Kluyveromyces lactis cytoplasmic plasmid pGKL2: heterologous expression of Orf3p and proof of guanylyltransferase and mRNA-triphosphatase activities

Yeast Yeast 2001; 18: 815–825. DOI: 10.1002 /yea.728

Research Article

Kluyveromyces lactis cytoplasmic plasmid pGKL2: heterologous expression of Orf3p and proof of guanylyltransferase and mRNA–triphosphatase activities Markus Tiggemann, Stefanie Jeske, Michael Larsen and Friedhelm Meinhardt* Institut fu¨r Mikrobiologie, Westfa¨lische Wilhelms-Universita¨t Mu¨nster, Corrensstrasse 3, 48149 Mu¨nster, Germany

* Correspondence to: F. Meinhardt, Institut fu¨r Mikrobiologie, Westfa¨lische Wilhelms-Universita¨t Mu¨nster, Corrensstrasse 3, 48149 Mu¨nster, Germany. E-mail: [email protected]

Received: 10 November 2000 Accepted: 10 January 2001

Abstract The predicted ORF3 polypeptide (Orf3p) of the linear genetic element pGKL2 from Kluyveromyces lactis was expressed in Bacillus megaterium as a fusion protein with a His(6X)-tag at the C-terminus for isolation by Ni-affinity chromatography. This is the first time that a yeast cytoplasmic gene product has been expressed heterologously as a functional protein in a bacterial system. The purified protein was found to display both RNA 5k-triphosphatase and guanylyltransferase activities. When the lysine residue present at position 177 of the protein within the sequence motif (KXDG), highly conserved in capping enzymes and other nucleotidyl transferases, was substituted by alanine, the guanylyltransferase activity was lost, thereby proving an important role for the transfer of GMP from GTP to the 5k-diphosphate end of the mRNA. Our in vitro data provides the first direct evidence that the polypeptide encoded by ORF3 of the cytoplasmic yeast plasmid pGKL2 functions as a plasmid-specific capping enzyme. Since genes equivalent to ORF3 of pGKL2 have been identified in all autonomous cytoplasmic yeast DNA elements investigated so far, our findings are of general significance for these widely distributed yeast extranuclear genetic elements. Copyright # 2001 John Wiley & Sons, Ltd. Keywords: capping; guanylyltransferase; mRNA-triphosphatase; killer; linear plasmid; Kluyveromyces; cytoplasmic viruses

Introduction Linear dsDNA elements, originally termed linear plasmids, were first described in mitochondria of male sterile corn (Pring et al., 1977). Similar genetic traits have been detected in a multitude of organisms since then and have been found to be widespread in filamentous fungi and yeasts; for compilations we refer to Meinhardt and Rohe (1993), Fukuhara (1995) and Meinhardt et al. (1997). In contrast to plants and filamentous fungi, almost all of the yeast linear dsDNA elements are cytoplasmically localized; they have been isolated from numerous genera, such as Botryoascus, Debaryomyces, Kluyveromyces, Pichia, Saccharomyces, Trichosporon and Wingea (Cong et al., 1994; Fukuhara, 1995). The genetic organization of yeast Copyright # 2001 John Wiley & Sons, Ltd.

linear elements appeared to be quite uniform (Hishinuma and Hirai, 1991; Klassen, 2001) with the killer plasmid pair pGKL1 and pGKL2 of Kluyveromyces lactis (also referred to as k1 and k2) the most thoroughly characterized (Hishinuma et al., 1984; Gunge, 1995; Schaffrath et al., 1999; Meinhardt and Schaffrath, 2001). K. lactis cells containing pGKL1 and pGKL2 differ from plasmid-less cells by their ability to kill sensitive yeasts belonging either to the same or a different species (Gunge et al., 1981; Gunge and Sakaguchi 1981). The four open reading frames identified for the smaller, 8.9 kbp element pGKL1, which is fully dependent on pGKL2 (Gunge et al., 1981), were found to encode the plasmid specific DNA polymerase, the a-, b- and c-subunits of the heterotrimeric toxin (Stark and Boyd, 1986; Stark et al.,

M. Tiggemann et al.

816

1990) and immunity against the toxin (Kikuchi et al., 1984). The autonomous, 13.5 kbp element pGKL2 carries 11 ORFs. As disruption of ORF1 had no influence on replication and maintenance, it appeared to be dispensable (Schaffrath et al., 1992), a finding which was supported by elucidation of the structure of pPE1B from Pichia etchellsii, in which homologues of all pGKL2-based genes but ORF1 were found to exist (Klassen, 2001); ORF2 encodes the element specific DNA polymerase, including the terminal protein (Tommasino et al., 1988; Takeda et al., 1996); the predicted ORF3 polypeptide, which is under investigation here, was found to share similarities with capping enzymes (Larsen et al., 1998); ORF4 may encode a helicase (Tommasino et al., 1988; Stark et al., 1990); ORF5 presumably encodes a ss-DNA binding protein (Schaffrath, personal communication); the predicted ORF6 protein encodes the RNA-polymerase for transcribing pGKL-based genes (Wilson and Meacock, 1988); ORF7 may be a subunit of the latter (Schaffrath et al., 1997); although essential, a function is not known for ORFs 8 and 9 (unpublished data); ORF10 codes for a terminal recognition factor, probably involved in initiation of replication of both elements (McNeel and Tamanoi, 1991); ORF11, a long-unappreciated gene of unknown function, occupies a small gap between ORF3 and ORF4 (Larsen and Meinhardt, 2000). For detailed information on the killer system, we refer to a recent review (Meinhardt and Schaffrath, 2001). Genes present on the killer elements are likely to be transcribed independently, as each is preceded by a sequence motif that was shown to be crucial for cytoplasmic promoters (Schickel et al., 1996). Transcripts synthesized in the cytoplasm do not have access to the nuclear capping machinery, but a cap is essential for efficient initiation of eukaryotic translation. Formation of the cap structure (m7G(5k)ppp(5k)N(N)n) requires three enzymatically catalysed steps: Firstly, Pi is removed from the 5k-triphosphate end of the messenger by mRNAtriphosphatase (TPase), i.e. the c-phosphate of the pre-mRNA is removed. GMP is then transferred from GTP to the new diphosphate end by the RNA guanylyltransferase (GTase), eventually resulting in a 5k-5k-triphosphate bridge. GTase activity involves two reactions, the first of which is a nucleophilic attack on the a-phosphate of GTP, resulting in a Copyright # 2001 John Wiley & Sons, Ltd.

phosphoamide linkage of GMP to the e-amino group of a lysine residue, thereby facilitating the formation of a covalent enzyme–GMP complex (EpG), PPi is concomitantly released (Shuman and Hurwitz, 1981; Cong and Shuman, 1993; Niles and Christen, 1993); the GTase reaction is completed by the transfer of the enzyme-linked GMP to the diphosphate end of the mRNA, giving rise to the 5k–5k-triphosphate bridge (Shuman and Schwer, 1995). Finally, a methyl-moiety is transferred from S-adenosylmethionine to N-7 of the guanine by the RNA methyltransferase; additional methylations further downstream are optional (Shuman, 1995; Bissaillon and Lemay, 1997). We have shown previously that the predicted Orf3p of pGKL2 shares similarities to viral capping enzymes (Larsen et al., 1998); thus, it was tempting to check whether enzymatic reactions involved in cap formation can be proven for the polypeptide encoded by this essential ORF. For this purpose, ORF3 was heterologously expressed in a bacterial system that facilitated transcription and translation of A+T-rich genes, as pGKL2 is composed of 74% A+T; the enzyme was found to possess both TPase and GTase activities. Furthermore, an alanine substitution of the lysine residue within the motif KXDG, highly conserved in viral and nuclear guanylyltransferases and other nucleotidyltransferases (Shuman and Schwer, 1995), abolished enzyme activity. The data presented here not only demonstrate the functional expression of a cytoplasmic pGKL-based yeast gene in a bacterial expression system but also reveal a nucleus-independent capping machinery for the transcripts of linear yeast plasmids, a function hitherto exclusively evidenced for cytoplasmic viruses such as African swine fever virus (ASFV), Shope fibroma virus (SFV) and Vaccinia virus (Shuman, 1995).

Materials and methods Strains and growth conditions The microbial strains, plasmids and oligonucleotides used in this study are specified in Table 1. Escherichia coli strains were routinely grown in LB medium supplemented with 50 mg/ml ampicillin when required (Sambrook et al., 1989). The listed E. coli strains served as cloning hosts. For Yeast 2001; 18: 815–825.

mRNA-capping enzyme of K. lactis killer elements

817

Table 1. Plasmids, strains and oligonucleotides used Plasmid

Relevant markers

Reference

pUCBM20

lacZ, AmpR

pWH1520

xylR, AmpR (E. coli); TetRI and TetRII (Bacillus), shuttle plasmid AmpR, expression vector pQE60 containing ORF3/pGKL2 pUCBM20, containing a 1.9 kb ORF3 His amplification product in EcoRV restriction site pWH1520, containing a 1.9 SpeI ORF3 His fragment amplified from pQE60-3b pUCO3His, K177A substitution in the KADG motif pWH1520, containing the 1.9 SpeI ORF3His fragment derived from pUCO3Hismut

Boehringer-Mannheim GmbH, Mannheim, BRD Rygus and Hillen, 1991

pQE60 pQE60-3b pUCO3His pO3His pUCO3Hismut pO3Hismut

Strain Escherichia Escherichia Escherichia Escherichia

Qiagen, Hilden, Germany, 1997 This work This work This work This work This work

Relevant genotype

Bacillus megaterium DSM319

Wild-type

Bacillus megaterium DSM319 pO3His Saccharomyces cerevisiae F102-2

pO3His

Woodcock et al., 1989 Yanish-Perron et al., 1985 Struhl et al., 1976 Invitrogen Corporation, San Diego, USA Hunger and Claus, 1981; Stahl and Esser, 1983 This work

pGKL1, pGKL2

Gunge and Sakaguchi, 1981

Primer

Sequence (5k–3k); generated restriction sites are underlined

Application

Exe3 Carb Ex3 Amin ORF3up ORF3down ORF3.1

GGGGGGGGATCCTTTTTTAGAAAAGAAATGATAAG GGGGGGGGTCATGATTAAAAGATTCGCTAATATAAA GGACTAGTTTTAAAAGATTCGCTAAATATAA GGACTAGTGATTTTTTTCTCCATTTTAGCTT GAACAATGGTGTATATCTCCAGCTGCAGACGGAATA CATGTATTAGTC GACTAATACATGTATTCCGTCTGCAGCTGGAGATATA CACCATTGTTC CTAACTCAATTAAGATAGTTGATGG GGAAGCGAGAAGAATCATAATGGG

ORF3 amplification

ORF3.2 WH1 WH2

coli coli coli coli

DH5a JM107 SF8 TOP10

expression studies we used predominantly strain E. coli TOP10 and plasmid pQE60-3b.

ORF3His amplification Site-directed mutagenesis of the KADG motif 5k-IRD800 labelled for sequencing

Buchler, Braunschweig, Germany) and an automatic LI-COR sequencer (LI-COR, Inc., Lincoln, NE, USA).

Recombinant DNA techniques Molecular cloning procedures were carried out according to the methods described in Sambrook et al. (1989). DNA sequence analyses were performed with IRD 800-labelled universal and reverse sequencing primers, using the Thermo-Sequenase cycle sequencing kit with 7-deaza dGTP (Amersham Copyright # 2001 John Wiley & Sons, Ltd.

Plasmid construction For expression and isolation of the protein, a plasmid containing the ORF3 coding region with a C-terminal His tag was constructed. For this purpose, a DNA fragment was amplified by PCR from S. cerevisae F102-2 that contained a BspHI Yeast 2001; 18: 815–825.

M. Tiggemann et al.

818

site at codon 1 of ORF3 and a BamHI site at the end of the coding region, to clone it in frame with six additional histidine codons in pQE60. The fragment was amplified with primers Exe3 Carb and Ex3 Amin. The amplified product was cloned as a BspHI–BamHI fragment into the NcoI–BglIIcleaved pQE60, thereby adding the His tag to the C-terminus of Orf3p, resulting in pQE60-3b. From the latter plasmid a fragment was amplified using primers ORF3up and ORF3down and after cleavage with SpeI cloned into the corresponding SpeI site of pWH1520, giving rise to plasmid pO3His.

Site-directed mutagenesis The ORF3up/ORF3down amplified fragment was cloned as a blunt-ended fragment into the EcoRV site of pUCBM20, resulting in pUC03His, which was used for site-directed mutagenesis to replace the lysine at position 177 with alanine; we used complementary primers (ORFs 3.1 and 3.2) to generate the desired mutation. From the resulting plasmid, designated pUC03Hismut, a 1.9 kb SpeI fragment was excised and cloned into pWH1520, just as described above for the wild-type allele; the constructed plasmid was termed pO3Hismut.

Expression and purification of Orf3p E. coli strains listed in Table 1 were transformed with pQE60-3b and cultivated in LB medium containing 100 mg/ml ampicillin. For expression of Orf3p in B. megaterium we used shuttle plasmid p03His, which was transformed into B. megaterium DSM319 according to a previously described method (Meinhardt et al., 1989). B. megaterium (p03His) cells were grown to an optical density (OD600 nm) of 0.7 at 37uC in 1 l LB medium containing 12.5 mg/ml tetracycline. Expression from the xylA promoter was induced by adding 0.1% xylose (final concentration), followed by further incubation at 20uC for 4 h. The cells were subsequently harvested by centrifugation and stored at –70uC prior to use. The samples were thawed on ice and all further procedures were performed at 4uC. Cells were resuspended in 25 ml buffer [50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, 1 mM phenylmethylsulphonyl fluoride (PMSF), pH 8.0] equipped with 0.8 mg/ml lysozyme. After incubation for 30 min, 0.1% Tween 20 was added and kept on ice for further 30 min. Following sonification Copyright # 2001 John Wiley & Sons, Ltd.

(Branson Sonifier 250, Sonic Power Co.) the lysate was centrifuged; from the supernatant the protein was purified by nickel affinity chromatography (Ni-NTA agarose, Qiagen, Germany) according to the supplier’s instructions, with the addition of 0.1% Tween 20 to all buffers. Further purification involved cationic exchange chromatography on phosphocellulose, essentially as described by Ho et al. (1998).

RNA-triphosphatase assay c-32P-labelled triphosphate-terminated in vitrosynthesized RNA was prepared as described by Takagi et al. (1997). The RNA–triphosphatase reaction mixture contained (in 10 ml) 50 mM Tris–HCl (pH 7.9), 5 mM DTT, 5 mM MgCl2, 10 mM KCl, 100 gm/l BSA, 2–5 mmol [c-32P] GTPterminated RNA (6000 cpm/pmol) and the enzyme preparation. Incubation of samples was for 30 min at 37uC for Orf3p preparations and SAP (shrimp alkaline phosphatase; Roche Diagnostics GmbH, Mannheim, Germany). Reactions were terminated by adding 1 ml 1 M HCOOH. The reaction mixtures were spotted to PEI-cellulose thin-layer chromatography (TLC) plates (J.T Baker Chemicals, Deventer, The Netherlands). Plates were developed with 0.5 M KH2PO4 (pH 3.4). 32P and [c-32P] RNA were visualized by autoradiographic exposure of the developed TLC plate.

Assay of enzyme-GMP (EpG) complex formation The standard reaction mixture (20 ml) contained 50 mM Tris–HCl (pH 8.0), 2 mM DTT, 20 mM MgC12, 1 mM [a-32P]ATP and ORF3 protein, as indicated, and was incubated for 15 min at 30uC. The reaction was halted by adjusting the mixture to 1% SDS. The samples were electrophoresed through a 10% polyacrylamide gel containing 0.1% SDS. The gel was incubated for 20 min in amplifier-buffer (Amersham Buchler, Braunschweig, Germany) and label transfer to the ORF3 polypeptide was visualized by autoradiographic exposure of the dried gel (Gross and Shuman, 1998).

Western analysis Proteins separated by SDS–PAGE (11% acrylamide) were transferred to nitrocellulose filters by using a semi-dry electroblotter (Biometra, Go¨ttingen, Yeast 2001; 18: 815–825.

mRNA-capping enzyme of K. lactis killer elements

819

Germany); gels were equilibrated with buffer [25 mM Tris–200 mM glycine containing 5% (vol/ vol) methanol] prior to transfer of the polypeptides at 5 mA/cm. Blots on nitrocellulose were blocked with 5% milk powder in TBST [50 mM Tris–HCl (pH 7) containing 500 mM NaCl and 0.2% Tween 20] for 30 min at room temperature. His tag proteins were detected by immunoblotting with an anti-His tag–svFv-alkaline phosphatase conjugate (Lindner et al., 1997) that was used at a 1 : 500 dilution in TBST with 0.5% milk powder. Detection of bands was achieved by using the luminescence substrate CSPD (Boehringer-Mannheim, Germany).

Results Heterologous expression of Orf3p Our first attempts to express Orf3p of pGKL2 heterologously were performed in E. coli employing hybrid plasmid pQE60-3b, in which the gene was inserted in frame to the ATG start codon of the pQE60 expression cartridge. Concomitantly, the available His(6X) tag-encoding sequence was added to the C-terminal coding region. This and all other constructions conducted in our study were verified by sequencing. We used transformants of E. coli strains listed in Table 1 by applying various culture conditions to gain expression. After induction with IPTG (isopropyl-bD-thiogalacto-pyranoside) using different inducer concentrations, expression of the protein could not be obtained, as we could neither see a band of the expected size in PAGE nor visualize a His-tagged protein in respective immunoblots (data not shown). Since the E. coli genome has a G+C content of 50.1% (Oliver and Marin, 1996), whereas the killer plasmid pair, pGKL1 and pGKL2, exhibits a G+C content of only 26% (Tommasino et al., 1988), we used as an alternative the B. megaterium expression system (G+C=39%; Vary 1992). For this purpose, plasmid p03His (Figure 1), based on the E. coli/ Bacillus shuttle plasmid pWH1520 (Rygus and Hillen, 1991), was constructed and used for expression studies in strain B. megaterium DSM319. In p03His the ORF3 coding region with the added C-terminal His tag sequence was fused in frame to the start codon of the xylA gene. The putative capping enzyme gene is, thus, governed by the xylose-inducible xylA promoter (PA in Figure 1). B. megaterium cells containing p03His were Copyright # 2001 John Wiley & Sons, Ltd.

Figure 1. Physical map of shuttle plasmid p03His. The plasmid consists of pWH1520 (Rygus and Hillen, 1991) into which the amplified ORF3 containing a C-terminal His tag coding region was inserted as a SpeI fragment in a way that it is governed by the inducible xylA promoter PA. xylA, xylose isomerase gene of B. megaterium. xylR, gene encoding the xylose regulator protein. TetRI and TetRII denote fragments of the tetracycline resistance gene inactivated by insertion of the xylose operon. ORI pBC16, origin of replication from a B. cereus plasmid. TetRI, resistance gene of pBC16. All other parts correspond to the pBR322 sequence

cultivated and expression from PA was induced by adding xylose, as outlined in Materials and methods. Samples obtained after sonification of the bacterial lysates were subsequently submitted to PAGE; in induced cultures a band of the expected size was to be observed, whereas such a band was lacking in non-induced cultures (see Figure 2A). Verification of the C-terminal His-tagged protein was achieved by Western blot analyses using an anti-His tag antibody (see Figure 2B).

Purification of Orf3p As the Western blot clearly revealed the presence of the His tag, the protein was purified by adsorption to Ni-NTA-agarose and eluted stepwise with imidazole; the results of such experiments are presented in Figure 3. Although the eluates were found to contain predominantly the desired protein, the polypeptide was further purified by phosphocellulose cation exchange chromatography prior to use in experiments aimed at characterization of the enzyme. Yeast 2001; 18: 815–825.

820

M. Tiggemann et al.

function (see also Figure 5C). Thus, purified Orf3p was used for assaying possible RNA 5k-triphosphatase activity. For this purpose, the release of 32P-radioactivity from [c-32P] triphosphateterminated RNA was checked by TLC. The appearance of radioactive monophosphate was demonstrated by autoradiographic exposure of the TLC plates. Shrimp alkaline phosphatase (SAP) and reaction mixtures lacking divalent cations (Mg2+) served as controls. The results presented in Figure 4 clearly prove mRNA triphosphatase activity of the protein under investigation.

Guanylyltransferase activity—formation of a covalent Orf3p–GMP complex

Figure 2. SDS–PAGE (A) and immunoblot (B) of proteins isolated from B. megaterium containing p03His. Lane 1 corresponds to proteins obtained from non-induced cultures, lane 2 corresponds to proteins obtained after xylose (0.1%) induction. (B) The immunoblot was obtained by applying an anti-His tag antibody (Lindner et al., 1997)

RNA 5k-triphosphatase activity of Orf3p Previous findings concerning ORF3 (Larsen et al., 1998) suggested that the leading third of the predicted polypeptide might confer a triphosphatase

During mRNA capping the initial reaction involved in the transfer of GMP to the diphosphate end of the messenger is the formation of a phosphoamide bond between GMP and the e-amino group of a lysine residue within the highly conserved motif KXDG, resulting in a covalent enzyme–GMP complex (EpG) (Shuman and Hurwitz, 1981). Since the latter motif, as well as other domains conserved among cytoplasmic viral capping enzymes, were identified in Orf3p (see Figure 5C), we assayed guanylyltransferase activity by incubating the polypeptide in buffer containing 1 mM [a-32P]GTP and 20 mM MgCl2. As depicted in Figure 5A, such experiments resulted in formation

Figure 3. Isolation and purification of the heterologously expressed Orf3p. Protein fractions from B. megaterium lysates after xylose induction (lane 1), aliquots of imidazole eluate fractions: lane 2, 10 mM; lane 3, 40 mM; lanes 4–6, 150 mM; lane 7, 250 mM; lane 8, 500 mM analysed by SDS–PAGE followed by Coomassie blue staining. Positions and sizes (in kDa) of marker proteins are indicated on the left Copyright # 2001 John Wiley & Sons, Ltd.

Yeast 2001; 18: 815–825.

mRNA-capping enzyme of K. lactis killer elements

821

Figure 4. RNA triphosphatase activity of Orf3p. [c-32]GTP-terminated RNA was incubated with buffer only (lane 1); [c-32]GTP-terminated RNA was incubated with 5 pmol Orf3p (lane 2); [c-32]GTP-terminated RNA was incubated with 1 unit shrimp alkaline phosphatase (SAP, lane 3). Omission of MgCl2 in the reaction mixture with Orf3p (lane 4). Incubation was for 30 min at 30uC. The reaction mixture was analysed by thin-layer chromatography (TLC) on PEI-cellulose plates. 32P label was detected by autoradiography

of a SDS-stable nucleotidyl–protein adduct which migrates as a distinct protein band at approximately 67 kDa in SDS–polyacrylamide gel electrophoresis (SDS–PAGE). However, labelling could neither be detected when Orf3p was incubated with [a-32P]ATP instead of GTP, nor when MgCl2 was omitted, making evident a crucial role of the protein in transguanylation of GMP to the mRNA.

Site-directed mutagenesis of the Orf3p KADG motif Further strong evidence that Orf3p is involved in capping of cytoplasmic transcripts originated from site-directed mutagenesis of the lysine (K177) within the KADG motif. By applying oligonucleotides ORF3.1 and ORF3.2, a mutation was generated that resulted in an alanine substitution of the lysine at position 177 of the protein, as outlined in Figure 5C. The mutated allele was expressed in B. megaterium, as specified above for the wild-type gene. Xylose induction resulted in overexpression of a full-sized 67 kDa protein. However, an EpG could Copyright # 2001 John Wiley & Sons, Ltd.

not be detected in the guanylyltransferase assay (see Figure 5B).

Discussion Biochemical and enzymatic characterization of polypeptides encoded by yeast extranuclear genetic elements have been hindered by the rather weak expression of plasmid-based genes (Schru¨nder and Meinhardt, 1995; Schru¨nder et al., 1996; Schickel et al., 1996; Larsen and Meinhardt, 2000). Particularly with regard to polypeptides modifying eukaryotic nucleic acids such as the capping enzyme, these kind of investigations meet further difficulties, as interference with proteins of similar function encoded by nuclear genes can hardly be excluded. That is why we have decided to express in and isolate the ORF3 polypeptide from a bacterial system for studying its enzymatic properties. Routinely, E. coli was used for heterologous expression; the Vaccinia virus mRNA capping enzyme was obtained that way and catalytic activities were proven (Shuman, 1990). However, as shown in this paper, it was not possible to gain expression of Yeast 2001; 18: 815–825.

822

Copyright # 2001 John Wiley & Sons, Ltd.

M. Tiggemann et al.

Yeast 2001; 18: 815–825.

mRNA-capping enzyme of K. lactis killer elements

ORF3 in commonly applied E. coli systems. We assume different codon preferences to be responsible for the observed lack of expression, as the genomic G+C ratio of E. coli is very different from that of the yeast plasmids (52% vs 26%, respectively); the G+C ratio (39%) of B. megaterium (Vary, 1992) is closer to pGKL2 (Tommasino et al., 1988) and that is why we have chosen this Grampositive bacterium as the host for heterologous expression of Orf3p. Such an experimental approach allowed us to express the protein with a C-terminal His tag useful for identification and isolation of the protein, which was subsequently used to demonstrate mRNA-triphosphatase activity and formation of a stable EpG. Covalent linkage of GMP to the lysine at position 177 within the motif KADG, highly conserved in nucleotidyltransferases (Shuman and Schwer, 1995), was verified by sitedirected mutagenesis. Thus, at least two enzymatic activities necessary for the capping of transcripts evidently reside in the ORF3 gene product. Predicted ORF3 gene products of all autonomous linear cytoplasmically localized yeast genetic elements that have been sequenced so far (Klassen, 2001) resemble capping enzymes known from cytoplasmic viruses (Poxviridae and Iridoviridae) in a way that putative guanylyltransferase motifs reside in the centre and triphosphatase motifs are located in the leading third of the polypeptide (Shuman, 1995; Larsen et al., 1998). The most thoroughly investigated mRNA capping machinery of a cytoplasmic genetic element, the Vaccinia virus enzyme, is a heterodimeric protein composed of subunits with molecular

823

masses of 95 and 33 kDa which are encoded by the viral D1 and D12 genes, respectively (Martin et al., 1975; Niles et al., 1986, 1989; Shuman et al., 1980). As for Orf3p (Larsen et al., 1998; see also Figure 5C), catalytic domains of the Vaccinia capping enzyme are organized in a modular fashion. The N-terminal 60 kDa of the D1 subunit constitutes an autonomous functional unit containing both the triphosphatase and guanylyltransferase activities (Higman et al., 1992; Shuman, 1989; Shuman and Morham, 1990). The methyltransferase domain is a distinct, non-overlapping, autonomous unit of the carboxyl portion of the large subunit heterodimerized with the D12 protein (Cong and Shuman, 1992; Higman et al., 1994; Mao and Shuman, 1994). In the native enzyme both domains are linked via a protease-sensitive hinge region of the large subunit (Shuman, 1989). As a motif reminiscent of a S-adenosylmethionine binding site was identified in the carboxyl portion of the predicted ORF3 polypeptides of yeast cytoplasmic elements (SamB in Figure 5C), it was accordingly suggested that all enzymatic activities necessary for mRNA capping are presumably present on a single peptide chain (Larsen et al., 1998). In this context it is noteworthy that we were not able to successfully establish an assay for the demonstration of the methyltransferase activity of Orf3p (data not shown), as was previously done for the vaccina virus capping enzyme (Barbosa and Moss, 1978; Guo and Moss, 1990; Shuman, 1995; Liao and Stollar, 1997). One possible explanation for this is that the His tag at the C-terminus of the heterologously expressed polypeptide prevents

Figure 5. (A) Guanylyltransferase activity of Orf3p expressed in B. megaterium. (a) The purified polypeptide was analysed by SDS–PAGE followed by Coomassie blue staining. Guanylyltransferase assay mixture (20 ml) contained 50 mM Tris–HC1 (pH 8.0), 2 mM DTT, 20 mM MgCl2, 1 mM [a-32P]GTP or [a-32P]ATP and ORF3 protein as indicated. Marker, standard (SDS6H): lanes 1–3, guanylyltransferase mixture (Orf3p 0.2, 0.3 and 0.5 pmol); lane 4, guanylyltransferase mixture without MgCl2; lane 5, guanylyltransferase mixture with [a-32P]ATP instead of [a-32P]GTP; lane 6, ORF3 protein was omitted from a control reaction. The positions and sizes (in kDa) of the marker proteins are indicated on the left. (b) The gel was dried and EpG formation demonstrated by autoradiography. (B) Impact of the alanine substitution in the KADG motif on EpG formation of Orf3p. The isolated purified wild-type (lane 2) and mutagenized polypeptide (lane 1) were analysed by SDS–PAGE followed by Coomassie blue staining. Guanylyltransferase assay mixture contained (in 20 ml) 50 mM Tris–HC1 (pH 8.0), 2 mM DTT, 20 mM MgCl2, 1 mM [a-32P]GTP and 5 pmol Orf3p. The positions and sizes (in kDa) of the marker proteins are indicated on the left. The label transfer to the ORF3 protein was detected by autoradiography. (C) Schematic representation of Orf3p and the K177A allele. Conserved regions found in viral cytoplasmic capping enzymes are highlighted. Triphosphatase (TPase) motifs (1, 2, 3, 4) guanylyltransferase (GTase) motifs (I, III, IIIa, IV, V, VI) and a putative S-adenosylmethionine binding site (SamB) of a presumed methyltransferase (MTase) according to Larsen et al. (1998). In the mutated protein the lysine within motif KADG is substituted by an alanine (K177A), as indicated. The wild-type and mutated alleles were checked by sequencing using primers WH1 and WH2 Copyright # 2001 John Wiley & Sons, Ltd.

Yeast 2001; 18: 815–825.

824

methyltransfrase activity. Also, it cannot be excluded that the native enzyme has a second subunit that is necessary for methyltransferase activity, as for the Vaccinia virus capping enzyme. Prominent candidate genes encoding such a presumptive subunit are those essential ORFs of pGKL2 for which a function is not known at present, i.e. ORFs 8, 9 and 11 (Meinhardt and Schaffrath, 2001). Co-expression of Orf3p with the putative subunits in B. megaterium, followed by a survey of catalytic activities, will provide an elegant means for identifying the respective gene. Similarly, motifs not detected until ORF3 polypeptides of linear plasmids were aligned with viral capping enzymes (triphosphatase motif 2 and the putative S-adenosylmethionine binding site; Larsen et al., 1998) are now subject to functional investigation by site-directed mutagenesis. Thus, our findings bear general significance for studying mRNA cap formation, an essential mechanism in common with all eukaryotes.

References Barbosa E, Moss B. 1978. mRNA (nucleoside-2k-)-methyltransferase from Vaccinia virus. J Biol Chem 253: 7692–7697. Bisaillon M, Lemay G. 1997. Viral and cellular enzymes involved in synthesis of mRNA cap structure. Virology 236: 1–7. Cong P, Shuman S. 1992. Methyltransferase and subunit association domains of Vaccinia virus mRNA capping enzyme. J Biol Chem 267: 16424–16429. Cong P, Shuman S. 1993. Covalent catalysis in nucleotidyl transfer: a KTDG motif essential for enzyme–GMP complex formation by mRNA capping enzyme is conserved at the active sites of RNA and DNA ligases. J Biol Chem 268: 7256–7260. Cong YS, Yarrow D, Li YY, Fukuhara H. 1994. Linear DNA plasmids from Pichia etchelsii, Debaryomyces hansenii and Wingea robertsiae. Microbiology 140: 1327–1335. Fukuhara H. 1995. Linear DNA plasmids of yeasts. FEMS Microbiol Lett 131: 1–9. Gross CH, Shuman S. 1998. RNA 5k-triphosphatase, nucleoside triphosphatase, and guanylyltransferase activities of baculovirus LEF-4 protein. J Virol 72: 10020–10028. Gunge N. 1995. Plasmid DNA and the killer phenomenon in Kluyveromyces. In Genetics and Biotechnology. The Mycota, vol 2, Ku¨ck U, Esser K, Lemke P (series eds). Springer: Berlin; 189–209. Gunge N, Sakaguchi K. 1981. Intergeneric transfer of desoxyribonucleic acid killer plasmids, pGKL1 and pGKL2, from Kluyveromyces lactis into Saccharomyces cerevisiae by cell fusion. J Bacteriol 147: 155–160. Gunge N, Tamaru A, Ozawa F, Sakaguchi K. 1981. Isolation and characterization of linear desoxyribonucleic acid plasmids from Kluyveromyces lactis and the plasmid-associated killer character. J Bacteriol 145: 382–390. Copyright # 2001 John Wiley & Sons, Ltd.

M. Tiggemann et al.

Guo P, Moss B. 1990. Interaction and mutual stabilization of the two subunits of Vaccinia virus mRNA capping enzyme co-expressed in Escherichia coli. Proc Natl Acad Sci U S A 87: 4023–4027. Higman HA, Bourgeois N, Niles EG. 1992. The Vaccinia virus mRNA (guanine-N7-)-methyltransferase requires both subunits of the mRNA capping enzyme for activity. J Biol Chem 267: 16430–16437. Higman MA, Christen LA, Niles EG. 1994. The mRNA (guanine-7) methyltransferase domain of the Vaccinia virus mRNA capping enzyme: expression in Escherichia coli and structural and kinetic comparison to the intact capping enzyme. J Biol Chem 269: 14974–14981. Hishinuma F, Hirai K. 1991. Genome organization of the linear plasmid pSKL, isolated from Saccharomyces kluyveri. Mol Gen Genet 226: 97–106. Hishinuma F, Nakamura K, Hirai K, Nishizawa R, Gunge N, Maeda T. 1984. Cloning and nucleotide sequence of the linear DNA killer plasmids from yeast. Nucleic Acids Res 12: 7581–7597. Ho CK, Schwer B, Shuman S. 1998. Genetic, physical and functional interaction between the triphosphatase and guanylyltransferase components of the yeast mRNA capping apparatus. Mol Cell Biol 18: 5189–5198. Hunger W, Claus D. 1981. Taxonomic studies on Bacillus megaterium and on agarolytic Bacillus strains. In The Aerobic Endospore-forming Bacteria: Classification and Identification, Berkeley RCW, Goodfellow M (eds). Academic Press: London; 217–239. Kikuchi Y, Hirai K, Hishinuma F. 1984. The yeast linear DNA killer plasmids, pGKL1 and pGKL2, possess terminally attached proteins. Nucleic Acids Res 12: 5685–5692. Klassen R, Tontsidou L, Larsen M, Meinhardt F. 2001. Genome organization of the linear cytoplasmic element pPE1B from pichia etchellsii. Yeast (accepted). Larsen M, Gunge N, Meinhardt F. 1998. Kluyveromyces lactis killer plasmid pGKL2: evidence for a viral-like capping enzyme encoded by ORF3. Plasmid 40: 243–246. Larsen M, Meinhardt F. 2000. Kluyveromyces lactis killer system: identification of a new gene encoded by pGKL2. Curr Genet 38: 271–275. Liao HJ, Stollar V. 1997. Methyltransferase activity of the insect orbivirus JKT-7400: photoaffinity labeling of a minor virion protein, VP4, with S-adenosylmethionine. Virology 235: 235–240. Lindner P, Bauer K, Krebber A, et al. 1997. Specific detection of his-tagged proteins with recombinant anti-his tag scFV-phosphatase or scFv-phage fusion. BioTechniques 22: 140–149. Mao X, Shuman S. 1994. Intrinsic RNA (guanine-7) methyltransferase activity of the Vaccinia capping enzyme D1 subunit is stimulated by the D12 subunit: identification of amino acid residues in the D1 protein required for subunit association and methyl group transfer. J Biol Chem 269: 24472–24479. Martin SA, Paoletti E, Moss B. 1975. Purification of mRNA guanylyltransferase and mRNA (guanine-7) methyltransferase from Vaccinia virions. J Biol Chem 250: 9322–9329. McNeel DG, Tamanoi F. 1991. Terminal region recognition factor 1, a DNA-binding protein recognizing the inverted terminal repeats of the pGKL1 linear DNA plasmids. Proc Natl Acad Sci U S A 88: 11398–11402. Yeast 2001; 18: 815–825.

mRNA-capping enzyme of K. lactis killer elements

Meinhardt F, Rohe M. 1993. Extranuclear inheritance: Linear protein-primed replicating genomes in plants and microorganisms. In Progress in Botany, vol. 54, Behnke HD, Lu¨ttge U, Esser K, Kadereit JW, Runge M (eds). Springer-Verlag: Berlin; 334–357. Meinhardt F, Schaffrath R. 2001. Extranuclear inheritance: cytoplasmic linear ds-DNA killer elements of the dairy yeast Kluyveromyces lactis. In Progress in Botany, vol. 62, Esser K, Lu¨ttge U, Kadereit J, Beyschlag W (eds). Springer-Verlag: Berlin; 51–70. Meinhardt F, Schaffrath R, Larsen M. 1997. Microbial linear plasmids. Appl Microbiol Biotechnol 47: 329–336. Meinhardt F, Stahl U, Ebeling W. 1989. Highly efficient expression of homologous and heterologous genes in Bacillus megaterium. Appl Microbiol Biotechnol 41: 344–351. Niles EG, Lee-Chen S, Shuman S, Moss B, Broyles S. 1989. Vaccinia virus gene D12L encodes the small subunit of the viral mRNA capping enzyme. Virology 172: 513–522. Niles EG, Christen L. 1993. Identification of the Vaccinia virus mRNA guanyltransferase active site lysine. J Biol Chem 268: 2986–24989. Niles EG, Condit R, Caro P, Davidson K, Matusick L, Seto J. 1986. Nucleotide sequence and genetic map of the 16-kb Vaccinia virus HindIII D fragment. Virology 153: 96–112. Oliver J, Marin A. 1996. A relationship between GC content and coding-sequence length. J Mol Evol 43: 216–223. Pring DR, Levings III CS, Hu WWL, Timothy DH. 1977. Unique DNA associated with mitochondria in the ‘S’-type cytoplasm of male steril maize. Proc Natl Acad Sci U S A 74: 2904–2908. Rygus T, Hillen W. 1991. Inducible high-level expression of heterologous genes in Bacillus megaterium using the regulatory element of the xylose-utilisation operon. Appl Microbiol Biotechnol 35: 594–599. Sambrook J, Maniatis T, Fritsch EF. 1989. Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory Press: New York. Schaffrath R, Meinhardt F, Meacock PA. 1997. ORF7 of yeast plasmid pGKL2: analysis of gene expression in vivo. Curr Genet 31: 190–192. Schaffrath R, Meinhardt F, Meacock PA. 1999. Genetic manipulation of Kluyveromyces lactis linear DNA plasmids: gene targeting and plasmid shuffles. FEMS Microbiol Lett 172: 201–210. Schaffrath R, Stark MJR, Gunge N, Meinhardt F. 1992. Kluyveromyces lactis killer system: ORF1 of pGKL2 has no function in immunity expression and is dispensable for killer plasmid replication and maintenance. Curr Genet 21: 357–363. Schickel J, Helmig C, Meinhardt F. 1996. Kluyveromyces lactis killer system: analysis of cytoplasmic promotors of yeast linear plasmids. Nucleic Acids Res 24: 1879–1886. Schru¨nder J, Meinhardt F. 1995. An extranuclear expression system for analysis of cytoplasmic promotors of yeast linear killer plasmid. Plasmid 33: 139–151. Schru¨nder J, Gunge N, Meinhardt F. 1996. Extranuclear expression of the bacterial xylose isomerase (xylA) and the UDP-glucose dehydrogenase (hasB) genes in yeast with Kluyveromyces lactis linear killer plasmids as vectors. Curr Microbiol 33: 323–330.

Copyright # 2001 John Wiley & Sons, Ltd.

825

Shuman S. 1989. Functional domains of Vaccinia virus mRNA capping enzyme: analysis by limited tryptic digestion. J Biol Chem 264: 9690–9695. Shuman S. 1990. Catalytic activity of Vaccinia mRNA capping subunits co-expressed in Escherichia coli. J Biol Chem 265: 11960–11966. Shuman S. 1995. Capping enzyme in eukaryotic mRNA synthesis. Prog Nucleic Acids Res Mol Biol 50: 101–129. Shuman S, Hurwitz J. 1981. Mechanism of mRNA capping by Vaccinia virus guanylyltransferase: characterization of an enzyme-guanylate intermediate. Proc Natl Acad Sci U S A 78: 187–191. Shuman S, Morham SG. 1990. Domain structure of Vaccinia virus mRNA capping enzyme: activity of the Mr 95,000 subunit expressed in Escherichia coli. J Biol Chem 265: 11967–11972. Shuman S, Schwer B. 1995. RNA capping enzyme and DNA ligase: a superfamily of covalent nucleotidyltransferases. Mol Microbiol 17: 405–410. Shuman S, Surks M, Furneaux H, Hurwitz J. 1980. Purification and characterisation of a GTP-pyrophosphate exchange activity from Vaccinia virions: association of the GTPpyrophosphate exchange activity with Vaccinia mRNA guanylyltransferase-RNA (guanine-7-) methyltransferase complex (capping enzyme). J Biol Chem 255: 11588–11598. Stahl U, Esser K. 1983. Plasmid heterogeneity in various strains of Bacillus megaterium. Eur J Appl Biotechnol 17: 248–251. Stark MJR, Boyd A. 1986. The killer toxin of Kluyveromyces lactis: characterization of the toxin subunits and identification of the genes which encode them. EMBO J 5: 1995–2002. Stark MJR, Mileham AJ, Romanos MA, Boyd A. 1990. The plasmid-encoded killer system of Kluyveromyces lactis: a review. Yeast 6: 1–29. Struhl K, Cameron JR, Davis RW. 1976. Functional genetic expression of eukaryotic DNA in Escherichia coli. Proc Natl Acad Sci U S A 73: 1471–1475. Takagi T, Moore CR, Diehn F, Buratowski S. 1997. An RNA 5k-triphosphatase related to the protein tyrosine phosphatases. Cell 89: 867–873. Takeda M, Hiraishi H, Takesako T, Tanase S, Gunge N. 1996. The terminal protein of the linear DNA plasmid pGKL2 shares an N-terminal domain with the plasmid encoded DNA polymerase. Yeast 12: 241–246. Tommasino M, Ricci S, Galeotti CL. 1988. Genome organization of the killer plasmid pGKL2 from Kluyveromyces lactis. Nucleic Acids Res 16: 5863–5878. Vary PS. 1992. Development of genetic engineering in Bacillus megaterium. In Biology of Bacilli: Applications to industry, Doi R, McGloughlin M (eds). Butterworth–Heinemann: Boston; 251–310. Wilson DW, Meacock PA. 1988. Extranuclear gene expression in yeast: evidence for a plasmid encoded RNA polymerase of unique structure. Nucleic Acids Res 16: 8097–8110. Woodcock DM, Crowther PJ, Doherty J, et al. 1989. Quantitative evaluation of Escherichia coli host strains for tolerance to cytosin methylation in plasmid and phage recombinants. Nucleic Acids Res 17: 3469–3478. Yanish-Perron C, Vieira J, Messing J. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequence of the M13mp18 and pUC19 vectors. Gene 33: 103.

Yeast 2001; 18: 815–825.