Isolation of cDNA libraries from individual human preimplantation embryos

Molecular Human Reproduction vol.4 no.6 pp. 571–575, 1998

Isolation of cDNA libraries from individual human preimplantation embryos

Yury Verlinsky1,3, Gennady Morozov1, Oleg Verlinsky1, Valery Koukharenko2, Svetlana Rechitsky1, Eugene Goltsman1, Viktor Ivakhnenko1, Viktor Gindilis1, Charles M.Strom1 and Anver Kuliev1 1Reproductive Genetics Institute, Illinois Masonic Medical Center, 836 W. Wellington Avenue, Suite 4504, Chicago, IL 60657, USA, and 2Russian Research Center for Medical Genetics, Russian Academy of Medical Sciences, Moscow, Russia 3To

whom correspondence should be addressed

Although available data from the mouse model suggest that morphogenesis during preimplantation development is dependent on the expression of embryonic genes, convincing data for human preimplantation embryos are missing. To investigate the expression of genes involved in human preimplantation development we constructed cDNA libraries from human individual blastocysts and screened them for the expression of β-actin, CD59, homeoboxes OCT-3 and HOXA4, and HLA-G and hMLH-1 genes. β-actin, CD59, and OCT-3 were detected by reverse transcription–polymerase chain reaction (RT–PCR), while HOXA4, HLA-G and hMLH-1 were undetected. Sequencing of 48 random clones from two libraries revealed a different identity to the known genes including 99% identity to human histone 3.1 and human ribosome protein S25 complete cDNA. These data demonstrate the feasibility of constructing cDNA libraries from individual human preimplantation embryos and their potential usefulness in the assessment of the relevance of specific gene expression in the failures of preimplantation development. Key words: cDNA library/CD59/histone 3.1/human blastocyst/OCT-3

Introduction

Materials and methods

Available data from the mouse model suggest that morphogenesis during preimplantation development is dependent on the expression of embryonic genes (Kidder, 1992; Rothstein et al., 1992). Analogous data on genetic expression in human preimplantation development is limited, and has been concentrated on particular genes or gene families (Campbell et al., 1995; Taylor and Johnson, 1996; Jay et al., 1997). In our previous study using specially designed intron spanning primer sets for reverse transcription–polymerase chain reaction (RT–PCR) we demonstrated the presence of mRNAs of homeobox-containing genes HOXA4 and HOXA7 in human oocytes and cleavage stage embryos up to the 5-cell stage (Verlinsky et al., 1995; Kuliev et al., 1996). The expression of tissuespecific genes in human preimplantation development has also been reported (Daniels et al., 1997). Since only minute quantities of mRNA can be obtained from a single preimplantation embryo, we constructed cDNA libraries from individual blastocysts, which will enable screening for the expression of specific genes as specific probes and/or DNA sequences become available. The construction of cDNA libraries from single human preimplantation embryos has recently been demonstrated (Adjaye et al., 1997). In the present paper we report the results of our study on the construction, screening and sequencing of cDNA libraries from human blastocysts, and demonstrate the presence of mRNA for βactin, CD59 and OCT-3 genes, as well as human histone 3.1 and human ribosome protein S25 cDNA.

Sample collection Human genomic DNA from whole blood was isolated and purified according to the technique of Albarino and Romanowski (1994). Embryos were received from participants of the in-vitro fertilization (IVF) programme at Illinois Masonic Medical Center, Chicago, USA, with informed consent. All of the embryos used would have been otherwise discarded, either because they were haploid, triploid, morphologically abnormal, or were normal supernumary embryos donated for research. All research protocols were approved by the Institutional Review Board at the Illinois Masonic Medical Center.

© European Society for Human Reproduction and Embryology

Embryo lysis and reverse transcription Lysis and DNase treatment of embryos were performed in first strand buffer (Promega, Madison, WI, USA) supplemented with 0.3% NP40. Embryos frozen in 10 µl of deionized water were thawed with addition of buffer containing 0.5 IU of Inhibit-ACE (39→59 Inc, Boulder, CO, USA) and 25 IU of RNAsin (Promega) and incubated at 65°C for 5 min. After adding 2 IU of RNase free DNase (Promega) samples were incubated at 37°C for 30 min, heated to 99°C for 5 min and cooled to 4°C. mRNA was extracted using streptavidin magnetic beads (Promega). The primers for reverse transcription (Lyb-1 or Univ-N6; Figure 1) were added following precipitation with glycogen (Boeringer). As shown in Figure 1, primer Lyb-1 was used in the construction of libraries of 39 ends of cDNAs, and random primer Univ-N6 for randomly distributed fragments of cDNAs. Reverse transcription (RT) was carried out according to Brady et al., (1990). After adding 1 µl (150 ng/µl) of primer Lyb-1 or primer Univ-N6, and 0.5 IU of Inhibit-ACE the reaction mixture was heated to 65°C and slowly cooled to room temperature. Then 1 µl of 200 IU/µl of Moloney reverse transcriptase and dNTP

571

Y.Verlinsky et al.

Figure 1. Principal steps in construction of cDNA libraries. (Promega) (20 µM each) were added, and samples were incubated at 37°C for 1 h, heated to 99°C for 5 min and cooled to 4°C.

Second strand synthesis The library’s 39-ends were constructed by using poly(dG) tailing, using terminal deoxynucleotidyl transferase (TdT; USB Corporation, Cleveland, OH, USA). After adding 20 µl of 53 TdT buffer, and dGTP at a final concentration of 1.5 mM to 50 µl of RT mixture, the samples were diluted with deionized water to a final volume of 100 µl. Then 15 IU of TdT was added and the samples were incubated for 1 h at 37°C, heat inactivated for 10 min at 65°C, cooled using a thermal cycler, and precipitated with glycogen (Boeringer). Random cDNA fragments were constructed using random primer (Univ-N6). The RT products were cooled in an ice bath, incubated for 30 min at 37°C with 1 µl of RNase H (Promega), then

572

incubated for 30 min at 16°C with 1 µl DNA polymerase I (Promega), and precipitated with glycogen. The total yield of mRNA was used for making cDNA. To avoid wastage, the total RNA yield was not evaluated.

Polymerase chain reaction Primers for reverse transcription and PCR were synthesized using an Applied Biosystems 381A DNA Synthesiser (Camden, NJ, USA). The compatibility of primers, the absence of hairpins and primerdimer formation were analysed using the OLIGO program software (Rychlik, 1991). PCR was performed in a Perkin-Elmer cycler under mineral oil with initial denaturation at 94°C for 3 min, followed by cycles of a three step profile: melting at 94°C, annealing at various temperatures for 1 min and elongation at 72°C. Following the last cycle, chain

cDNA libraries from human blastocysts

Table I. Designed primers and conditions for polymerase chain reaction (PCR) Primer

Sequence

Gene

PCR conditions Tannual °C

[MgCl2] mm telongation (min)

Primers for 1st round of PCR to construct libraries of 3’-ends 62 6 3 Lyb-1 GCGCCGCGGCCGC(T)18 Lyb-2 GCCGTCGACGCGT©15 Primers for 2nd round of PCR to construct libraries of 3’-ends Lyb-3 GCGCCGCGGCCGCTT 62 6 3 Lyb-4 CGGAATTCGCCGTGGACGCGTCC Univ-N6 GCCGGAGCTCTGCAGAATTC(N)6 25 Primer for 1st and 2nd round of PCR to construct libraries of randomly distributed cDNA fragments Univ GCCGGAGCTCTGCAGAATTC 47 2.5 1 act-up TCCAGGGCGACGTAGCACAGCTT β-actin 60 2.0 1 act-dn CGACGAGGCCCAGAGCAAGAGA cd59-up CTGCTGACTGCAAAACAGCC CD59 49 2.0 1 cd59-dn CCACCATTTTCAAGCTGTTC mlh-up AGCCTCAGTAAAGAATGCG MLH1 50 2.0 1 mlh-dn ATAAAGGAATACTATCAGAAGGC hlag-up TTCCCAGAGCAGTCTTCC HLA-G 51 2.0 1 hlag-dn GGGATCAGCCTCCTTCG VH4 GGTGTACCCCTGGATGAAG HOXA4 47 2.0 1 DH2 CCGGTTCTGGAACCAGAT pou-up CCAAGCTCCTGAAGCAGAAGAGG OCT-3 49 2.0 1 pou-dn CTTCTGGCGCCGGTTGCAGAAC

Table II. Gene expression in individual human blastocysts identified by polymerase chain analysis (PCR) analysis of DNA from cDNA libraries and reverse transcription (RT) products. To exclude the possibility of contamination by DNA, actin was present in all RT–PCR products using specially designed intronspanning primer sets Blastocysts/ cDNA libraries

Quantity of libraries

cDNA of 3’-ends 6a cDNA of randomly distributed fragments 6b Total 12 aObtained bObtained

Quantity of libraries containing sequences corresponding to genes β-actin

CD59

OCT-3

HOXA4

HLA-G

MLH-1

5 6 11

5 3 8

4 3 7

0 0 0

0 0 0

0 0 0

from one early haploid and five expanded diploid blastocysts. from four diploid (one early, two expanded, and one hatched) and two early triploid blastocysts.

elongation was completed by 8 min incubation at 72°C and cooling to 4°C. The final PCR reaction mixture consisted of 10 mM of Tris– HCl, 80 µM of each dNTP and 1 µM of each primer (primer sequences and conditions of PCR are presented in Table I). Two rounds of PCR amplification of cDNA were performed, the first one consisting of 20, and the second, 25 cycles. After each round of PCR, the amplified cDNA was enriched to a high molecular fraction by chromatography on a Sephacryl S-400 (USB Corporation) minicolumn by a standard method (Sambrook et al., 1989). The total cDNA obtained was amplified. To exclude the possibility of contamination with extraneous DNA, 3 µl of the obtained cDNA was exposed to nested PCR with primers for the CFTR gene, designed for single cell analysis. The absence of PCR product indicated the absence of DNA contamination in all of our reactions. To sort out the failure of amplification from the absence of expression, negative and positive controls were used. mRNA from cultured human fibroblasts served as a positive control for the genes studied.

Insertion of cDNA into the cloning vector cDNA amplified with primer set Lyb3/Lyb4 was digested with the restriction endonucleases NotI and EcoRI and ligated into the λ–gt11 Sfi-Not vector. PCR products obtained using Univ-primer were digested with EcoRI only and ligated into a λ–gt10 vector. Approximately 106 plaque forming units (pfu) were obtained. Restriction

nuclease digestion and ligation were performed according to Sambrook et al. (1989).

Library propagation To propagate the library 50 µl of Packagene extract (Packagene System; Promega) was added to 10 µl of ligated mixture and incubated at room temperature for 3 h. The mixture of assembled phage particles was evaluated for quantity, propagated in BNN102 strain (C600Hfl), and the total phage DNA of each library was isolated and purified by immunoprecipitation (Titus, 1991). Clone analysis Plasmid DNA was propagated by transforming the bacterial strain INV-alphaF9 (Hanahan, 1983) and isolated by the boiling method (Holmes and Quigley, 1982). The PCR-inserts from two of the libraries were sequenced by the dideoxy Sanger method (Sanger et al., 1977) modified for double-stranded DNA (Chen and Seeburg, 1985) using bacteriophage T7 DNA polymerase (Tabor and Richardson, 1987).

Results and Discussion cDNA library construction was successful for 12 of 37 individual human blastocysts at different stages of development 573

Y.Verlinsky et al.

Table III. Sequence analysis of randomly chosen cDNA clones from randomly distributed fragments cDNA libraries Clone no.

Size of insert (kb)

Percentage of identity

Library from blastocyst #11a 32L1 Genomic sequence from human 9q34 32L2 Human calpastatin gene, exon 6 32L4 Mycobacterium phage DS6A 32L7 Human mRNA for phosphomannose 32L9 Human DNA sequence from cosmid U157D4 32L10 Human chromosome 10 clone LA10NCO1 187 B 7 32L11 Human SIL mRNA 32L12 Human DNA from BAC 397C4 on 22q12-qter 32L13 D.melanogaster position specific antigen 32L14 Human PBX2 mRNA 32L15 Human histone 3.1 complete cDNA 32L16 Rats dopamine D1 receptor 32L17 Human gene for arachidonate 12-lipoxygenase 32L20 Human subclone 1d9 from P1 H52 32L22 E.coli Rhs core protein

0.7 0.4 0.4 0.6 0.5 0.4 0.6 0.8 0.2 0.6 0.5 0.2 0.8 0.3 2.2

69 65 63 67 62 60 61 64 65 71 .99 60 66 69 64

Library from blastocyst #9b 12L4 Guinea pig pro-opiomelanocortin 12L5 Bacterial sp. 16S rRNA gene 12L6 Mice lunatic fringe precursor mRNA 12L8 Human ribosomal protein S25 12L9 Human nebulin mRNA 12L10 Sequence 7 from patent US 5571675 12L11 Human chromosome X clone Q115B1 12L12 Hartigia frimaculata mitochondrial cytochrome oxidase I 12L13 Human BAC clone RG126M09 12L15 Genome fragment of H. influenzae 12L17 Drosophila melanogaster telomere 2L 12L18 Human mRNA for Ah receptor 12L20 Human germ-line T-cell receptor 12L23 Human DNA for immunoglobuline light chain 12L26 S.coelicolor redZ gene

0.8 o.4 0.9 0.2 1.1 0.8 0.3 0.3 0.1 0.6 0.8 0.8 1.2 0.5 0.7

71 68 69 .99 70 73 68 77 65 71 69 66 67 72 68

aFrom bFrom

Most homologous sequence

normal diploid blastocyst. morphologically normal triploid blastocyst.

(four from early, seven from expanded, and one from hatched blastocysts). The results of PCR analysis of the RT–PCR products and the library cDNA are summarized in Table II. As expected most embryos (11 blastocysts) showed the presence of mRNA for β-actin, which is a basic part of the cytoskeleton of all cells and is known to be expressed in relatively large quantities (Gilbert, 1994). Eight blastocysts showed the presence of mRNA for CD59, which is membrane attack complex inhibitory factor shown to be expressed in human blastocyst by immunocytochemical staining (Taylor and Johnson, 1996). The RT–PCR product of seven blastocysts revealed mRNA of OCT-3, which is in agreement with earlier report by Okamoto et al. (1990). The presence of OCT-3 was also reported by Abdel Rahman et al. (1995), although in this case the possibility of DNA contamination cannot be excluded, as the human OCT-3 gene has at least one pseudogene (Takeda et al., 1992). All three of these genes (OCT-3, β-actin and CD59) were present in only six of 12 blastocysts, while none revealed mRNA for HOXA4, HLA-G and MLH-1 genes in spite of the use of specially designed intron-spanning primer sets. This is in agreement with our previous observation of the absence of mRNA for HOXA4 and HOXA7 in human preimplantation embryos after the 5-cell stage (Verlinsky, 574

1995; Kuliev, 1996). The HLA-G gene, a possible human homologue of the mouse preimplantation embryo development (Ped) gene, was also absent, contrary to the mouse data (Xu et al., 1994). The absence of mRNA for MLH1 was also contrary to our expectation, as the product of this gene is involved in the mitotic spindle formation (Papadopoulos, 1994). The results of our analysis of two of the cDNA libraries are presented in Table III. Most of the clones contained inserts with size variation from 0.2 to 2.2 kb. The average size of inserts (~0.8 kb) is as expected, since the technique used is biased toward smaller inserts (Rebel et al., 1995; Corrick et al., 1996). These inserts were subcloned into a plasmid vector pUC18 and partially sequenced. The results of PCR analysis in comparison with genomic DNA are shown in Figure 2. The sequence data obtained were compared with DNA sequences databases (ENTREZ Document Retrieval System, 1996; Table III), showing a limited homology to known sequences, except for a strong identity (.99%) for human histone 3.1 and human ribosome protein S25. These data and also findings of mRNA for β-actin, CD59 and OCT3, demonstrate the feasibility of constructing cDNA libraries from individual human preimplantation embryos,

cDNA libraries from human blastocysts

Figure 2. Electrophoresis of polymerase chain reaction (PCR) products derived from total DNA of cDNA library #32 and from genomic DNA using primer sets designed to different genes. Lanes 1–123 ladder, then PCR products derived in reactions with: 2 5 library DNA, primers for β-actin; 3 5 genomic DNA, primers for β-actin; 4 5 library DNA, primers for OCT-3; 5 5 genomic DNA, primers for OCT-3; 6 5 library DNA, primers for CD59; 7 5 genomic DNA, primers for CD59; 8 5 library DNA, primers for HOXA4; 9 5 genomic DNA, primers for HOXA4; 10 5 library DNA, primers for MLH1; 11 5 genomic DNA, primers for MLH1; 12 5 library DNA, primers for HLA-G; 13 5 genomic DNA, primers for HLA-G. The bands in lanes 7 and 13 are absent because the expected size of PCR products from genomic DNA is too large due to size of corresponding intron. The 123 ladder was obtained from Gibco BRL (Grand Island, NY, USA; cat. no. 15613-011). The size of the DNA markers were: 123, 246, 369 bp etc. The agarose gel was 1.2% ethidium bromide inverted.

which might be useful for the assessment of the relevance of specific gene expression in the failures of preimplantation development.

of cDNAs expressed during early human development. Genomics, 39, 104–108. Kidder, G.M. (1992) The genetic program for preimplantation development. Dev. Genet., 13, 319–325. Kuliev, A., Kukharenko, V., Morozov, G. et al. (1996) Expression of homeobox-containing genes in human preimplantation development and in embryos with chromosomal aneuploidies. J. Assist. Reprod. Genet., 13, 177–181. Okamoto, K., Okazawa, H., Okuda, A. et al. (1990) A novel octamer binding transcription factor is differentially expressed in mouse embryonic cells. Cell, 60, 461–472. Papadopoulos, N., Nicolaides, N.C., Wei, Y.-F. et al. (1994) Mutation of a mutL homolog in hereditary colon cancer. Science, 263, 1625–1629. Rebel, F., Renard, J.-P. and Duranthon, V. (1995) PCR-generated cDNA libraries from reduced numbers of mouse oocytes. Zygote, 3, 241–250. Rothstein, J.L., Johnson, D., Deloia, J.A. et al. (1992) Gene expression during preimplantation mouse development. Genes Dev., 6, 1190–1201. Rychlik, W. (1991) OLIGO 4.1 Primer Analysis Software Sambrook, J., Fritch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. 2nd edn. Cold Spring Harbor, Cold Spring Harbor Laboratory Press. Sanger, F., Nicklent, S. and Coulson, A.R. (1977) DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA, 74, 5463–5467. Tabor, S. and Richardson, C.C. (1987) DNA sequence analysis with a modified bacteriphage T7 DNA polymerase. Proc. Natl. Acad. Sci. USA, 84, 4767–4771. Takeda, J., Seino, S. and Bell, G.I. (1992) Human Oct3 gene family: cDNA sequence, alternative splicing, gene organization, chromosomal location, and expression at low level in adult tissues. Nucl. Acids Res., 20, 4613–4620. Taylor, C.T. and Johnson, P.M. (1996) Complement-binding proteins are strongly expressed by human preimplantation blastocysts and cumulus cells as well as gametes. Mol. Hum. Reprod., 2, 52–59. Titus, D. (1991) Promega Protocols and Application Guide. Promega Co. Verlinsky, Y., Morozov, G., Gindilis, V. et al. (1995) Homeobox gene expression in human oocytes and preembryos. Mol. Reprod. Dev., 41, 127–132. Xu, Y., Jin, P., Mellor, A.L. and Warner, C.M. (1994) Identification of the Ped gene at the molecular level: the Q9 MHC class I transgene converts the Ped slow to the Ped fast phenotype. Biol. Reprod., 51, 695–699. Received on November 18, 1997; accepted on March 23, 1998

References Abdel-Rahman, B., Fiddler, M., Rappolee, D. and Pergament, E. (1995) Expression of transcription regulating genes in human preimplantation embryos. Hum. Reprod., 10, 2787–2792. Adjaye, J., Daniels, R., Bolton, V. and Monk, M. (1997) cDNA libraries from single human preimplantation embryos. [Abstr. no. O-046] Hum. Reprod., 12 (Abstr. Book 1), 22. Albarino, C.G. and Romanowski, V. (1994) Phenol extraction revisited: a rapid method for the isolation and preservation of human genomic DNA from whole blood. Mol. Cell. Probes, 8, 423–427. Brady, G., Barbara, M. and Iscove, N. (1990) Representative in vitro cDNA amplification from individual hematopoietic cells and colonies. Methods Mol. Cell. Biol., 2, 17–25. Campbell, S., Swann, H.R., Seif, M.W. et al. (1995) Cell adhesion molecules on the oocyte and preimplantation human embryo. Hum. Reprod., 10, 1571–1578. Chen, E.Y. and Seeburg, P.H. (1985) Supercoil sequencing: a fast and simple method for sequencing plasmid DNA. DNA, 4, 165–170. Corrick, C.M., Silvestro, M.J., Lahoud, M.H. et al. (1996) Construction of a mouse blastocyst cDNA library by PCR amplification from total RNA. Mol. Reprod. Dev., 43, 7–16. Daniels, R. Lowell, S., Bolton, V. and Monk, M. (1997) Transcription of tissue-specific genes in human preimplantation embryos. Hum. Reprod., 12, 2251–2256. ENTREZ Document Retrieval System (1996) ENTREZ Document Retrieval System. National Center for Biotechnology Information, Bethesda, USA. Gilbert, S.F. (1994) Developmental Biology. Sinauer Ass. Inc., Sunderland. Hanahan, D. (1983) Studies on transformation of Escherichia coli plasmids. J. Mol. Biol., 166, 557–580. Holmes, D.S. and Quigley, M. (1982) A rapid boiling method for the preparation of bacterial plasmids. Anal. Biochem., 114, 193–197. Jay, P., Diriong, S., Taviaux, S. et al. (1997) Isolation and regional mapping

575