LAPTM4B facilitates late endosomal ceramide export to control cell death pathways

article published online: 17 August 2015 | doi: 10.1038/nchembio.1889

LAPTM4B facilitates late endosomal ceramide export to control cell death pathways

© 2015 Nature America, Inc. All rights reserved.

Tomas Blom1,2*, Shiqian Li1,2, Andrea Dichlberger1,2, Nils Bäck1, Young Ah Kim3, Ursula Loizides-Mangold4, Howard Riezman4, Robert Bittman3 & Elina Ikonen1,2* Lysosome-associated protein transmembrane-4b (LAPTM4B) associates with poor prognosis in several cancers, but its physio­ logical function is not well understood. Here we use novel ceramide probes to provide evidence that LAPTM4B interacts with ceramide and facilitates its removal from late endosomal organelles (LEs). This lowers LE ceramide in parallel with and independent of acid ceramidase–dependent catabolism. In LAPTM4B-silenced cells, LE sphingolipid accumulation is accompanied by lysosomal membrane destabilization. However, these cells resist ceramide-driven caspase-3 activation and apoptosis induced by chemotherapeutic agents or gene silencing. Conversely, LAPTM4B overexpression reduces LE ceramide and stabilizes lysosomes but sensitizes to drug-induced caspase-3 activation. Together, these data uncover a cellular ceramide export route from LEs and identify LAPTM4B as its regulator. By compartmentalizing ceramide, LAPTM4B controls key sphingolipidmediated cell death mechanisms and emerges as a candidate for sphingolipid-targeting cancer therapies.

I

n mammalian cells, sphingomyelin (SM) is the most abundant sphingolipid and a reservoir for generating the second messenger ceramide. The LEs are a major site for sphingolipid catabolism. In LEs, ceramide can be generated by acid sphingomyelinase (SMPD1) hydrolyzing SM on the intraluminal vesicles (ILVs) of multivesicular bodies (MVBs)1,2. Ceramide can be further degraded by acid ceramidase (ASAH1), releasing a fatty acid and sphingosine, the final breakdown products in LE sphingolipid catabolism. The mechanism by which sphingosine exits LEs is not fully understood3–5. However, sphingosine can enter the salvage pathway to be used as a building block for the regeneration of SM. In this pathway, sphingosine is initially converted to ceramide in the endoplasmic reticulum (ER). The formed ceramide can then be transferred by ceramide transfer protein (CERT) to the trans-Golgi, where it is used as a substrate for SM synthesis6. The sphingolipid metabolic pathways are attracting increasing attention as targets for anticancer strategies7–9. Ceramide is a strong tumor suppressor with proapoptotic properties, and several commonly used chemotherapeutics induce cell death in a ceramidedependent fashion10,11. Cancer cells often downregulate SMPD1 to reduce their ceramide content and increase chemotherapy resistance12. Consequently, SM may accumulate in LEs, leading to lysosomal destabilization13,14. Because of this, SMPD1 manipulation and lysosomal membrane permeabilization (LMP) are being explored as means to kill chemotherapy-resistant cancer cells15,16. Importantly, both the subcellular localization and the abundance of ceramide are relevant. In particular, ceramide and its metabolites at ER– mitochondrial membrane contact sites promote mitochondrial outer membrane permeabilization, cytochrome C release and caspasedependent apoptosis17–19. Accordingly, ceramide retention in the ER by inhibition of CERT can sensitize cells to chemotherapeutics20. LAPTM4B belongs to the membrane-spanning lysosomal LAPTM family of proteins and is aberrantly expressed in several common cancers21–25. LAPTM4A, the first member of the LAPTM protein family to be described, was characterized as a nucleoside transporter26 and later found to confer multidrug resistance by

modulating drug compartmentalization27,28. Similarly, LAPTM4B has been reported to affect the subcellular distribution of cytotoxic drugs23,29, but endogenous substrates for LAPTM4B-mediated transport have not been identified. High LAPTM4B expression is associated with resistance to anthracyclines, possibly promoting cytosolic retention of the drugs and thereby reducing DNA damage23. LAPTM4B has also been reported to stimulate the efflux of chemotherapeutic compounds from cells through the P-glycoprotein efflux pump29 and to promote lysosomal membrane stability21. However, in a large survey of four patient data sets, low expression of LAPTM4B was strongly associated with chemotherapy resistance25. Very recently, LAPTM4B was found to regulate epidermal growth factor receptor signaling by acting on its lysosomal sorting and degradation30 and autophagy initiation31. Thus, LAPTM4B appears to be relevant for cancer progression by several mechanisms, and high or low LAPTM4B expression may confer a poor anticancer drug response. We recently developed a strategy to follow LE SM catabolism and recycling by tracking the metabolism of 3H-labeled SM targeted to the LE in low-density lipoprotein (LDL) particles5. Using this assay, we conducted a small interfering RNA (siRNA) screen to find proteins that facilitate the removal of SM degradation products from the LE. LAPTM4B was identified as the best hit in this screen. Here we provide evidence that LAPTM4B binds ceramide and that the amount of LAPTM4B in the LE membrane is a major determinant of intra-endosomal sphingolipid content and thereby affects LE membrane stability. Moreover, LAPTM4B acts as a gatekeeper between intra- and extra-endosomal ceramide pools, modulating apoptosis sensitivity. Thus, by regulating the subcellular compartmentalization of ceramide, LAPTM4B controls key sphingolipidmediated cell death mechanisms that are highly relevant in cancer.

RESULTS LAPTM4B deficiency causes cellular ceramide accumulation

To identify regulators of LE sphingolipid export, we screened 19 candidate membrane-spanning LE proteins (annotated by

Department of Anatomy, Faculty of Medicine, University of Helsinki, Helsinki, Finland. 2Minerva Foundation Institute for Medical Research, Helsinki, Finland. 3Department of Chemistry and Biochemistry, Queens College, City University of New York, Flushing, New York, USA. 4Department of Biochemistry, University of Geneva, CH-1211 Geneva 4, Switzerland. *e-mail: [email protected] or [email protected] 1

nature CHEMICAL BIOLOGY | Advance online publication | www.nature.com/naturechemicalbiology

1

article 3 [ H]-Cer

Pulse

b 5.0

*

2,000

Pulse

Chase

LAPTM4B

siRNA

Ctrl

1,000

Chase

d C16-ceramide

OH

Control siRNA

OH

12 HN

14

3.0

1.0

*

LAPTM4B

CPM/mg

3,000

4.0

2.0

*

4,000

0

LAPTM4B

LAPTM4B

Pulse

Ctrl

1,000

c

Control siRNA LAPTM4B siRNA

*

2,000

siRNA

Chase

5,000

3,000

0

Ceramides

6.0 Phosphate (pmol/nmol)

Ctrl

siRNA

LAPTM4B

10,000

*

4,000

Ctrl

*

20,000

0

F

LAPTM4B siRNA

*

F

*

B

O N

OH

Ceramide-BODIPY

N

OH

Silencing of LAPTM4B resulted in enlarged lysosomes, higher numbers of lysosomes and multivesicular body (MVB)-lysosome hybrid organelles and concentric multilamellar structures characteristic of lipidoses32 (Fig. 1c and Supplementary Fig. 2). SM metabolism outside LEs did not appear to be affected, as we observed no alterations in de novo SM synthesis (Supplementary Fig. 3a), SM synthase activity in vitro (Supplementary Fig. 3b) or salvage of sphingosine to ceramide and SM (Supplementary Fig. 3c). Moreover, there was no LE cholesterol accumulation, as assessed by filipin staining upon LAPTM4B depletion, suggesting that there is not a general lipid export block from LE (Supplementary Fig. 3d).

Ceramide accumulation in LEs

To visualize ceramide trafficking in living cells, we used the fluorescent analog ceramideC16 C18 C20 C22 C24 O BODIPY, which we previously established33 e f siRNA Ctrl (Fig. 1d). When introduced into cells via LAPTM4B LAPTM4B Ctrl LDL particles (here referred to as ceramide0h 1h 3h 5h 0h 1h 3h 5h BODIPY/LDL), this probe is metabolized in * 1.5 * a manner similar to that of radiolabeled cer* * * amide (Supplementary Fig. 4a,b), suggest* 1 ing that it can be used as a reporter for LE 0.5 ceramide trafficking. Using this approach, we found that LAPTM4B-depleted cells retained 0 ceramide-BODIPY/LDL–derived fluorescence 0 1 2 3 4 5 in dextran-labeled LEs to a higher extent than Chase time (h) did cells treated with control siRNA (Fig. 1e,f and Supplementary Fig. 5). Figure 1 | LAPTM4B deficiency causes ceramide accumulation. (a) A431 cells treated with We therefore investigated the metabolic control or LAPTM4B siRNAs were pulsed with [3H]-SM/LDL for 1 h and harvested directly after fate of ceramide-BODIPY/LDL in control the pulse or after a 1-h chase. Lipid metabolites were separated by high-performance TLC and and LAPTM4B-depleted cells. In control cells, analyzed by scintillation counting (n = 5; error bar, mean ± s.e.m.; *P < 0.05, t-test). CPM, counts ceramide-BODIPY was rapidly metabolized per minute. (b) Quantification of cellular ceramides in control or LAPTM4B-depleted cells by MS to sphingosine-BODIPY and SM-BODIPY, (n = 3). x axis indicates fatty acyl chain length. Error bars, mean ± s.e.m.; *P < 0.05, t-test. (c) EM the latter becoming the major metabolite analysis of LE compartments in control and LAPTM4B-depleted cells. White arrowhead indicates after 5 h of chase (Supplementary Fig. 4c). In a lysosome; black arrowhead indicates an MVB-lysosome hybrid organelle. Scale bar, 1 μm. LAPTM4B-depleted cells, a smaller fraction (d) Structures of a natural ceramide and the fluorescent ceramide-BODIPY. (e) LEs of A431 cells of the probe was converted to SM-BODIPY labeled with rhodamine-dextran overnight. Following a 1-h pulse with ceramide-BODIPY/LDL, (Supplementary Fig. 4c), indicating a defect the trafficking of fluorescent ceramide (Cer-BPY) was analyzed by confocal microscopy at the in LE sphingolipid salvage. Moreover, we indicated chase times. Scale bar, 10 μm. (f) Ceramide-BODIPY/LDL derived fluorescence intensity observed an accumulation of ceramide(AU) in dextran-labeled LEs of cells treated as in e. n = 15 images per time point and ≥10 cells BODIPY followed by sphingosine-BODIPY per image. Error bars, mean ± s.e.m.; *P < 0.05, t-test. Ctrl, control. at later time points of chase (Fig. 2a and Supplementary Figs. 4c–e and 6). This sugGene Ontology to lysosome membrane and lipid transporter gests that the accumulating ceramide-BODIPY is accessible to subcategories) in human epidermoid carcinoma (A431) cells by ASAH1. To test this, we knocked down ASAH1 alone or in combisiRNA-mediated silencing, using [3H]-SM in complex with LDL nation with LAPTM4B. We found that siRNA-mediated depletion particles ([3H]-SM/LDL) as a probe. The SM was labeled with 3H of LAPTM4B or ASAH1 caused an accumulation of ceramidein the C3 position of the sphingosine backbone, allowing it to be BODIPY and that this phenotype was exacerbated by depletion traced throughout all sphingolipid metabolic steps5. Cells depleted of both proteins (Fig. 2a). Notably, the gradual build-up of of LAPTM4B displayed the highest accumulation of the [3H]-SM sphingosine-BODIPY observed in LAPTM4B-depleted cells metabolites [3H]-ceramide and [3H]-sphingosine (Fig. 1a). Of note, was abrogated by ASAH1 co-depletion (Fig. 2a), suggesting that the LAPTM4B transcript was eight-fold more abundant in A431 the accumulation of ceramide-BODIPY takes place in ASAH1cells than in primary human fibroblasts (Supplementary Table 1). containing compartments. By quantifying total cellular sphingolipids using mass spectromTo compare the effects of LAPTM4B and ASAH1 silencing on etry, we found that ceramides accumulated in LAPTM4B-silenced the trafficking of the ceramide-BODIPY/LDL-derived fluorescells compared to controls, and that all ceramide species detected cence, we scored its time-dependent colocalization with dextranwere increased (Fig. 1b), whereas the amounts of sphingoid labeled LE. Again, LAPTM4B-depleted cells displayed a significant bases, SMs and glycosylceramides were not significantly altered retention of BODIPY fluorescence in the LE (Fig. 2b,c). Notably, (Supplementary Fig. 1a). The ceramide accumulation phenotype silencing of ASAH1 (>80% depletion at the mRNA level) alone was confirmed with an additional siRNA targeting a different region did not have a significant effect on BODIPY accumulation in LEs of the LAPTM4B mRNA (Supplementary Fig. 1b). (Fig. 2b,c), suggesting that acid hydrolysis of fluorescent ceramide to 2

8

HN

14

BODIPY intensity in dextran compartment (AU)

Overlay

Dextran

Cer-BPY

0

© 2015 Nature America, Inc. All rights reserved.

CPM/mg

30,000

Ctrl

CPM/mg

5,000

3 [ H]-Sph

Ctrl

[3H]-SM 40,000

LAPTM4B

a

Nature chemical biology doi: 10.1038/nchembio.1889

nature chemical biology | Advance online publication | www.nature.com/naturechemicalbiology

article

Nature chemical biology doi: 10.1038/nchembio.1889 a

1-h pulse

3 Fold of ctrl

1-h pulse

Sph-BODIPY SM-BODIPY

*

2

these findings suggest that LAPTM4B facilitates ceramide exit from LEs and that this pathway operates in parallel with ASAH1mediated ceramide removal by degradation.

Sph-BODIPY

4

*

3

*

*

2

1

1

0

0 *

6

Suppression of ceramide accumulation

4 3 2 1 0

LAPTM4B

LAPTM4B + ASAH1

LAPTM4B

ASAH1 + LAPTM4B

Ctrl

ASAH1

LAPTM4B + ASAH1

*

BODIPY intensity in dextran compartment (AU)

Ctrl

LAPTM4B

*

4

ASAH1

Fold of ctrl

1-h pulse + 1-h chase

Cer-BODIPY

ASAH1

Ctrl

nmol/mg protein

Dextran

Cer-BODIPY/LDL

siRNA

1-h pulse + 1-h chase

We next addressed whether overexpression of LAPTM4B can lower cellular ceramide Sph-BODIPY 2 levels. For this purpose, we generated a stable SM-BODIPY cell line expressing siRNA-resistant LAPTM4B0 Cherry (LAPTM4B-Ch). As a control, we used siRNA Ctrl + – – – a stable cell line expressing CD63-Cherry ASAH1 – + – + LAPTM4B – – + + (CD63-Ch), as CD63 depletion does not affect the cellular metabolism of [3H]-SM/LDL (data not shown). The LAPTM4B-Ch cells had Ctrl 18-fold higher LAPTM4B mRNA levels than b c LAPTM4B siRNA did CD63-Ch cells, as assessed by quantitaASAH1 ASAH1 + tive PCR (data not shown). LAPTM4B-Cherry LAPTM4B + ASAH1 Ctrl ASAH1 LAPTM4B LAPTM4B colocalized extensively with CD63 in A431 cells 3 * *# * # (Fig. 3a), similarly as in other cells32. Notably, *# # 2 * LAPTM4B-Ch cells had a reduced ceramide * content compared to CD63-Ch cells (Fig. 3b 1 and Supplementary Fig. 7). Furthermore, siRNA-mediated knockdown of endogenous 0 0 1 2 3 4 5 LAPTM4B caused a substantial increase in Chase time (h) the cellular ceramide content in control cells, Ceramide but not in LAPTM4B-Ch cells (Fig. 3b). Upon d 0.7 * simultaneous knockdown of endogenous 0.6 * LAPTM4B and ASAH1, the ceramide con0.5 * 0.4 tent in CD63-Ch cells was increased, whereas 0.3 this effect was blunted in the LAPTM4B-Ch 0.2 0.1 cells expressing siRNA-resistant LAPTM4B 0 (Fig. 3b). These results indicate that high siRNA LAPTM4B protein levels can lower cellular ceramide content. In addition, they confirm that the cellular ceramide accumulation observed upon LAPTM4B silencing is not Figure 2 | LAPTM4B-depleted cells accumulate ceramide in LEs. (a) Metabolism of an siRNA off-target effect. LDL-derived ceramide-BODIPY analyzed by high-performance TLC (HPTLC) from A431 cells We next tested whether overexpression treated with the indicated siRNAs. Left, representative HPTLC, right, quantification of of LAPTM4B alleviates the ceramide accuceramide-BODIPY metabolites (n = 3 experiments; error bar, mean ± s.e.m.; *P < 0.05, mulation in fibroblasts from patients with Holm’s test). (b) A431 cells were treated with the indicated siRNAs and LE labeled with Farber’s disease (an inherited ASAH1 defirhodamine-dextran. After a pulse with ceramide-BODIPY/LDL for 1 h, the trafficking of fluorescent ciency). These patient fibroblasts sequestered ceramide was analyzed by confocal microscopy. Images are from 3-h chase. Scale bar, 10 μm. ceramide-BODIPY/LDL in the LE (Fig. 3c,d) (c) Time-dependent localization of ceramide-BODIPY/LDL in the LE of cells treated as in b. y-axis and metabolized the probe less efficiently than shows mean BODIPY fluorescence intensity (AU) in the dextran-labeled LE organelles (n = 6 control fibroblasts (Fig. 3e and Supplementary images per time point and ≥10 cells per image; *P < 0.05, control versus LAPTM4B siRNA–treated Fig. 8), indicating that ceramide-BODIPY cells; #P < 0.05, LAPTM4B versus LAPTM4B + ASAH1 siRNA–treated cells). (d) Cellular ceramide accumulated in the LEs of the patient cells. levels analyzed by HPTLC from A431 cells treated with the indicated siRNAs (n = 5). Error bars, Lentiviral LAPTM4B-Cherry overexpression mean ± s.e.m.; *P < 0.05, Holm’s test. Ctrl, control. significantly reduced the ceramide content in patient fibroblasts (Fig. 3f and Supplementary sphingosine is not a major pathway for its export from LEs in these Fig. 9). These data strengthen the idea that LAPTM4B can provide cells. This may also apply to natural ceramide, as we have observed an alternative mechanism to ASAH1-mediated breakdown for that the recycling of LE-targeted [3H]-ceramide was not blocked clearing LE ceramide. in A431 cells depleted of ASAH1 (ref. 5). In cells depleted of both ASAH1 and LAPTM4B, BODIPY accumulation was initially simi- LAPTM4B interacts with ceramide lar to that in cells depleted of LAPTM4B alone. However, at longer To address the intra-endosomal localization of LAPTM4B by chase times, BODIPY fluorescence in the dextran compartment immuno-EM, we generated stable A431 cell lines expressing Flagslowly decreased in LAPTM4B-depleted cells, whereas it remained tagged LAPTM4B (LAPTM4B-Flag) or CD63-Flag. Immunogold high for the entire 5-h chase in cells depleted of both ASAH1 labeling of the Flag-tagged proteins showed that CD63 and and LAPTM4B (Fig. 2c). This implies that ASAH1 contributes to LAPTM4B were similarly distributed in MVBs, with ~25% of the ceramide-BODIPY degradation if LAPTM4B is not functional. label in the delimiting membrane and ~75% in the ILVs (Fig. 4a) The endogenous ceramide levels of LAPTM4B- and/or ASAH1- (n = 49 CD63-positive and 38 LAPTM4B-positive structures). silenced cells mirrored these results; knockdown of either protein We then used cells expressing CD63-Flag and LAPTM4B-Flag caused similar increases in cellular ceramide, and depletion of both for ceramide-binding experiments, employing the Flag epitope had an additive effect on ceramide accumulation (Fig. 2d). Together, for pulldown. To this end, we synthesized and characterized a

Overlay

© 2015 Nature America, Inc. All rights reserved.

Cer-BODIPY

Cer-BODIPY

nature CHEMICAL BIOLOGY | Advance online publication | www.nature.com/naturechemicalbiology

3

article a

Nature chemical biology doi: 10.1038/nchembio.1889 LAPTM4B-Ch

b

Merge

Ceramide (nmol/mg protein)

CD63-EGFP

1.4

CD63-Ch o.e.

1.2

LAPTM4B-Ch o.e.

*

1 0.8 0.6 0.4

*

*

*

0.2

siRNA

0 Ctrl ASAH1 LAPTM4B

Control fibroblasts

c

BODIPY-Cer/LDL

+ – –

– + –

– – +

– + +

Farber’s fibroblasts

Dextran

BODIPY-Cer/LDL

Dextran

Chase time (h) 3

d

0.8

e

BODIPY-lipids

f

4

Cellular lipids

*

Sensitization to anthracycline-induced death

4

Farber’s + LAPTM4B

Farber’s

Farber’s + LAPTM4B

Farber’s

Farber’s

Control

Farber’s

Control

Ctrl

Cer

3

Ctrl

*

0.6

Ceramide (nmol/mg protein)

Both high and low LAPTM4B expression have been associated with chemotherapy Cer resistance23,25. We therefore investigated how 2 0.4 Sph LAPTM4B expression affects cell sensitivity to SM 0.2 1 chemotherapeutic agents in our systems. We SM 0 0 found that A431 cells stably overexpressing LAPTM4B were sensitized to caspase-3 activation after treatment with anthracyclines or paclitaxel (Fig. 5a and Supplementary Fig. 12) and showed lower viability than did CD63 Figure 3 | LAPTM4B overexpression suppresses ceramide accumulation. (a) Colocalization control cells upon anthracycline treatment of LAPTM4B-Cherry and CD63-EGFP in LEs of A431 cells by confocal microscopy. Scale bar, (Supplementary Fig. 12). Conversely, A431 10 μm. (b) CD63-Ch and LAPTM4B-Ch overexpressing (o.e.) cells were treated with the cells depleted of LAPTM4B were protected indicated siRNAs for 3 d, and cellular ceramide levels analyzed by HPTLC (n = 3–7 independent from anthracycline- and paclitaxel-induced experiments). Error bars, mean ± s.e.m.; *P < 0.05, t-test. (c) Ceramide-BODIPY retention in LEs caspase activation and poly(ADP-ribose) of ASAH1-deficient Farber’s patient fibroblasts. The LEs of control or Farber’s patient fibroblasts polymerase (PARP) cleavage (Fig. 5b and were labeled with rhodamide-dextran. Cells were pulsed with ceramide-BODIPY/LDL and Supplementary Figs. 13 and 14) and displayed BODIPY trafficking monitored by confocal microscopy during 0–3 h chase. Scale bar, 40 μm. increased viability compared to cells treated (d) Colocalization of BODIPY and dextran at 3 h chase in c expressed as Pearson’s correlation with control siRNA (Supplementary Fig. 13 (n = 3). Error bars, mean ± s.e.m.; *P < 0.05. (e) HPTLC analysis of ceramide-BODIPY metabolites and Supplementary Table 2). This suggests in control and Farber’s fibroblasts pulsed with ceramide-BODIPY/LDL for 1 h and chased for 1 h that LAPTM4B deficiency inhibits a classical in unlabeled medium. (f) Left, representative HPTLC analysis of SM and ceramide from healthy apoptosis pathway. As the role of LAPTM4B fibroblasts (control), Farber’s disease fibroblasts (Farber’s) and Farber’s fibroblasts overexpressing in chemotherapy resistance has previously LAPTM4B (Farber’s + LAPTM4B). Right, quantification of cellular ceramide (n = 4 experiments). been studied in breast cancer, we silenced Error bars, mean ± s.e.m.; *P < 0.05, t-test. Ctrl, control; Cer, ceramide; Sph, sphingosine. LAPTM4B in KPL-4 breast cancer cells that have high LAPTM4B expression (Supplementary crosslinkable and fluorescent ceramide derivative (ceramide-BP- Table 1). LAPTM4B depletion in these cells conferred protection BODIPY (1), Fig. 4b and Supplementary Note). Cells incubated from chemotherapy-induced caspase-3 activation and rendered with ceramide-BP-BODIPY were subjected to UV-induced cross- them highly death resistant (Supplementary Fig. 15). linking followed by anti-Flag immunoprecipitation, and analysis of fluorescent probe crosslinking. This revealed that ceramide-BP- LAPTM4B depletion protects from ceramide-induced death BODIPY was crosslinked more efficiently to LAPTM4B than to CD63 Ceramide can sensitize cancer cells to chemotherapy-induced (Fig. 4c,d). Moreover, the probe showed negligible crosslinking to death36–38. ASAH1 depletion increases ceramide (Fig. 2d), and, MCOLN1 (Fig. 4c,d), an LE protein that interacts with LAPTM4B32 accordingly, ASAH1-silenced cells were highly sensitized to and is functionally regulated by SM and sphingosine34. These results anthracycline-induced apoptosis as measured by cleaved caspase-3 suggest that LAPTM4B interacts specifically with ceramide. The (Fig. 5c and Supplementary Fig. 16). However, cells depleted of crosslinking of ceramide-BP-BODIPY to LAPTM4B was competed both ASAH1 and LAPTM4B were desensitized to anthracyclineby cell-permeable C6-ceramide in a concentration-dependent induced caspase-3 cleavage (Fig. 5c), despite having higher ceramide Colocalization (BODIPY/dextran)

© 2015 Nature America, Inc. All rights reserved.

0

manner (Fig. 4e,f), providing additional evidence for the specificity of the interaction. The short-term treatment with C6-ceramide was not accompanied by overt toxic effects, as indicated by intact LE and nuclear morphology and lack of caspase activation (Supplementary Fig. 10). Considering the ceramide interaction and ILV localization of LAPTM4B, we wondered whether LAPTM4B might be required for ceramide delivery to the limiting LE membrane. We used ceramide-BODIPY imaging to address this question. We enlarged LEs by RFP-tagged Rab-interacting lysosomal protein (RILPRFP) overexpression (analogously to what was done for early endosomes using Rab5Q79L overexpression)35 to provide sufficient resolution for light microscopic assessment of BODIPY fluorescence distribution within LEs. Comparison of the fluorescence patterns did not reveal major differences in BODIPY distribution between LAPTM4B-depleted and control LEs, suggesting that LAPTM4B silencing did not impair the access of LDL-derived ceramide-BODIPY to the limiting LE membrane (Supplementary Fig. 11).

nature chemical biology | Advance online publication | www.nature.com/naturechemicalbiology

article

Nature chemical biology doi: 10.1038/nchembio.1889 CD63-Flag

b

LAPTM4B-Flag

its proapoptotic effects, such as in the ER and ER-associated mitochondria (Fig. 5d). Notably, the LAPTM4B-Cherry organelles containing ceramide-BODIPY/LDL were closely associated with the ER (Supplementary Figs. 17 and 18 and Supplementary Movie 1), suggesting a potential route for ceramide transfer from LEs to the ER. To further test this idea, we used siRNA-mediated knockdown to deplete A431 cells of CERT and accumulate LE-derived ceramide in the ER. This resulted in increased colocalization of ceramide-BODIPY/LDL–derived fluorescence with an ER marker (Fig. 5e). We found that CERT-depleted cells were sensitized to anthracycline-induced caspase-3 cleavage, as expected (Fig. 5f). Notably, this phenotype was abrogated by co-depletion of LAPTM4B (Fig. 5f and Supplementary Fig. 19). This result indicates that the proapoptotic effect of CERT depletion via ER ceramide accumulation is counterbalanced by LAPTM4B silencing, apparently because less ceramide is reaching the ER.

Ceramide-BP-BODIPY OH O

OH

8 HN

N

10 O

Fraction of control Lysate

Pulldown

Pulldown

F

B F

Cer-BP-BPY crosslinking

50

Flag LAPTM4B BODIPY MCOLN1

N

f

C6-ceramide (µM) 0

*

CD63

Lysate

Pulldown

Lysate

Pulldown

70 55

7 6 5 4 3 2 1 0

LAPTM4B

Fold of CD63

35

e

Cer-BP-BPY crosslinking

Lysate

d

LAPTM4B MCOLN1

70 55

35

*

1.2 1 0.8 0.6 0.4 0.2 0

0 2 10 50 C6-Cer (µM)

Figure 4 | LAPTM4B interacts with ceramide. (a) Localization of LAPTM4B-Flag and CD63Flag in MVBs analyzed by immunogold labeling and EM. Black arrowheads indicate label on the delimiting membrane of MVBs; white arrowheads, label on ILVs. Scale bar, 200 nm. Quantification from 49 CD63- and 38 LAPTM4B-positive structures. (b) Structure of the crosslinkable ceramide derivative ceramide-BP-BODIPY. (c) SDS-PAGE and western blot analysis of ceramide-BP-BODIPY crosslinking in stable A431 cell lines expressing CD63-Flag, LAPTM4B-Flag or MCOLN1-Flag. (d) Quantification of ceramide-BP-BODIPY crosslinking to precipitated protein in c; CD63 binding is set to 1 (n = 4). Error bars, mean ± s.e.m.; *P < 0.05. (e) Ceramide-BP-BODIPY crosslinking in cells expressing LAPTM4B-Flag in a competition experiment with C6-ceramide. (f) Quantification of ceramide-BP-BODIPY crosslinking in the presence of C6-ceramide as in e (n = 5 separate experiments for 0 μM and 50 μM C6-ceramide; n = 2 for 2 μM and 10 μM C6-ceramide). Error bars, mean ± s.e.m.; *P < 0.05, Holm’s test.

levels than cells depleted of ASAH1 alone (Fig. 2d). This suggests that in the double-depleted cells, in which ceramide is sequestered in LEs, less ceramide is available outside LEs, where ceramide exerts a

CD63 o.e. Casp-3

–

+

–

1 µM Dau

–

–

25 nM Pacl

–

–

–

–

+

–

+

–

–

–

+

–

–

+

–

–

–

+

–

e siRNA SM

LE

Golgi

ASAH1

Cer

c

A431 Casp-3

Casp-3

Ponceau

Ponceau Ctrl ASAH1 LAPTM4B

+ – –

+ – –

+ – –

– + –

– + –

– + –

– + +

– + +

– + +

1 µM Dox 1 µM Dau

– –

+ –

– +

– –

+ –

– +

– –

+ –

– +

Ponceau Ctrl CERT LAPTM4B

+ – –

+ – –

+ – –

– + –

– + –

– + –

– + +

– + +

– + +

1 µM Dox 1 µM Dau

– –

+ –

– +

– –

+ –

– +

– –

+ –

– +

Ctrl

+

+

+

+

–

–

–

–

LAPTM4B 1 µM Dox

–

–

–

–

+

+

+

+

–

+

–

–

–

+

–

1 µM Dau 25 nM Pacl

–

– –

– –

+ –

– +

– –

– –

+ –

– +

Ctrl siRNA

CERT siRNA

f

Cer-BODIPY

d

siRNA

Ponceau 1 µM Dox

Depletion of LAPTM4B has been reported to increase lysosomal membrane permeabilization (LMP), cathepsin release and cell death21. LMP is regulated by sphingolipids13,39, and endosomal ceramide can induce cathepsin D activation40,41. We therefore hypothesized that LAPTM4B affects lysosomal cell death mechanisms, in part via LE sphingolipids. We obtained several lines of evidence in line with this idea. First, cells depleted of LAPTM4B displayed increased levels of

b

LAPTM4B o.e.

Sensitization to LMP

Casp-3

siRNA ER

CERT

Chemotherapy sensitization

siRNA

Caspase-3

siRNA

LAPTM4B

ER tracker

Sph

Merge

© 2015 Nature America, Inc. All rights reserved.

CD63

Lysate

Flag

BODIPY

kDa

Pulldown

c

O

siRNA

a

Figure 5 | LE ceramide sequestration confers protection against chemotherapy-induced caspase-3 cleavage. (a,b) Western blot analysis of caspase-3 cleavage in A431 cells overexpressing (o.e.) CD63 or LAPTM4B (a) or treated with control or LAPTM4B siRNA (b) and treated with the indicated drugs for 24 h. Dox, doxorubicin; Dau, daunorubicin; Pacl, paclitaxel. (c) Western blot analysis of caspase-3 cleavage in A431 cells treated with control, ASAH1 or LAPTM4B siRNAs and challenged with doxorubicin (Dox) or daunorubicin (Dau) for 24 h. (d) Schematic representation of ceramide catabolism and trafficking between LE, ER and Golgi. Cer, ceramide; Sph, sphingosine. (e) Confocal microscopy of A431 cells treated with control or CERT siRNA and labeled with ER Tracker Red and ceramide-BODIPY/LDL for 30 min. Cells were chased for 3 h and then imaged. Scale bar, 10 μm. Insets, highermagnification view of boxed areas. (f) Western blot analysis of caspase-3 cleavage in A431 cells treated with control, CERT or LAPTM4B siRNAs and challenged with the indicated compounds for 24 h. Ctrl, control. nature CHEMICAL BIOLOGY | Advance online publication | www.nature.com/naturechemicalbiology

5

article

Nature chemical biology doi: 10.1038/nchembio.1889 b

siRNA

CTSD Proact Ctrl LAPTM4B ASAH1 SMPD1

+ – – –

– + – –

– – + –

– + + –

– – – +

– + – +

Green fluorescence intensity

Pro-CTSD

siRNA Ctrl LAPTM4B Ctrl LAPTM4B

CD63-Ch o.e.

Ctrl siRNA LAPTM4B siRNA SMPD1 siRNA

LAPTM4B-Ch o.e.

140 120 100 80 60 40 20 0

160

0

we found that in BT549 breast cancer cells, LAPTM4B depletion alone was sufficient to induce LMP and substantially reduce cell viability (in agreement with previous studies21), suggesting that these cells are particularly prone to LMP-induced death. Taken together, these data strongly suggest that LE sphingolipid accumulation is an underlying mechanism associated with LMP-induced cell death upon LAPTM4B depletion.

c

Cell line

Green fluorescence intensity

a

80 70 60 50 40 30 20 10 0

0

160

DISCUSSION

The pathways responsible for the degradation of SM and complex sphingolipids in LEs cone f d CD63-FLAG Ctrl siRNA verge on ceramide as the common catabolite. Ctrl LAPTM4B SMPD1 LAPTM4B-FLAG LAPTM4B siRNA The major mechanism for ceramide removal 120 120 110 from LEs is considered to be its degradation * 110 * 100 100 by ASAH1. ASAH1 is a slow-acting enzyme, * 90 90 whereas the upstream enzyme SMPD1 is 80 80 highly active43. This suggests that ceramide 70 70 60 60 might also be removed from LEs by other 50 50 mechanisms. Ceramide release to the extra0 10 20 0 10 20 cellular space in exosomes is one possibility44, Siramesine (µM) Siramesine (µM) but its quantitative importance in cellular ceramide clearance is not known. Figure 6 | LAPTM4B affects lysosome-associated cell death pathways by regulating LE Here we provide several lines of evidence to sphingolipid content. (a) Western blot analysis of pro-cathepsin D (pro-CTSD) and cleaved suggest that ceramide can be exported from LEs cathepsin D heavy chain (CTSD) in A431 cells treated with indicated siRNAs. Proact, loading and that this route of LE ceramide clearance control. (b,c) Analysis of sensitivity to acridine orange–induced LMP in stable cell lines is regulated by LAPTM4B. First, LAPTM4Boverexpressing CD63 (CD63-Ch o.e.) or siRNA-resistant LAPTM4B (LAPTM4B-Ch o.e.) (b) depleted cells have an elevated ceramide conor wild-type A431 cells treated with indicated siRNAs (c). n = 18 cells in b and ≥6 cells in c. tent and an LE ultrastructure characteristic of Error bars, mean ± s.e.m. (d) SM was labeled with lysenin in A431 cells treated with indicated lipidosis, and they display accumulation of flusiRNAs. Intracellular SM pools were visualized in digitonin-permeabilized cells and plasma orescent ceramide in LE. Second, LAPTM4B membrane SM in nonpermeabilized cells. Scale bar, 10 μm. (e) Cell viability in stable CD63overexpression reduces LE ceramide storage and LAPTM4B-overexpressing cell lines 24 h after treatment with the indicated concentrations in human lysosomal ceramide storage disof siramesine (n = 4 experiments). (f) Viability of wild-type A431 cells treated with control or ease cells. Third, there is a specific interaction LAPTM4B siRNAs, measured after 24 h treatment with the indicated concentrations of between ceramide and LAPTM4B. Fourth, low siramesine (n = 6 experiments). In e,f, error bars, mean ± s.e.m.; *P < 0.05, t-test. Ctrl, control. expression of LAPTM4B confers protection from ceramide-induced ER-mitochondrial the cleaved, active cathepsin D compared to control (Fig. 6a and apoptosis, and high expression of LAPTM4B confers sensitivity, sugSupplementary Fig. 20). This phenotype was mimicked by ASAH1 gesting that these membranes represent acceptors for the ceramide knockdown, as expected. More notably, it was abrogated by SMPD1 transferred in a LAPTM4B-dependent manner. Finally, retention depletion (Fig. 6a), indicating that the observed effect of LAPTM4B of LE ceramide in LAPTM4B-depleted cells is associated with on cathepsin D is mediated via ceramide derived from acid hydro- cathepsin D activation and destabilization of lysosomes, which are lysis of SM. Second, we observed that LAPTM4B overexpression known effects of LE sphingolipid accumulation. reduced the sensitivity of cells to acridine orange–induced LMP, The dissection of this pathway was enabled by sphingolipid whereas cells depleted of LAPTM4B were sensitized to LMP probes [3H]-SM and [3H]-Cer (ref. 5), as well as ceramide-BODIPY33 (Fig. 6b), similarly as with SMPD1 depletion (Fig. 6c). Importantly, and ceramide-BP-BODIPY. Furthermore, introduction of the probes endosomal SM was increased in LAPTM4B-depleted cells, as judged in LDL particles targeted them to LEs. The fluorescent moiety of by lysenin staining of digitonin-permeabilized cells (Fig. 6d). This ceramide-BODIPY and the radioactive group of [3H]-SM are posiis consistent with the idea that in LAPTM4B-silenced cells, SM tioned in the sphingosine base, allowing them to be traced after accumulation in LEs contributes to the increased sensitivity to ASAH1-catalyzed hydrolysis, unlike commercially available ceramide LMP13,14. We presume that the increase of LE SM may be second- probes with fatty acyl chain linked fluorophores or radiolabels. In ary to the ceramide export block, causing local accumulation of ceramide-BP-BODIPY, the crosslinkable group and the fluorescent the upstream metabolite. moiety are localized to the sphingosine tail and the fatty acyl group, Finally, we tested whether LAPTM4B affects cell death caused respectively. This assures that the crosslinked probe can be detected by the LMP-inducing experimental anticancer drug siramesine. only if the ceramide structure is intact. Our results agree with the idea Cells overexpressing LAPTM4B were protected from siramesine- that LAPTM4B binds ceramide and facilitates its removal from LEs. induced cell death (Fig. 6e), whereas LAPTM4B depletion sensi- However, it is possible that the compartmentalization of other endogtized cells to siramesine (Fig. 6f). Unlike doxorubicin (Fig. 5b and enous lipids (such as sphingosine, which accumulates transiently in Supplementary Fig. 14), siramesine did not induce caspase activa- LAPTM4B-depleted cells) may also be regulated by LAPTM4B. tion or PARP cleavage (Supplementary Fig. 21), and the caspase The precise mechanism(s) and regions of LAPTM4B controlling inhibitor Z-VAD-FMK was not protective in cells treated with sir- ceramide export from LEs should be addressed in future studies. amesine (Supplementary Table 2). This is consistent with the finding At the fluorescence microscopy level, we found no evidence that that siramesine induces caspase-independent cell death42. Notably, LAPTM4B facilitates ceramide delivery from ILVs to the limiting the sensitivity of cells to LMP-induced death varied. For instance, LE membrane. This leaves several possibilities; perhaps the protein Time (s)

Time (s)

Cell viability (%)

Cell viability (%)

+

© 2015 Nature America, Inc. All rights reserved.

Digitonin

–

siRNA

6

nature chemical biology | Advance online publication | www.nature.com/naturechemicalbiology

© 2015 Nature America, Inc. All rights reserved.

Nature chemical biology doi: 10.1038/nchembio.1889 acts as a permease or channel in the limiting membrane or regulates ceramide transfer from LEs to post-LE membranes, such as the ER, by controlling membrane traffic. Of note, LAPTM proteins have been implicated in facilitating transmembrane movement of small amphiphilic molecules23,26–29. Interestingly, the predicted third transmembrane domain of LAPTM4B contains the motif LVAITVLIY, matching the relaxed sphingolipid binding motif described45,46. However, when we introduced the interfering T212F mutation45 in this motif, the protein remained functional as judged by its ability to rescue LE ceramide-BODIPY accumulation in LAPTM4B-depleted cells (data not shown). Thus, LAPTM4B-mediated ceramide trafficking appears not to be entirely dependent on this motif. We found that LAPTM4B affected sensitivity to chemothera­ peutic compounds and cell death mechanisms differently depending on its expression level and ceramide compartmentalization: cells expressing LAPTM4B at high levels displayed increased clearance of ceramide from LE, sensitizing cells to ceramide-dependent apoptosis. In parallel, LE membranes were stabilized and cells were desensitized to lysosome-mediated death. In contrast, low LAPTM4B expression resulted in the retention of ceramide (and its upstream metabolite SM) in LEs, conferring sensitivity to lysosomotropic agents and lysosome-mediated death but protecting from ceramide toxicity in the ER. These findings may partly explain the discrepant reports on LAPTM4B expression and chemotherapy resistance in human study cohorts. Moreover, our data may help to better predict the contribution of LAPTM4B expression in responses to cancer therapy in the future, especially in combination with other ceramide pathway transcripts20,47,48. We have identified LAPTM4B as the first LE transmembrane protein that specifically interacts with ceramide and showed that ASAH1 and LAPTM4B represent alternative routes for LE ceramide clearance. LAPTM4B-facilitated ceramide exit from LEs provides a mechanism by which LAPTM4B modulates drug-induced cell death and constitutes a previously unknown pathway amenable to sphingolipid manipulations. Received 22 January 2015; accepted 9 July 2015; published online 17 August 2015

Methods

Methods and any associated references are available in the online version of the paper.

References

1. Schulze, H. & Sandhoff, K. Sphingolipids and lysosomal pathologies. Biochim. Biophys. Acta 1841, 799–810 (2014). 2. Kolter, T. & Sandhoff, K. Lysosomal degradation of membrane lipids. FEBS Lett. 584, 1700–1712 (2010). 3. Lloyd-Evans, E. et al. Niemann-Pick disease type C1 is a sphingosine storage disease that causes deregulation of lysosomal calcium. Nat. Med. 14, 1247–1255 (2008). 4. Speak, A.O. et al. Altered distribution and function of natural killer cells in murine and human Niemann-Pick disease type C1. Blood 123, 51–60 (2014). 5. Blom, T., Li, Z., Bittman, R., Somerharju, P. & Ikonen, E. Tracking sphingosine metabolism and transport in sphingolipidoses: NPC1 deficiency as a test case. Traffic 13, 1234–1243 (2012). 6. Hanada, K. et al. Molecular machinery for non-vesicular trafficking of ceramide. Nature 426, 803–809 (2003). 7. Truman, J.-P., García-Barros, M., Obeid, L.M. & Hannun, Y.A. Evolving concepts in cancer therapy through targeting sphingolipid metabolism. Biochim. Biophys. Acta 1841, 1174–1188 (2014). 8. Park, J.-W., Park, W.-J. & Futerman, A.H. Ceramide synthases as potential targets for therapeutic intervention in human diseases. Biochim. Biophys. Acta 1841, 671–681 (2014). 9. Henry, B., Möller, C., Dimanche-Boitrel, M.-T., Gulbins, E. & Becker, K.A. Targeting the ceramide system in cancer. Cancer Lett. 332, 286–294 (2013). 10. Ogretmen, B. & Hannun, Y.A. Biologically active sphingolipids in cancer pathogenesis and treatment. Nat. Rev. Cancer 4, 604–616 (2004). 11. Morad, S.A.F. & Cabot, M.C. Ceramide-orchestrated signalling in cancer cells. Nat. Rev. Cancer 13, 51–65 (2013).

article

12. Kallunki, T., Olsen, O.D. & Jäättelä, M. Cancer-associated lysosomal changes: friends or foes? Oncogene 32, 1995–2004 (2013). 13. Kirkegaard, T. et al. Hsp70 stabilizes lysosomes and reverts Niemann-Pick disease-associated lysosomal pathology. Nature 463, 549–553 (2010). 14. Petersen, N.H.T. et al. Transformation-associated changes in sphingolipid metabolism sensitize cells to lysosomal cell death induced by inhibitors of acid sphingomyelinase. Cancer Cell 24, 379–393 (2013). 15. Aits, S. & Jäättelä, M. Lysosomal cell death at a glance. J. Cell Sci. 126, 1905–1912 (2013). 16. Ellegaard, A.-M. et al. Sunitinib and SU11652 inhibit acid sphingomyelinase, destabilize lysosomes, and inhibit multidrug resistance. Mol. Cancer Ther. 12, 2018–2030 (2013). 17. Chipuk, J.E. et al. Sphingolipid metabolism cooperates with BAK and BAX to promote the mitochondrial pathway of apoptosis. Cell 148, 988–1000 (2012). 18. Tafesse, F.G. et al. Sphingomyelin synthase-related protein SMSr is a suppressor of ceramide-induced mitochondrial apoptosis. J. Cell Sci. 127, 445–454 (2014). 19. Lee, H. et al. Mitochondrial ceramide-rich macrodomains functionalize Bax upon irradiation. PLoS ONE 6, e19783 (2011). 20. Swanton, C. et al. Regulators of mitotic arrest and ceramide metabolism are determinants of sensitivity to paclitaxel and other chemotherapeutic drugs. Cancer Cell 11, 498–512 (2007). 21. Li, Y. et al. Lysosomal transmembrane protein LAPTM4B promotes autophagy and tolerance to metabolic stress in cancer cells. Cancer Res. 71, 7481–7489 (2011). 22. Yang, H. et al. Overexpression of LAPTM4B–35 promotes growth and metastasis of hepatocellular carcinoma in vitro and in vivo. Cancer Lett. 294, 236–244 (2010). 23. Li, Y. et al. Amplification of LAPTM4B and YWHAZ contributes to chemotherapy resistance and recurrence of breast cancer. Nat. Med. 16, 214–218 (2010). 24. Shao, G.-Z. et al. Molecular cloning and characterization of LAPTM4B, a novel gene upregulated in hepatocellular carcinoma. Oncogene 22, 5060–5069 (2003). 25. De Ronde, J.J. et al. SERPINA6, BEX1, AGTR1, SLC26A3, and LAPTM4B are markers of resistance to neoadjuvant chemotherapy in HER2-negative breast cancer. Breast Cancer Res. Treat. 137, 213–223 (2013). 26. Hogue, D.L., Ellison, M.J., Young, J.D. & Cass, C.E. Identification of a novel membrane transporter associated with intracellular membranes by phenotypic complementation in the yeast Saccharomyces cerevisiae. J. Biol. Chem. 271, 9801–9808 (1996). 27. Hogue, D.L., Kerby, L. & Ling, V. A mammalian lysosomal membrane protein confers multidrug resistance upon expression in Saccharomyces cerevisiae. J. Biol. Chem. 274, 12877–12882 (1999). 28. Cabrita, M.A., Hobman, T.C., Hogue, D.L., King, K.M. & Cass, C.E. Mouse transporter protein, a membrane protein that regulates cellular multidrug resistance, is localized to lysosomes. Cancer Res. 59, 4890–4897 (1999). 29. Li, L. et al. LAPTM4B: a novel cancer-associated gene motivates multidrug resistance through efflux and activating PI3K/AKT signaling. Oncogene 29, 5785–5795 (2010). 30. Tan, X. et al. LAPTM4B is a PtdIns(4,5)P2 effector that regulates EGFR signaling, lysosomal sorting, and degradation. EMBO J. 34, 475–490 (2015). 31. Tan, X., Thapa, N., Sun, Y. & Anderson, R.A.A. Kinase-Independent Role for EGF Receptor in Autophagy Initiation. Cell 160, 145–160 (2015). 32. Vergarajauregui, S., Martina, J.A. & Puertollano, R. LAPTMs regulate lysosomal function and interact with mucolipin 1: new clues for understanding mucolipidosis type IV. J. Cell Sci. 124, 459–468 (2011). 33. Pietiäinen, V. et al. NDRG1 functions in LDL receptor trafficking by regulating endosomal recycling and degradation. J. Cell Sci. 126, 3961–3971 (2013). 34. Shen, D. et al. Lipid storage disorders block lysosomal trafficking by inhibiting a TRP channel and lysosomal calcium release. Nat. Commun. 3, 731 (2012). 35. Wegner, C.S. et al. Ultrastructural characterization of giant endosomes induced by GTPase-deficient Rab5. Histochem. Cell Biol. 133, 41–55 (2010). 36. Reynolds, C.P., Maurer, B.J. & Kolesnick, R.N. Ceramide synthesis and metabolism as a target for cancer therapy. Cancer Lett. 206, 169–180 (2004). 37. Ji, C. et al. Exogenous cell-permeable C6 ceramide sensitizes multiple cancer cell lines to Doxorubicin-induced apoptosis by promoting AMPK activation and mTORC1 inhibition. Oncogene 29, 6557–6568 (2010). 38. Bedia, C., Casas, J., Andrieu-Abadie, N., Fabriàs, G. & Levade, T. Acid ceramidase expression modulates the sensitivity of A375 melanoma cells to dacarbazine. J. Biol. Chem. 286, 28200–28209 (2011). 39. Ullio, C. et al. Sphingosine mediates TNFα-induced lysosomal membrane permeabilization and ensuing programmed cell death in hepatoma cells. J. Lipid Res. 53, 1134–1143 (2012). 40. Heinrich, M. et al. Cathepsin D links TNF-induced acid sphingomyelinase to Bid-mediated caspase-9 and -3 activation. Cell Death Differ. 11, 550–563 (2004).

nature CHEMICAL BIOLOGY | Advance online publication | www.nature.com/naturechemicalbiology

7

article

Nature chemical biology doi: 10.1038/nchembio.1889

41. Heinrich, M. et al. Cathepsin D targeted by acid sphingomyelinase-derived ceramide. EMBO J. 18, 5252–5263 (1999). 42. Ostenfeld, M.S. et al. Effective tumor cell death by sigma-2 receptor ligand siramesine involves lysosomal leakage and oxidative stress. Cancer Res. 65, 8975–8983 (2005). 43. Sandhoff, K. My journey into the world of sphingolipids and sphingolipidoses. Proc. Jpn. Acad., Ser. B, Phys. Biol. Sci. 88, 554–582 (2012). 44. Trajkovic, K. et al. Ceramide triggers budding of exosome vesicles into multivesicular endosomes. Science 319, 1244–1247 (2008). 45. Contreras, F.-X. et al. Molecular recognition of a single sphingolipid species by a protein’s transmembrane domain. Nature 481, 525–529 (2012). 46. Björkholm, P. et al. Identification of novel sphingolipid-binding motifs in mammalian membrane proteins. Biochim. Biophys. Acta 1838, 2066–2070 (2014). 47. Juul, N. et al. Assessment of an RNA interference screen-derived mitotic and ceramide pathway metagene as a predictor of response to neoadjuvant paclitaxel for primary triple-negative breast cancer: a retrospective analysis of five clinical trials. Lancet Oncol. 11, 358–365 (2010). 48. Lee, A.J.X. et al. CERT depletion predicts chemotherapy benefit and mediates cytotoxic and polyploid-specific cancer cell death through autophagy induction. J. Pathol. 226, 482–494 (2012).

Acknowledgments

Author contributions

E.I. and T.B. conceived the project, designed and analysed experiments. T.B., S.L. and A.D. designed, carried out and analyzed experiments. N.B. carried out and analysed the electron microscopy experiments. R.B. conceived and designed the synthesis of the fluorescent ceramide probes, and Y.A.K. carried out the synthesis. H.R. planned and U.L.-M. carried out the lipid mass spectrometry and analysed the data. E.I. and T.B. wrote the manuscript; all authors read and commented on it.

Competing financial interests

The authors declare no competing financial interests.

Additional information

Supplementary information and chemical compound information is available in the online version of the paper. Reprints and permissions information is available online at http://www.nature.com/reprints/index.html. Correspondence and requests for materials should be addressed to T.B. or E.I.

© 2015 Nature America, Inc. All rights reserved.

The authors thank K. Sandhoff for helpful comments on the manuscript; A. Uro and D.J. Baek for technical support; S. Hautaniemi, R. Louhimo and S. Karinen for help

with bioinformatics and the Biomedicum imaging unit for help with microscopy. This study was supported by Academy of Finland grants 273533 and 266092 (T.B.), 131489, 263841 and 272130 (E.I.), the Liv och Hälsa Foundation (T.B. and N.B.), the University of Helsinki Research Fund Grant (T.B.), the Ruth and Nils-Erik Stenbäck Foundation (T.B.), the Finnish Medical Foundation (E.I. and R.B.), the Sigrid Juselius Foundation (E.I.), the Magnus Ehrnrooth Foundation (N.B.), the Perklén Foundation (N.B.), the Swiss National Science Foundation (H.R.), the NCCR Chemical Biology (H.R.) and SystemsX.ch (H.R.).

8

nature chemical biology | Advance online publication | www.nature.com/naturechemicalbiology

© 2015 Nature America, Inc. All rights reserved.

ONLINE METHODS

Materials. Flag M2 resin, acridine orange and filipin were from Sigma, lysenin (used at 1 μg/ml) and rabbit anti-lysenin antibody (used at 1:500 dilution) were from Peptanova, mouse anti–cathepsin D antibody was from BD Transduction Laboratories (1:4,000 dilution for western blotting, detecting a pro- and cleaved cathepsin D, ~45 kDa and 28 kDa, respectively). The monoclonal rabbit antibodies to cleaved caspase-3 (5A1E), PARP (46D11), and mouse monoclonal anti-caspase-8 (1C12) and rabbit anti-caspase-9 (Asp330) were purchased from Cell Signaling Technology (all used at 1:1,000 dilutions for western blotting). Alexa-488 goat anti rabbit (A11008) was from molecular probes. Proact membrane stain was from Amresco (M282). Doxorubicin, daunorubicin and paclitaxel were from Sigma. NBD-C6-ceramide BSA complex and rhodamine-dextran were purchased from Invitrogen, C6-ceramide was from Enzo Life Sciences, ER Tracker Red from Molecular Probes, and [3H]-sphingosine (specific activity, 21.4 Ci/mol) and [3H]-serine (specific activity, 30.9 Ci/mol) were from PerkinElmer. [3H]-SM (specific activity, 13 Ci/mmol) was synthesized as described5. Ceramide-BODIPY was generated by N-acylation of sphingosine-BODIPY, which was synthesized as described previously49. Synthesis of ceramide-BP-BODIPY is described in the Supplementary Note. Control (AG08498) and Farber’s patient fibroblasts (GM20018) were from Coriell Cell Repositories. The siRNAs used were GL2 negative control (sense strand: CGUACGCGGAAUACUUCGATT), silencer select negative control #1 (Ambion), LAPTM4B siRNA a (sense strand: CCUA CCUGUUUGGUCCUUATT), LAPTM4B siRNA b (sense strand: GGAUCAG UAUAACUUUUCATT), SMPD1 (sense strand: CUCCUUUGGAUGGGCC UGGTT), ASAH1 (target sequence: CACGATTAACTGTGAAATGTA), SMS1 (sense strand: CUACACUCCCAGUACCUGGTT), SMS2 (sense strand: CGA UUAGAAAGAUGAACAATT) and CERT (sense strand: CCACAUGACUUA CUCAUUATT). For depletion of LAPTM4B, the ‘b’ siRNA was always used unless specifically stated otherwise. The siRNAs were used at a final concentration of 10 nM and the siRNA treatment duration was 3 d. Sphingolipid analysis by mass spectrometry. Lipid extracts were prepared using methyl tert-butyl ether (MTBE) as previously described50. Briefly, cell pellets were resuspended in 100 μl water and 360 μl methanol. A mixture of internal sphingolipid standards (consisting of 2,500 pmol C12-SM, 500 pmol C17-Cer and 100 pmol C8GC, all from Avanti Polar Lipids) was added. Samples were vortexed and 1.2 ml MTBE was added. Phase separation was induced by addition of 200 μl of MS-grade water. The upper (organic) phase was transferred to 13-mm glass tubes, and the lower phase was reextracted with 400 μl of artificial upper phase. The total organic phase, recovered from each sample, was split into three parts and dried. One aliquot was treated by alkaline hydrolysis to enrich for sphingolipids, and one of the other aliquots was used for phosphorus analysis. The determination of total phosphorus in the lipid extracts was performed as described50 and used for normalization of lipid contents. Tandem mass spectrometry for the identification and quantification of sphingolipid molecular species was performed using multiple reaction monitoring (MRM) with a TSQ Vantage Triple Stage Quadrupole Mass Spectrometer (Thermo Fisher Scientific) equipped with a robotic nanoflow ion source, Nanomate HD (Advion Biosciences). Each individual ion dissociation pathway was optimized with regard to collision energy. Lipid concentrations were calculated relative to the corresponding internal standards and then normalized to the total phosphate content of each lipid extract as described50. Sphingoid base analysis was performed as described51. Sphingolipid extracts were reconstituted in a free sphingoid base reconstitution mixture of methanol/H2O/acetic acid (50:50:1) (vol/vol/vol) and loaded onto a C18 column (ODB, 5 μm, 150 × 1.0 mm, UP5ODBD15MC, Interchim) coupled to a tandem mass spectrometer. Mass spectrometry analysis was done on a Varian 320-MS triple quadrupole mass spectrometer (Agilent Technologies) equipped with an ESI source. The C18 column was equilibrated for 2 min with a 50:50 mixture of reverse phase solutions A (H2O/methanol/acetic acid (69:30:1, vol/vol/vol) containing 5 mM ammonium acetate) and B (methanol/acetic acid (99:1, vol/vol) containing 5 mM ammonium acetate). A linear gradient was applied from 50% to 100% of solution B over 8 min followed by a wash with 100% solution B for 12 min. The column was then reequilibrated with a 50:50 mixture of solutions A and B for 10 min. The autosampler was set to inject 30 μl of the reconstituted sphingolipid extracts onto the column at a flow rate of 50 μl/min. The areas under the peaks were determined for quantification relative to the C17-ceramide standard. doi:10.1038/nchembio.1889

Sphingomyelin synthase activity measurements in vitro. Cells were harvested in 10% glycerol, 15 mM KCl, 5 mM NaCl, 1 mM EDTA, 20 mM HEPES-KOH, pH 7.0, with protease inhibitor cocktail (chymostatin, leupeptin, antipain, pepstatin A, 25 μg/ml each). Cells were subjected to 20 passages through a 25G needle and centrifuged for 10 min at 2,500 r.p.m. at 4 °C. For each sample, equal amounts of protein in 100 μl of lysis buffer was added to 100 μl of lysis buffer supplemented with 0.002% Triton X-100, 20 nmol palmitoyloleoylphosphatidylcholine (POPC) and 0.1 mg of NBD-ceramide BSA. After incubation for 2 h at 37 °C, the lipids were extracted, separated on HPTLC plates with 1-butanol/acetic acid/H2O (3:1:1) and visualized using a FLA-9000 imager. Staining of free cholesterol using filipin. Cells grown on coverslips were fixed with 4% paraformaldehyde for 20 min and then quenched with 50 mM NH4Cl for 10 min. The cells were washed with PBS and incubated with 0.05% filipin in 10% FBS/PBS for 30 min at 37 °C. After washing the coverslips with PBS, the cells were briefly rinsed with MilliQ-H2O and mounted. DNA constructs and generation of stable cell lines. The LAPTM4B cDNAs were provided by R.-L. Zhou (School of Basic Medical Sciences, Peking University), the CD63 were from G. Griffiths (Cambridge Institute for Medical Research, University of Cambridge), and MCOLN1 and BFP-KDEL were from Addgene. The siRNA-resistant LAPTM4B construct was generated by introducing four silent point mutations in the siRNA target sequence of LAPTM4B (GGATCAGTATAACTTTTCA to GGACCAGTACAATTTCTCA). The constructs were cloned into the pmCherry-C1 vector and 3xFlag-tagged constructs into pcDNA3.1(+). The stable cell lines were generated by transfecting A431 cells with the plasmid construct, followed by selection and expansion of G418 resistant clones. Lentivirus constructs for expression of LAPTM4B-mCherry were obtained by substituting the GFP coding sequence in pLV-hPGK-GFP vector with LAPTM4B-mCherry, and the lentivirus was packed at the Functional Genomics Unit of Biomedicum Helsinki. Quantitative PCR. Total RNA was extracted from human cell lines according to the manufacturer’s instructions (RNA NucleoSpin II, Macherey Nagel). cDNA was synthesized from 1 μg total RNA using the ProtoScript II First Strand cDNA Synthesis Kit and random hexamer primers (New England BioLabs). For quantitative PCR (qPCR), the cDNA was amplified in duplicates using the LightCycler 480 SYBR Green I Master (Roche) with gene-specific oligonucleo­ tides on a LightCycler 480 system (Roche). The following specific oligonucleotides were used: ASAH1 (sense: 5′-ATTGGCCCCAGCCTACTTTAT-3′; antisense: 5′-CCCTGCTTAGCATCGAGTTCAT-3′), LAPTM4B (sense: 5′-C CTGGATCATCCCATTCTTCTGT-3′; antisense: 5′-AATTAGGAGGCAGT TGCCGTATG-3′), SMPD1 (sense: 5′-GCCCAATCTGCAAAGGTCTA-3′; antisense: 5′-TTCAGCAGATTGCACAGCTT-3′), and GAPDH (sense: 5′-GA AGGTGAAGGTCGGAGTC-3′; antisense: 5′-GAAGATGGTGATGGGATT TC-3′). GAPDH was used as endogenous control and relative gene expression was calculated by the 2-ΔΔCT method. Pulse-chase experiments using labeled sphingolipids. LDL particles were labeled with sphingolipids as previously described5. For labeling LDL particles, 20 nmol of ceramide-BODIPY, 3 nmol [3H]-sphingomyelin (40 μCi) or 1.5 nmol [3H]-ceramide (20 μCi) were used per 1 mg LDL. To trace the metabolism of sphingolipid probes, cells were serum starved overnight and then pulsed for 1 h with 50 μg/ml labeled LDL. The cells were chased in serum-free medium before lipid extraction and analysis on HPTLC. For the colocalization experiments of ceramide-BODIPY/LDL and terminal LE, the endosomal compartments were labeled by overnight incubation with the fluid phase marker rhodamine dextran (25 μg/ml) in medium containing 5% lipoprotein-deprived serum. The cells were then chased in serum-free medium for another 2 h to allow the dextran label to concentrate in lysosomes. Cells were then labeled for 1 h with 50 μg/ml ceramide-BODIPY/LDL (pulse), after which confocal imaging was initiated. For studying ceramide-BODIPY/LDL colocalization with the ER, cells were serum starved overnight and labeled with 1 μM ER Tracker Red together with 50 μg/ml ceramide-BODIPY/LDL for 30 min. The chase for the colocalization studies was carried out in CO2-independent medium at 37 °C. Lysenin staining of sphingomyelin. Cells were fixed in 4% PFA for 15 min, washed with PBS and incubated for 10 min with or without digitonin (50 μg/ml) for staining of the intracellular or plasma membrane pools of nature CHEMICAL BIOLOGY

sphingomyelin, respectively. The cells were washed in PBS and blocked for 15 min with 2% BSA in PBS. After a 2 h incubation with lysenin (1 μg/ml in blocking solution), the cells were incubated with anti-lysenin primary antibody (1:500 for 1 h), followed by Alexa 488 goat anti-rabbit (1:1,000 for 1 h), before mounting the coverslips on microscope slides. Confocal and wide-field microscopy. Filipin and lysenin stained cells were imaged with an Olympus IX70 inverted microscope equipped with a Polychrome IV monochromator, and Imago-QE camera (TILL Photonics). Confocal imaging was carried out using Leica TCS SP2 and SP8 confocal microscopes with climate chambers. All confocal experiments were carried out in CO2-independent medium and at 37 °C. For acridine orange–induced lysosomal membrane permeabilization, cells were incubated with 2 μg/ml acridine orange for 15 min and were then imaged with the 488 nm laser line with an acquisition rate of 1.6 s/image.

© 2015 Nature America, Inc. All rights reserved.

Cell viability. Cells on 96-well plates were siRNA treated using HipPerFect (Qiagen) according to the manufacturer’s instructions for reverse transfection. After 48 h, cells were exposed to the drugs for 24 h, after which viability was measured using the CellTiter 96 Aqueous one solution assay (Promega). Alternatively, cell viability was measured by cell counting using trypan blue exclusion (0.4% in PBS) to distinguish dead from live cells. Electron microscopy. Cells on coverslips were fixed with 2.5% glutaraldehyde in 0.10 M cacodylate buffer, postfixed with 1% osmium tetroxide and 1.5% potassium ferrocyanide, dehydrated and embedded in an Epon resin. Ultrathin sections were post-stained with uranyl acetate and lead citrate. Fifty cells in each specimen were systematically sampled and photographed at 20,000× with a Jeol JEM-1400 electron microscope equipped with a Gatan Orius SC 1000B bottommounted CCD-camera. For immunoelectron microscopy, cells were fixed with 4% paraformaldehyde in 0.10 M phosphate buffer for 2 h, scraped, pelleted and embedded in gelatin. Polyvinylpyrrolidone-sucrose–infiltrated specimens were sectioned at −120 °C. Sections were collected with methyl cellulose and sucrose, blocked with 1% fish skin gelatin (Sigma) and 1% BSA (Sigma), and incubated with DDDDK tag antibody (Abcam ab21536) 1:50 for 1 h followed by protein A conjugated to 10-nm gold particles (University of Utrecht, Utrecht, the Netherlands) for 1 h and embedded in uranyl acetate-methyl cellulose. Image quantification. For image analysis ImageJ was used. For quantifying the ceramide-BODIPY/LDL–derived fluorescence in the dextran compartment, a threshold mask of the dextran-labeled compartment was used, and the average fluorescence intensity of BODIPY in the masked region was calculated. To compare experiments, the data were normalized by setting the average BODIPY fluorescence intensity in the dextran compartment within an experiment as 1. The acridine orange–induced lysosomal membrane permeabilization was quantified as the increase in total cell green fluorescence during image acquisition using the argon 488 nm laser for excitation. Crosslinking with ceramide-BP-BODIPY. Stable cell lines overexpressing Flagtagged candidate proteins were generated. The cells were cultured on 60-mm

nature chemical biology

dishes to near confluency and incubated in cell culture medium containing 1 μM ceramide-BP-BODIPY for 1.5 h, after which the cells were washed three times with ice-cold PBS. The cells were placed on ice and ceramideBP-BODIPY was crosslinked for 20 min using a Spectrolinker XL-1500 with six UV-A lamps (365 nm). The dishes were placed ~10-cm from the UV-A light source on ice for 20 min. The Flag-tagged proteins were immunoprecipitated with an M2-anti Flag antibody. For the competition experiments the indicated concentrations of C6-ceramide were added to the cells together with the crosslinkable ceramide-BP-BODIPY during the 1.5 h incubation before crosslinking. Lipid analyses by high-performance thin-layer chromatography. The cells were washed with PBS on ice and scraped in 800 μl of 2% NaCl. Aliquots were removed for protein determination, and 3 ml CHCl3/methanol (1:2) was added to the cell suspension, followed by vigorous vortexing. Then 1 ml CHCl3 and 1 ml H2O were added for phase separation, and the lower phase was collected. The solvents were evaporated with a stream of nitrogen, and the lipids were dissolved in CHCl3/methanol (2:1). The lipid extracts were separated on two HPTLC plates; one portion (25% or 50%) of the extracts was developed using a mobile phase consisting of CHCl3/methanol/acetic acid/H2O (100:60:16:7) to resolve phospholipids and BODIPY-labeled phospholipids, respectively. The other portion (75% or 50% of the extracts) was used to resolve ceramide and ceramide-BODIPY, respectively, using CHCl3/acetic acid (9:1). Fluorescencelabeled lipids on the HPTLC plates were visualized using a FLA-9000 imager (GE Healthcare) with excitation at 488 nm, and the endogenous lipids were visualized by immersing the HPTLC-plates in a mixture of 3% CuSO4 and 8% H3PO4 followed by charring at 180 °C. De novo sphingolipid synthesis and sphingosine recycling were measured by pulsing cells with 1 μCi/ml [3H]-serine for 2 h or 1 μCi/ml [3H]-sphingosine for 15 min. The lipids were extracted and separated by HPTLC. Bands corresponding to lipid standards were scraped and analyzed by scintillation counting. High-performance thin-layer chromatography and western blotting data. Full HPTLC lanes and western blots are shown in Supplementary Figures 22 and 23. Statistics. Results are expressed as mean ± s.e.m. Statistical analysis was done by Student’s t-test. When three or more means were compared, Holm’s t-test for multiple comparisons was used. Statistical significance (P < 0.05) is denoted with an asterisk. 49. Bandhuvula, P., Li, Z., Bittman, R. & Saba, J.D. Sphingosine 1-phosphate lyase enzyme assay using a BODIPY-labeled substrate. Biochem. Biophys. Res. Commun. 380, 366–370 (2009). 50. Loizides-Mangold, U., David, F.P.A., Nesatyy, V.J., Kinoshita, T. & Riezman, H. Glycosylphosphatidylinositol anchors regulate glycosphingolipid levels. J. Lipid Res. 53, 1522–1534 (2012). 51. Sullards, M.C. & Merrill, A.H. Analysis of sphingosine 1-phosphate, ceramides, and other bioactive sphingolipids by high-performance liquid chromatography-tandem mass spectrometry. Sci. STKE 2001, pl1 (2001).

doi:10.1038/nchembio.1889