J. Eukaryot. Microbiol., 53(1), 2006 pp. 20–25 r 2006 The Author(s) Journal compilation r 2006 by the International Society of Protistologists DOI: 10.1111/j.1550-7408.2005.00068.x
Intraspecific Genetic Variation in Paramecium Revealed by Mitochondrial Cytochrome c Oxidase I Sequences DANA BARTH,a SASCHA KRENEK,a SERGEI I. FOKINb,1 and THOMAS U. BERENDONKa Molecular Evolution and Animal Systematics, Institute of Biology II, University of Leipzig, 04103 Leipzig, Germany, and b Dipartimento Etologia, Ecologia ed Evoluzione, Universita` di Pisa, 56126 Pisa, Italy
a
ABSTRACT. Studies of intraspecific genetic diversity of ciliates, such as population genetics and biogeography, are particularly hampered by the lack of suitable DNA markers. For example, sequences of the non-coding ribosomal internal transcribed spacer (ITS) regions are often too conserved for intraspecific analyses. We have therefore identified primers for the mitochondrial cytochrome c oxidase I (COI) gene and applied them for intraspecific investigations in Paramecium caudatum and Paramecium multimicronucleatum. Furthermore, we obtained sequences of the ITS regions from the same strains and carried out comparative sequence analyses of both data sets. The mitochondrial sequences revealed substantially higher variation in both Paramecium species, with intraspecific divergences up to 7% in P. caudatum and 9.5% in P. multimicronucleatum. Moreover, an initial survey of the population structure discovered different mitochondrial haplotypes of P. caudatum in one pond, thereby demonstrating the potential of this genetic marker for population genetic analyses. Our primers successfully amplified the COI gene of other Paramecium. This is the first report of intraspecific variation in freeliving protozoans based on mitochondrial sequence data. Our results show that the high variation in mitochondrial DNA makes it a suitable marker for intraspecific and population genetic studies. Key Words. Genetic diversity, intraspecific variation, mitochondrial DNA, Paramecium caudatum, Paramecium multimicronucleatum.
from P. aurelia (Pritchard et al. 1990), Tetrahymena pyriformis (Burger et al. 2000), and Tetrahymena thermophila (Brunk et al. 2003) are available in GenBank. To our knowledge, despite initial studies on sequence diversity in mtDNA (Pritchard et al. 1983; Seilhamer, Gutell, and Cummings 1984; Seilhamer, Olsen, and Cummings 1984), no attempt has been made to utilize mitochondrial sequences to study intraspecific variation in ciliates. This could be attributed to a general disadvantage of rapidly evolving markers: primer design can be elaborate and once developed, application of the primers is often restricted to one species only. However, RFLP analyses of mtDNA revealed intraspecific divergences of 1–2% in Paramecium tetraurelia (Cummings 1980) and 1–8% in Paramecium caudatum (Tsukii 1994). This illustrates the great potential of mtDNA to investigate genetic variation at the intraspecific level. Although Paramecium is among the best studied of ciliates, there is still intensive research on the taxonomy and distribution of this diverse genus (Fokin et al. 2004). Some Paramecium species, such as P. caudatum, are distributed worldwide and therefore represent unique objects to investigate the genetic structure of a species, which has experienced several ice ages and extremely diverse environmental variation. In the present study, we developed primers for the mitochondrial cytochrome c oxidase I (COI) gene and used it to investigate intraspecific variation in strains of P. caudatum and Paramecium multimicronucleatum from different localities and compared this to genetic variation using ITS sequences. From one pond in Germany, we sequenced multiple clones of P. caudatum to determine the potential of COI gene sequences at the intrapopulation level. Furthermore, we tested the mitochondrial primers in other species of the genus Paramecium.
T
O understand the mechanisms that cause and maintain genetic diversity in natural populations has been one of the main aims of biologists for years. The focus on intraspecific genetic diversity in a variety of organisms has played a central role in the endeavour to elucidate these mechanisms. The importance of this approach has been documented numerous times in studies of phylogeography and evolutionary and conservation biology (Emerson and Hewitt 2005 and references therein). Probably, because of the lack of suitable DNA markers, such studies on free-living protists are comparatively rare. The few studies on ciliates include, for example, those by Kusch (1998), Przybos, Skotarczak, and Wodecka (2003), and Stoeck et al. (2000), who used random amplified polymorphic DNA (RAPD) as a molecular tool for the investigation of intraspecific diversity in ciliates. RAPD fingerprints have proven to be suitable instruments for the identification of the morphologically indistinguishable sibling species of the Paramecium aurelia complex (Stoeck and Schmidt 1998). However, in the context of data analysis, RAPD data are clearly inferior to sequence data, which is partly attributed to the restricted number of possible characters analyzed in RAPD fingerprints. Moreover, the interpretation of RAPD data for phylogenetic or phylogeographic questions is somewhat problematic (Foissner et al. 2001; Stoeck et al. 2000). Sequences of the non-coding and thus more variable internal transcribed spacers (ITS) localized between the nuclear ribosomal genes are occasionally used for investigations of intraspecific genetic variation in ciliates (Coleman 2005; Diggles and Adlard 1997; Miao et al. 2004; Wright 1999). While some authors detected intraspecific variation using ITS data (Diggles and Adlard 1997; Miao et al. 2004), others obtained identical sequences even between strains from very distant localities (Coleman 2005; Wright 1999; this study). Compared with nuclear DNA, mitochondrial (mt)DNA is characterized by its increased rate of sequence evolution and the high copy number of mtDNA molecules per cell (Rand 2001). Because of these special features, mtDNA has become the marker of choice for analyses at the phylogeographic and low taxonomic level in animals. To date, the complete mitochondrial sequences
MATERIALS AND METHODS Sampling and DNA isolation. Paramecium caudatum and P. multimicronucleatum were collected from eight different geographic localities (Table 1). From one pond near Leipzig, Germany (‘‘Schwemmteich’’ Machern, 51121 0 N, 12138 0 E), seven clones of P. caudatum were sequenced. Paramecium tetraurelia (stock 51) and Paramecium schewiakoffi were used as outgroups for the reconstruction of phylogenetic trees. Clonal cultures were maintained in modified Cerophyl Infusion (Sonneborn 1970) inoculated with Enterobacter aerogenes, Wheat Grass Powder was purchased from GSE Vertrieb GmbH (Saarbru¨cken, Germany). For DNA extraction, four to six cells
Corresponding Author: D. Barth, Molecular Evolution and Animal Systematics, Institute of Biology II, University of Leipzig, 04103 Leipzig, Germany—Telephone number: 149-341-9736743; FAX number: 149-341-9736789; e-mail:
[email protected] 1 Permanent Address: Sankt-Petersburg State University, 199034, St. Petersburg, Russia.
20
21
BARTH ET AL.—MITOCHONDRIAL DNA VARIATION IN PARAMECIUM Table 1. Specifications of the Paramecium clones used in the phylogenetic analyses. Clonal lineage
Abbreviation
Geographic origin
COI haplotype
GenBank Accession numbers COI
P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P.
caudatum CTJ-P-1 caudatum ASN-1 caudatum IN11-05 caudatum GMA-1 caudatum IP3-1 caudatum ISN-10 caudatum GPL-1 caudatum GLM-1 caudatum GLM-2 multimicronucleatum multimicronucleatum multimicronucleatum multimicronucleatum multimicronucleatum multimicronucleatum multimicronucleatum multimicronucleatum schewiakoffi Sh1-38 tetraurelia Stock 51
AS-3 GMA-2 IP-10 AH1-5 ISN-11 IN-1 GS3-1 BSP-7
Pc1 Pc2 Pc3 Pc4 Pc5 Pc6 Pc7 Pc8 Pc9 Pm1 Pm2 Pm3 Pm4 Pm5 Pm6 Pm7 Pm8 Ps Pt
China, Tianjin Australia, Ourimbah Italy, Naples Germany, Martinfeld Italy, Pisa Italy, Sicily Germany, Plo¨n Germany, Leipzig Germany, Leipzig Australia, Sydney Germany, Martinfeld Italy, Pisa USA, Hawaii Italy, Sicily Italy, Naples Germany, Stuttgart Brasilia, Rio China, Shanghai Unknown
from each clonal culture were thoroughly washed in Eau de Volvics and then incubated overnight with 100 ml of 10% Chelexs solution and 10 ml Proteinase K (10 mg/ml) at 56 1C. For single-cell extractions, only 30 ml of 10% Chelexs solution and 3 ml Proteinase K (10 mg/ml) were used. Afterwards the mixture was boiled for 20 min and the supernatant was used for subsequent PCR reactions. Amplification and sequencing of the ITS regions. A fragment of 500 bp, containing the ITS-1, the 5.8S ribosomal gene, and the ITS-2, was amplified using the primers ITS-F and ITS-R located in the 5 0 region of the 18S rDNA and the 3 0 region of the 28S rDNA, respectively (Table 2). Each reaction mix contained 10 ml of Chelexs extracted genomic DNA, 10 pmol of each primer, 1 U Taq-polymerase (SIGMA, Taufkirchen, Germany), 1 PCR buffer with 2 mM MgCl2 and 200 mM dNTPs in a total volume of 50 ml. Polymerase chain reaction conditions for the ITS fragments were as follows: 5 min initial denaturation (95 1C), followed by 35 cycles of 1 min at 95 1C, 1 min at 55 1C, and 90 s at 72 1C, with a final extension of 5 min (72 1C). After purification with the Rapid PCR Purification System (Marligen Bioscience, Ijamsville, USA) PCR products were directly sequenced. Sequencing reactions were performed in both directions and analyzed on an ABI 3100 Genetic Analyzer (Applied Biosystems). Amplification and sequencing of mitochondrial DNA fragments. Initial primers were designed using aligned sequences of the COI gene from P. tetraurelia (Acc. No. NC001324) and T. pyriformis (Acc. No. NC000862). Short stretches of identical Table 2. Primers developed for this study. Primer ITSF ITSR CauCoxF CauCoxR CoxL11058 CoxH10176
Location
Sequence
3 0 of 18S rRNA gene 5 0 of 28S rRNA gene 11080 of P. aurelia mt genome 10139 of P. aurelia mt genome 11058 of P. aurelia mt genome 10176 of P. aurelia mt genome
cgtaacaaggtttccgtagg tcctccgcttactgatatgc tcaggagctgcmttagctccyatg tartataggatcmccwccataagc tgattagactagagatggc gaagtttgtcagtgtctatcc
PcCOI_b01 PcCOI_b02 PcCOI_a01 PcCOI_a01 PcCOI_a01 PcCOI_a02 PcCOI_a04 PcCOI_a05 PcCOI_a03 PmCOI_b1_01 PmCOI_b1_01 PmCOI_b1_01 PmCOI_a1_01 PmCOI_a1_02 PmCOI_a2_01 PmCOI_a2_01 PmCOI_a3_01 PsCOI_a01 PtCOI51
AM072774 AM072775 AM072776 AM072777 AM072778 AM072779 AM072780 AM072781 AM072782 AM072765 AM072766 AM072767 AM072768 AM072769 AM072770 AM072771 AM072772 AM072773 NC001324
ITS AM072791 AM072790 AM072786 AM072787 AM072785 AM072784 AM072783 AM072788 AM072789 AM072798 AM072797 AM072799 AM072794 AM072795 AM072792 AM072796 AM072793 AM072800 AM072801
amino acid sequences were interpreted as conserved gene regions over a relatively wide taxonomic range. The corresponding nucleotide positions were used to design the degenerate PCR primers CauCoxF and CauCoxR (Table 2). With these first primers we obtained weak PCR signals of the expected length, using only high concentrations of genomic DNA. Direct sequencing with those degenerate primers yielded unreadable sequences. Hence we cloned these PCR products from two species (P. caudatum and P. multimicronucleatum) into a TOPO cloning vector (Invitrogen, Karlsruhe, Germany) and sequenced with standard vector primers. Based on the sequences obtained, we designed the new primers CoxL11058 and CoxH10176, which amplified an 880-bp fragment of the mitochondrial COI gene (for primer specifications, see Table 2). Components of the PCR reactions were as in the ITS amplification (see above). PCR conditions were: 5 min initial denaturation (95 1C), followed by 35 cycles of 1 min at 95 1C, 1 min at 50 1C, and 45 s at 72 1C, then a final extension step of 5 min (72 1C). To rule out that sequence differences within the population of P. caudatum in Leipzig are because of amplification of different copies of the COI gene within one Paramecium clone (mitochondrial heteroplasmy), we conducted a single cell PCR (components and conditions see above) for both strains (GLM-1, GLM-2). Polymerase chain reaction products were cloned into a TOPO vector (Invitrogen, Karlsruhe, Germany) and 10 colonies from each strain were picked and sequenced with standard vector primers. Sequence analyses. Alignments of the ITS and COI datasets were carried out using CLUSTAL X 1.8 (Thompson et al. 1997). The program MEGA, v. 3.0 (Kumar et al. 2001) was used to estimate genetic distances and to calculate sequence statistics. All phylogenetic analyses were carried out with PAUP 4.0 b10 (Swofford 2002). To find the most appropriate model of DNA substitution for the maximum likelihood (ML) calculations, we carried out hierarchical likelihood ratio tests of both the ITS and COI data sets with the program Modeltest 3.06 (Posada and Crandall 1998). For the ITS data set, the model of Tamura and Nei (1993) was chosen, whereas the GTR model (Rodriguez et al. 1990)1G (shape parameter 5 14.1612)1I (I 5 0.5389) proved to be the best-fitting model of sequence evolution for the COI data set. In the maximum parsimony and ML calculations, the heuristic search method was invoked with 100 random stepwise additions and the TBR branch-swapping algorithm. Gaps were treated as
22
J. EUKARYOT. MICROBIOL., VOL. 53, NO. 1, JANUARY– FEBRUARY 2006
Table 3. Pairwise genetic distances between the investigated Paramecium clones.
Pm1 Pm2 Pm3 Pm4 Pm5 Pm6 Pm7 Pm8 Pc1 Pc2 Pc3 Pc4 Pc5 Pc6 Pc7 Pc8 Pc9 Ps Pt
Pm1
Pm2
Pm3
Pm4
Pm5
Pm6
Pm7
Pm8
Pc1
Pc2
Pc3
Pc4
Pc5
Pc6
Pc7
Pc8
Pc9
Ps
Pt
— 0 0 8.6 8.5 9.5 9.5 8.6 13.3 13.7 13.6 13.6 13.6 13.7 14.0 13.7 13.7 27.2 25.3
0.2 — 0 8.6 8.5 9.5 9.5 8.6 13.3 13.7 13.6 13.6 13.6 13.7 14.0 13.7 13.7 27.2 25.3
0.2 0 — 8.6 8.5 9.5 9.5 8.6 13.3 13.7 13.6 13.6 13.6 13.7 14.0 13.7 13.7 27.2 25.3
2.4 2.2 2.2 — 0.1 4.7 4.7 5.0 12.8 13.7 12.0 12.0 12.0 12.1 12.4 12.1 12.0 23.6 23.6
2.4 2.2 2.2 0 — 4.6 4.6 4.8 12.6 13.6 11.9 11.9 11.9 12.0 12.3 12.0 11.9 23.5 23.7
2.4 2.2 2.2 0 0 — 0 6.1 14.5 15.1 12.8 12.8 12.8 12.6 13.2 12.9 12.6 24.0 22.9
2.4 2.2 2.2 0 0 0 — 6.1 14.5 15.1 12.8 12.8 12.8 12.6 13.2 12.9 12.6 24.0 22.9
2.4 2.2 2.2 0 0 0 0 — 13.3 13.7 12.4 12.4 12.4 12.5 12.8 12.4 12.4 25.0 25.9
8.2 8.0 8.0 7.8 7.8 7.8 7.8 7.8 — 1.2 6.2 6.1 6.1 6.3 6.5 6.0 6.1 23.6 24.0
8.2 8.0 8.0 7.8 7.8 7.8 7.8 7.8 0 — 6.5 6.5 6.5 6.6 6.9 6.4 6.5 24.0 24.0
8.2 8.0 8.0 7.8 7.8 7.8 7.8 7.8 0 0 — 0 0 0.1 0.4 0.1 0.3 24.1 23.4
8.2 8.0 8.0 7.8 7.8 7.8 7.8 7.8 0 0 0 — 0 0.1 0.4 0.1 0.3 24.4 23.4
8.2 8.0 8.0 7.8 7.8 7.8 7.8 7.8 0 0 0 0 — 0.1 0.4 0.1 0.3 24.4 23.4
8.2 8.0 8.0 7.8 7.8 7.8 7.8 7.8 0 0 0 0 0 — 0.5 0.3 0.4 24.3 23.3
8.2 8.0 8.0 7.8 7.8 7.8 7.8 7.8 0 0 0 0 0 0 — 0.5 0.7 24.4 23.6
8.2 8.0 8.0 7.8 7.8 7.8 7.8 7.8 0 0 0 0 0 0 0 — 0.4 24.5 23.3
8.2 8.0 8.0 7.8 7.8 7.8 7.8 7.8 0 0 0 0 0 0 0 0 — 24.1 23.2
6.9 6.7 6.7 6.2 6.2 6.2 6.2 6.2 6.2 6.2 6.2 6.2 6.2 6.2 6.2 6.2 6.2 — 19.8
7.6 7.3 7.3 6.9 6.9 6.9 6.9 6.9 6.0 6.0 6.0 6.0 6.0 6.0 6.0 6.0 6.0 1.1 —
Abbreviations of the clonal lineages are as in Table 1. Lower left, mitochondrial COI distances; upper right, nuclear ITS distances.
missing data. Neighbor-joining trees were constructed with the Tamura and Nei model (Tamura and Nei 1993). Additionally, the Kimura-2-parameter (Kimura 1980) and the HKY85 model (Hasegawa, Kishino, and Yano 1985) were used, which yielded the same tree topologies and nearly identical bootstrap values. Bootstrap analyses (Felsenstein 1985) with 1,000 replicates were used to examine the robustness of the resulting bifurcations within each phylogenetic analysis. RESULTS Sequences of the complete nuclear ribosomal ITS-1–5.8S rDNA–ITS-2 region and part of the COI gene were obtained from different clones of P. caudatum and P. multimicronucleatum and one of each P. tetraurelia and P. schewiakoffi for outgroup comparisons (see Table 1 for accession numbers). ITS sequence analysis. The length of the ITS sequences were a constant 450 bp within P. multimicronucleatum and 451 bp for P. caudatum. The ITS fragments of the outgroup taxa P. schewiakoffi and P. tetraurelia were 450 bp in length. The mean sequence divergence between P. multimicronucleatum and P. caudatum was 7.9%, including three insertions/deletions, and ranged from 7.8–8.2% (Table 3). Within P. caudatum, all ITS sequences were identical, leading to one single unresolved clade in the distance tree (Table 3, Fig. 1). The ITS data for P. multimicronucleatum revealed two well-supported clades (PM_a; PM_b), separated by approximately 2% sequence divergence (Table 3, Fig. 1). Clade PM_a contained identical sequences of the strains from Brasilia, Hawaii, Stuttgart (Germany), Naples, and Sicily (Italy). Within clade PM_b the sequences from Pisa and Martinfeld (Thuringia, Germany) were identical, whereas the Australian sequence differed from the former by one additional transition. Mitochondrial sequence analysis. A portion of 767 bp from the mitochondrial COI gene was used for the sequence analyses. The corresponding sequence of P. tetraurelia from GenBank (NC001324) consisted of 764 bp only, indicating the deletion of one amino acid position in this species. Compared with the ITS data, the mitochondrial data revealed considerably higher sequence divergence within and between the investigated Paramecium species (Table 3, Fig. 2). Between P. multi-
micronucleatum and P. caudatum the mean sequence divergence was 13.2%, ranging from 11.9 to 14.5% (Table 3). Within P. caudatum two well-supported clades (haplogroups) appeared with a high interhaplogroup divergence of up to 7%. Clade PC_a contained the sequences from Sicily, Pisa, Leipzig, Martinfeld, Naples, and Plo¨n, whereas clade PC_b consisted of the sequences from China and Australia (Fig. 2). The intrahaplogroup diversity (Table 3), on the other hand, was low in P. caudatum, never exceeding 1.2%. Within P. multimicronucleatum, the same two clades as in the ITS analyses were obtained. Within clade PM_b the sequences from Pisa, Australia, and Martinfeld (Thuringia, Germany) were identical, whereas there was up to 6% intrahaplogroup diversity within clade PM_a (Table 3, Fig. 2). In P. caudatum translation of the mitochondrial sequences into amino acids yielded identical amino acid sequences, except one substitution in the Australian clone. In P. multimicronucleatum, the amino acid sequences were identical within the clades PM_a and PM_b, and differed at 6 positions between the two clades. Within population structure. As an initial approach to study the genetic structure within ciliate populations, we investigated seven clonal lineages of P. caudatum from one pond in Leipzig. Two distinct mitochondrial haplotypes were obtained, which differed at three nucleotide positions. Three of the clones belong to the haplotype PcCOI_a05, four to haplotype PcCOI_a03 (Fig. 2). Subsequent cloning of single cell PCR products from two strains (GLM-1 representing haplotype PcCOI_a05, GLM-2 representing haplotype PcCOI_a03) revealed, that despite some sequence variation within single cells the detected differences between these strains, using direct sequencing, were consistent. Primer utility in other Paramecium species. The primers CoxL11058 and CoxH10176, originally developed for P. caudatum and P. multimicronucleatum, also amplified COI in P. schewiakoffi (Fig. 2). These primers also yielded strong PCR signals of the expected length for P. nephridiatum, P. jenningsi, P. putrinum, and P. bursaria (data not shown). DISCUSSION In order to identify a highly variable genetic marker for studies on intraspecific relationships in the ciliate genus Paramecium, we developed a set of PCR primers for the mitochondrial COI gene.
BARTH ET AL.—MITOCHONDRIAL DNA VARIATION IN PARAMECIUM
23
Fig 1. Neighbor-joining tree of relationships between isolates of Paramecium caudatum and Paramecium multimicronucleatum inferred from nuclear ITS1–5.8S rRNA–ITS2 sequences. Paramecium tetraurelia and Paramecium schewiakoffi served as outgroups. The numbers at the nodes represent bootstrap values out of 1,000 resamplings in the neighbor-joining analysis using the Tamura–Nei model (first number), maximum parsimony (second number), and maximum likelihood analysis using the Tamura–Nei model (third number).
The high variation of mtDNA is well known, and mtDNA sequences have been frequently used to study metazoan intraspecific genetic variation, but no such investigations have been carried out in ciliates so far. The sequence analysis of the COI data from P. caudatum and P. multimicronucleatum demonstrated a considerable intraspecific divergence within both species. Compared with the ribosomal ITS data, which Diggles and Adlard (1997), Miao et al. (2004), and Wright (1999) also used for intraspecific analyses in ciliates, the mtDNA sequences revealed a much higher variation. Irrespective of the high evolutionary rate of mtDNA, this may be explained by the fact that homogenizing effects, such as conjugation, influence nuclear genetic variation only, whereas the mtDNA is usually excluded from these processes (Sainsard-Chanet and Cummings 1988). Therefore, the potential for intraspecific divergence is much higher in mtDNA. Despite the high evolutionary rate of mtDNA, the primers amplified COI in some more distantly related Paramecium species. This suggests that the strategy of amplification with degenerate primers, cloning and sequencing, and design of species-specific primers should also work in other ciliate species, at least within the genus Paramecium. The increased rate of sequence evolution of the mtDNA is particularly well demonstrated in the divergence between P. tetraurelia and P. schewiakoffi. Both species belong to the P. aurelia subgroup and are quite closely related (Fokin et al. 2004). The ITS
(this study) as well as the previously published 18S rDNA distances between both species (Fokin et al. 2004) are very low (1.1%), whereas the genetic distance analyzed with COI reaches nearly 20%. Our analyses show that the mtDNA displays an appropriate resolution for questions at the species or species complex level. The clonal lineages of P. caudatum were indistinguishable using ITS data, but they belong by no means to the same genotype when the mitochondrial data are considered. Interestingly, the COI gene is variable within one single population of P. caudatum in Leipzig. Our initial investigation on only seven clones discovered two distinct mitochondrial haplotypes. Further investigations comprising more clones must be carried out for a reliable statement about the population structure, but the first results resemble those of Kusch (1998) whose study of Stentor coeruleus populations revealed between one and four RAPD genotypes in one pond. This suggests that the ciliate populations of a local habitat consist of more than one genotype or haplotype and that clonal reproduction next to sexual processes may play an important role in natural habitats (Schlegel and Meisterfeld 2003). Nevertheless, the knowledge of the genetic variation in free-living protists is very limited and urgently requires further investigations. The ITS sequences, as well as the mitochondrial sequences, demonstrate a higher genetic divergence within P. multimicronucleatum compared with P. caudatum. Nanney et al. (1998) investigated partial large subunit (LSU) ribosomal
24
J. EUKARYOT. MICROBIOL., VOL. 53, NO. 1, JANUARY– FEBRUARY 2006
Fig 2. Neighbor-joining tree of relationships between isolates of Paramecium caudatum and Paramecium multimicronucleatum inferred from mitochondrial cytochrome c oxidase I (COI) sequences. Paramecium tetraurelia and Paramecium schewiakoffi served as outgroups. The numbers at the nodes represent bootstrap values out of 1,000 resamplings in the neighbor-joining analysis using the Tamura–Nei model (first), maximum parsimony (second), and maximum likelihood analysis using the GTR1G1I (shape parameter 5 14.1612; proportion of invariable sites 5 0.5389) model (third number).
sequences from four clones of each of P. multimicronucleatum and P. caudatum, and also found a substantially higher variation within P. multimicronucleatum. As neither of the studies is based on a representative worldwide sample of Paramecium clones, a taxonomic interpretation of these results would be premature. Nonetheless, the following taxonomic problem may be noted: The occurrence of morphologically indistinguishable syngens or sibling species is a common feature of the genus Paramecium. The most familiar example is the P. aurelia species complex. However, P. caudatum and P. multimicronucleatum were also thought to consist of different syngens (Sonneborn 1957; Wichtermann 1986). Several genetic studies on the intraspecific variation of P. caudatum were carried out (Khadem and Gibson 1985; Stoeck et al. 2000; Tsukii 1994), and Stoeck et al. (2000) finally rejected the syngen concept for this species on the basis of RAPD and ARDRA analyses. Paramecium multimicronucleatum, on the other hand, is still thought to consist of five syngens (Allen, Adams, and Rushford 1983; Sonneborn 1957; Wichtermann 1986). As we do not know to which syngens our clones belong, the higher intraspecific variation of P. multimicronucleatum may be attributed to the fact that our samples belong to more than one syngen. This assumption is supported by the fact that the ITS genetic distances between the two clades of P. multimicronucleatum are as high as the distances between the most divergent P. aurelia species in the ITS analysis of Coleman (2005). However, only future investigations of our clones, including mating tests with identified syngens,
will answer this question. These results indicate that the COI gene could also serve as a tool to identify possible syngens within Paramecium species. Our data confirm the assumption that the COI gene would be a suitable identification system for the current barcoding effort of the animal life (Hebert et al. 2003). However, further studies are urgently called for to test if the intraspecific variation of the COI gene within ciliates allows a clear assignment between gene sequence and species identity. In summary, the data clearly show the great potential of mtDNA analyses for free-living protists such as ciliates. Already a widely distributed tool in other organisms for the analysis of intraspecific variation, here we demonstrated the exceptional intraspecific resolution of COI sequences in P. caudatum and P. multimicronucleatum. This opens up a rich field for new investigations, which will potentially further our understanding of the phenotypic plasticity and local adaptation of these organisms, which are more widely distributed on Earth than many other species.
ACKNOWLEDGMENTS We thank Martin Schlegel for valuable suggestions to the manuscript and D. Sommerfeldt for finding and correcting faults in the English of the manuscript. The work was supported by the Deutsche Forschungsgemeinschaft (DFG) Schwerpunktprogramm AQUASHIFT (BE 2299/3-1).
BARTH ET AL.—MITOCHONDRIAL DNA VARIATION IN PARAMECIUM
LITERATURE CITED Allen, S. L., Adams, J. & Rushford, C. L. 1983. Interspecies relationships in the Paramecium aurelia complex: acid phosphatase variation. J. Protozool., 30:143–147. Brunk, C. F., Lee, L. C., Tran, A. B. & Li, J. L. 2003. Complete sequence of the mitochondrial genome of Tetrahymena thermophila and comparative methods for identifying highly divergent genes. Nucleic Acids Res., 31:1673–1682. Burger, G., Zhu, Y., Littlejohn, T. G., Greenwood, S. J., Schnare, M. N., Lang, B. F. & Gray, M. W. 2000. Complete sequence of the mitochondrial genome of Tetrahymena pyriformis and comparison with Paramecium aurelia mitochondrial DNA. J. Mol. Biol., 297:365–380. Coleman, A. W. 2005. Paramecium aurelia revisited. J. Eukaryot. Microbiol., 52:68–77. Cummings, D. J. 1980. Evolutionary divergence of mitochondrial DNA from Paramecium aurelia. Mol. Gen. Genet., 180:77–84. Diggles, B. K. & Adlard, R. D. 1997. Intraspecific variation in Cryptocaryon irritans. J. Eukaryot. Microbiol., 44:25–32. Emerson, B. & Hewitt, G. M. 2005. Phylogeography. Current Biol., 15:367–371. Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution, 39:783–791. Foissner, W., Stoeck, T., Schmidt, H. & Berger, H. 2001. Biogeographical differences in a common soil ciliate, Gonostomum affine (Stein), as revealed by morphological and RAPD-fingerprint analysis. Acta Protozool., 40:83–97. Fokin, S. I., Przybos, E., Chivilev, S. M., Beier, C. L., Horn, M., Skotarczak, B., Wodecka, B. & Fujishima, M. 2004. Morphological and molecular investigations of Paramecium schewiakoffi sp. nov. (Ciliophora, Oligohymenophorea) and current status of distribution and taxonomy of Paramecium spp. Eur. J. Protistol., 40:225–243. Hasegawa, M., Kishino, H. & Yano, T. A. 1985. Dating of the human–ape splitting by a molecular clock of mitochondrial-DNA. 22:160–174. Hebert, P. D. N., Cywinska, A., Ball, S. L. & deWaard, J. R. 2003. Biological identifications through DNA barcodes. Proc. R. Soc. Lond. B., 270:313–321. Khadem, N. & Gibson, I. 1985. Enzyme variation in Paramecium caudatum. J. Protozool., 32:622–626. Kimura, M. 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol., 16:111–120. Kumar, S., Tamura, K., Jakobsen, I. B. & Nei, M. 2001. MEGA2: molecular evolutionary genetics analysis software. Bioinformatics, 17:1244–1245. Kusch, J. 1998. Local and temporal distribution of different genotypes of pond-dwelling Stentor coeruleus. Protist, 149:147–154. Miao, W., Yu, Y. H., Shen, Y. F. & Zhang, X. Y. 2004. Intraspecific phylogeography of Carchesium polypinum (Peritrichia, Ciliophora) from China, inferred from 18S–ITS1–5.8S ribosomal DNA. Sci. China Ser. C Life Sci., 47:11–17. Nanney, D. L., Park, C., Preparata, R. & Simon, E. M. 1998. Comparison of sequence differences in a variable 23S rRNA domain among sets of cryptic species of ciliated protozoa. J. Eukaryot. Microbiol., 45:91–100. Posada, D. & Crandall, K. A. 1998. MODELTEST: testing the model of DNA substitution. Bioinformatics, 14:817–818. Pritchard, A. E., Laping, J. L., Seilhamer, J. J. & Cummings, D. J. 1983. Inter-species sequence diversity in the replication initiation region of Paramecium mitochondrial DNA. J. Mol. Biol., 164:1–15.
25
Pritchard, A. E., Seilhamer, J. J., Mahalingam, R., Sable, C. L., Venuti, S. E. & Cummings, D. J. 1990. Nucleotide sequence of the mitochondrial genome of Paramecium. Nucleic Acids Res., 18: 173–180. Przybos, E., Skotarczak, B. & Wodecka, B. 2003. Phylogenetic relationships of Paramecium jenningsi strains (classical analysis and RAPD studies). Folia Biol. (Krakow), 51:85–95. Rand, D. M. 2001. The units of selection on mitochondrial DNA. Annu. Rev. Ecol. Syst., 32:415–448. Rodriguez, F., Oliver, J. L., Marin, A. & Medina, J. R. 1990. The general stochastic-model of nucleotide substitution. J. Theor. Biol., 142: 485–501. Sainsard-Chanet, A. & Cummings, D. 1988. Mitochondria. In: Go¨rtz, H.-D. (ed.), Paramecium. Springer Verlag, Berlin-Heidelberg. p. 167–184. Schlegel, M. & Meisterfeld, R. 2003. The species problem in protozoa revisited. Eur. J. Protistol., 39:349–355. Seilhamer, J. J., Gutell, R. R. & Cummings, D. J. 1984. Paramecium mitochondrial genes. II. Large subunit ribosomal rRNA gene sequence and microevolution. J. Biol. Chem., 259:5173–5181. Seilhamer, J. J., Olsen, G. J. & Cummings, D. J. 1984. Paramecium mitochondrial genes. I. Small subunit rRNA gene sequence and microevolution. J. Biol. Chem., 259:5167–5172. Sonneborn, T. M. 1957. Breeding systems, reproductive methods, and species problems in Protozoa. In: Mayer, E. (ed.), The Species Problem. American Association For the Advancement of Science, Washington, DC. p. 155–324. Sonneborn, T. M. 1970. Methods in Paramecium research. In: Prescott, D. M. (ed.), Methods in Cell Physiology. Academic Press, New York. p. 242–339. Stoeck, T. & Schmidt, H. J. 1998. Fast and accurate identification of European species of the Paramecium aurelia complex by RAPD-fingerprints. Microb. Ecol., 35:311–317. Stoeck, T., Welter, H., Seitz-Bender, D., Kusch, J. & Schmidt, H. J. 2000. ARDRA and RAPD-fingerprinting reject the sibling species concept for the ciliate Paramecium caudatum (Ciliophora, Protoctista). Zool. Scr., 29:75–82. Swofford, D. L. 2002. PAUP. Phylogenetic Analysis Using Parsimony ( and Other Methods). Version 4.0. Sinauer Associates, Sunderland, MA. Tamura, K. & Nei, M. 1993. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol., 10:512–526. Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. & Higgins, D. G. 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res., 25:4876–4882. Tsukii, Y. 1994. Evolution of mitochondrial DNA in Paramecium caudatum. Jpn. J. Genet., 69:307–319. Wichtermann, R. 1986. The Biology of Paramecium. 2nd ed. Plenum Press, New York. Wright, A. D. G. 1999. Analysis of intraspecific sequence variation among eight isolates of the rumen symbiont, Isotricha prostoma (Ciliophora), from two continents. J. Eukaryot. Microbiol., 46:445–446.
Received: 06/14/05; accepted: 09/09/05
