19, 324–326. Zuckermann, F.A., Hussmann, R., Brandt, J., Mateu de Antonio, E., Martin, S., 1998. Interleukin-12 enhances the virus specific interferon gamma response of pigs to an inactivated Pseudorabies virus vaccine. Vet. Immun. Immunopathol. 63, 57–67.
