Gene 448 (2009) 1–6
Contents lists available at ScienceDirect
Gene j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / g e n e
Initial characterization of a recombinant kynureninase from Trypanosoma cruzi identified from an EST database Gabriela Ecco a, Javier Vernal a,⁎, Guilherme Razzera b, Carolina Tavares a, Viviane Isabel Serpa a, Santiago Arias a, Fabricio Klerynton Marchini c, Marco Aurélio Krieger c, Samuel Goldenberg c,⁎, Hernán Terenzi a,⁎ a b c
Centro de Biologia Molecular Estrutural, Departamento de Bioquímica, Universidade Federal de Santa Catarina, 88040-900 Florianópolis, SC, Brazil Centro Nacional de Ressonância Magnética Nuclear, Jiri Jonas, Departamento de Bioquímica Médica, ICB/CCS/UFRJ, Rio de Janeiro, RJ, Brazil Instituto Carlos Chagas, ICC-Fiocruz, Curitiba, Paraná, Brazil
a r t i c l e
i n f o
Article history: Received 12 March 2009 Received in revised form 12 August 2009 Accepted 13 August 2009 Available online 19 August 2009 Received by F.G. Alvarez-Valin Keywords: Metacyclogenesis Heterologous expression Chagas' disease
a b s t r a c t Kynureninase has been described in bacteria, fungi and animals as an enzyme involved in the catabolic degradation pathway of L-tryptophan. This pyridoxal 5′-phosphate (PLP)-dependent enzyme catalyzes the hydrolytic cleavage of L-kynurenine and 3-hydroxy-L-kynurenine to yield L-alanine and either anthranilic or 3-hydroxyanthranilic acid, respectively. We identified a putative kynureninase gene from a Trypanosoma cruzi project aiming at the structural and functional characterization of more than 100 proteins differentially expressed during metacyclogenesis. This gene encodes a protein similar in size and sequence to kynureninases from other sources. This open reading frame was cloned and the recombinant enzyme was overexpressed. Recombinant T. cruzi kynureninase was purified to homogeneity and its identity was confirmed by mass spectrometry. The apparent molecular mass of the native T. cruzi kynureninase was estimated by gel filtration, suggesting that the protein is a homodimer. Circular dichroism spectrum indicated a mixture of α-helix and β-sheet structure, expected for an aminotransferase fold. L-kynurenine, preferentially hydrolyzed by prokaryotic inducible kynureninases, and 3-hydroxy-L-kynurenine, the preferred substrate in fungi and vertebrates, are both catabolized equally well by T. cruzi kynureninase. Further experimental assays will be performed to fully understand the importance of this enzyme for T. cruzi metabolism. © 2009 Elsevier B.V. All rights reserved.
1. Introduction The protozoan Trypanosoma cruzi is the etiological agent of Chagas' disease, a parasitic disease widely distributed from Mexico to Central and South America. T. cruzi is estimated to infect nearly 15 million people in Latin America. Although estimates show a decrease in the incidence of Chagas' disease during the last few decades due to the interruption of transmission, it continues to represent a health threat
Abbreviations: EST, expressed sequence tags; NAD, nicotinamide-adenine dinucleotide; AIDS, acquired immunodeficiency syndrome; TEV, tobacco etch vírus; PCR, polymerase chain reaction; LB, Luria–Bertani; OD, optical density; EDTA, ethylenediaminetetraacetic acid; DTT, dithiothreitol; kDa, kiloDaltons; SDS-PAGE, sodium docecyl sulfate-polyacrylamide gel electrophoresis; bp, base pairs. ⁎ Corresponding authors. J. Vernal is to be contacted at Centro de Biologia Molecular Estrutural, Departamento de Bioquímica, Universidade Federal de Santa Catarina, 88040-900 Florianópolis, SC, Brazil. Tel.: +55 48 3721 6426; fax: +55 48 3721 9672. S. Goldenberg, Instituto Carlos Chagas ICC-Fiocruz, Rua Professor Algacyr Munhoz Mader 3775 CIC 81350-010, Curitiba, PR Brazil. Tel.: +55 41 33163230; fax: +55 41 33163267. E-mail addresses:
[email protected] (J. Vernal), sgoldenberg@fiocruz.br (S. Goldenberg). 0378-1119/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2009.08.007
for about 28 million people (TDR/WHO, 2007). Chagas' disease is incurable in the chronic stage and, therefore, a better understanding of parasite metabolism is important in the design of effective antitrypanosome drugs. A putative kynureninase gene was identified from a T. cruzi project aiming at the structural and functional characterization of more than 100 proteins differentially expressed during metacyclogenesis (Silva et al., 2007). This transcriptomics project was conceived to identify genes more expressed in infective (metacyclic trypomastigotes) forms of T. cruzi as compared to non-infective and replicative (epimastigotes) forms of the parasite. Kynureninase gene was identified among these more expressed genes. The results obtained by microarray analysis were confirmed by real-time PCR analysis. Kynureninase (E.C. 3.7.1.3) is a pyridoxal 5′-phosphate (PLP)dependent enzyme that catalyzes the hydrolytic cleavage of Lkynurenine and 3-hydroxy-L-kynurenine to yield L-alanine and either anthranilic or 3-hydroxyanthranilic acid, respectively. N-formylkynurenine can also be used as a substrate. Kynureninase has been described in bacteria, fungi, vertebrates (Koushik et al., 1997; Jakoby and Bonner, 1953; Shetty and Gaertner, 1973; Toma et al., 1997; Gaertner and Shetty, 1977; Allegri et al., 2003) and more recently in
2
G. Ecco et al. / Gene 448 (2009) 1–6
the only insect known to have a kynureninase gene, the silkworm Bombyx mori (Meng et al., 2009). Two functional orthologs of kynureninase are known. One of them, described as an inducible enzyme, preferentially hydrolyzes Lkynurenine and is mainly found in prokaryotic organisms (Momany et al., 2004). The other one, primarily eukaryotic, is described as a constitutive kynureninase and preferentially uses 3-hydroxy-Lkynurenine as substrate (Lima et al., 2007). Nonetheless, both orthologs have been reported in fungi (Gaertner et al., 1971; Shetty and Gaertner 1975). Kynureninase is involved in L-tryptophan catabolism and NAD+ de novo biosynthesis, through the kynurenine pathway. In this pathway, in vertebrates and some bacteria, L-tryptophan is degraded to quinolinic acid, which is subsequently metabolized to NAD+ (Magni et al., 2004). In other bacteria and plants, kynurenine pathway is nonexistent and quinolinic acid is generated from L-aspartate (Kurnasov et al., 2003; Katoh et al., 2006). NAD+ and its phosphate (NADP+) are essential redox cofactors in all living systems. They are involved not only in energy metabolism but also in cell death and various other cellular functions, including regulation of calcium homeostasis, mitochondrial function, antioxidation/generation of oxidative stress, and gene expression (Ying, 2008). In humans and other mammals, the kynurenine pathway generates several neuroactive intermediates, including quinolinic acid, kynurenic acid, and 3-hydroxykynurenine (Stone and Darlington, 2002). High concentrations of quinolinic acid in the central nervous system have been implicated in the etiology of a number of neurodegenerative diseases, such as Alzheimer's and Huntington's diseases and AIDS–dementia complex (Guillemin et al., 2005; Heyes et al., 2001; Stoy et al., 2005). Moreover, it has been recently discovered that the kynureninase from the silkworm B. mori participates in the kynurenine pathway to yield 3-hydroxyanthranilic acid, the final product of this pathway in this organism. NAD+ is therefore not produced through the de novo pathway from endogenous thryptophan. 3-hydroxyanthranilic acid was showed to be an important compound for larvae body pigmentation and it is suggested that the role of this enzyme and the pathway itself, in B. mori, is related to the pigmentation network and the detoxification of tryptophan metabolites (Meng et al., 2009). In T. cruzi, tyrosine aminotransferase (TAT) and L-2-hydroxy acid dehydrogenase (AHADH) are responsible for aromatic amino acid catabolism (Cazzulo Franke et al., 1999). To date, there is no available knowledge on an alternative pathway for tryptophan catabolism in this parasite or the existence of the kynurenine pathway. In this study, we described the cloning, expression, and purification of a kynureninase from T. cruzi and report the initial characterization of this purified protein.
2. Material and methods 2.1. Construction of pTcKyn expression vector To obtain T. cruzi kynureninase, the putative kynureninase gene from T. cruzi (GeneDB ID: Tc00.1047053503881.10) was cloned in frame with a hexahistidine tag coding sequence at the expression vector pDEST17 (Invitrogen Gateway® system) and named pTcKyn. The complete kynureninase open reading frame (ORF) was amplified by two sequential PCRs from genomic T. cruzi DNA. The first amplification used a reverse gene specific oligonucleotide flanking the 3′-gene followed by a partial attB2 gateway recombination site
(3′-GTACAAGAAAGCTGGGTTTAAAAGCACTCCGCAATCGCCC), the forward 5′-flanking oligonucleotide is a partial TEV protease cleavage sequence followed by a gene specific region (5′-CCTGTATTTTCAGGGCATGCGTAATAACGCCACGGAAAA). The sequentially amplification was done with a forward oligonucleotide containing a attB1 gateway recombination site and a TEV protease cleavage sequence to anneal at the first PCR (5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTCGGAAAACCTGTATTTTCAGGGC), the reverse oligonucleotide annealed at the attB2 and also added the missing part of the gateway recombination site (3′-GGGGACCACTTTGTACAAGAAAGCTGGGT). This amplification strategy and the pDEST tag incorporate at the amino terminal portion a sequence of 29 amino acids (MSYYHHHHHHLESTSLYKKAGSENLYFQG). The recombinant plasmid was used to transform Escherichia coli DH5α competent cells. Clones carrying the pTcKyn recombinant plasmid were identified by colony PCR and checked by DNA sequencing. 2.2. Expression and purification of recombinant T. cruzi kynureninase E. coli BL21(DE3)pLysS cells were transformed with pTcKyn recombinant plasmid to overexpress T. cruzi kynureninase. LB media broth (30 ml) supplemented with 100 μg/ml ampicillin and 50 μg/ml chloramphenicol was inoculated with E. coli cells containing the pTcKyn recombinant plasmid. Overnight cultures were transferred into 270 ml of the same medium and were grown at 37 °C until an OD value of 0.8 at 600 nm was reached. The culture was then maintained on ice for 10 min following ethanol P.A. addition to a final concentration of 2% (v/v). Isopropyl-β-D-thiogalactopyranoside (IPTG) was added to a final concentration of 0.5 mM and cultures were incubated at 25 °C for 15 h. Cells were harvested by centrifugation (6000g for 30 min at 4 °C) and re-suspended in 50 mM sodium phosphate lysis buffer (pH 8.0) containing 300 mM NaCl, 10 mM imidazole, 0.1 mM PLP and a protease inhibitor cocktail (Complete, Mini, Boehringer-Mannheim). The cells were disrupted by gentle sonication (6 cycles, 20 s) on ice and centrifuged (10,000g for 30 min at 4 °C). The protein was purified from the supernatant by immobilized metal ion affinity chromatography (Chelating Sepharose Fast Flow, GE Healthcare). The supernatant was mixed with 1 ml of pre-equilibrated sepharose resin with lysis buffer and incubated at 4 °C for 30 min with gentle shaking. The protein-bound sepharose resin was washed 5 times with 10 ml of wash buffer A (50 mM sodium phosphate, 300 mM NaCl, 40 mM imidazole, pH 8.0) and 5 times with 10 ml of wash buffer B (50 mM sodium phosphate, 300 mM NaCl, 60 mM imidazole, pH 8.0). The hexahistidine tagged kynureninase was eluted with 250 mM imidazole. Protein sample purity was assessed by SDS-PAGE in 10 % acrylamide slab gels (Shägger and von Jagow, 1987), under reducing conditions. The gels were stained with Coomassie brilliant blue R-250. The protein content was determined using the Bradford method (Bradford, 1976), with bovine serum albumin as a standard. The protein was further purified by gel filtration, using 100 mM potassium phosphate buffer pH 7.0 containing PLP 0.1 mM. Recombinant kynureninase was stored at −20 °C with 10% glycerol. 2.3. Analytical gel filtration The oligomeric state of T. cruzi recombinant kynureninase in solution was determined by gel filtration on a Superdex 200 Prep Grade (GE Healthcare) connected to an ÄKTA system (GE Healthcare). The column was equilibrated with 50 mM sodium phosphate buffer (pH 8.0) containing 50 mM NaCl, 1 mM EDTA, 1 mM DTT, and
Fig. 1. Multiple sequence alignment of kynureninases from various sources. T. cruzi, Trypanosoma cruzi (XP_807119); T. brucei, Trypanosoma brucei (XP_803513); L. braziliensis, Leishmania braziliensis (XP_001562446); H. sapiens, Homo sapiens (NP_003928); S. cerevisiae, Saccharomyces cerevisiae (Q05979); P. fluorescens, Pseudomonas fluorescens (1QZ9_A). Conserved active site residues are shown in red. Compensating double mutations are indicated in green and in blue. Peptides from T. cruzi recombinant kynureninase identified by mass spectrometry are underlined. The matched peptides cover 25% of the protein.
G. Ecco et al. / Gene 448 (2009) 1–6
3
4
G. Ecco et al. / Gene 448 (2009) 1–6
calibrated with: thyroglobulin, 669 kDa; apoferritin, 443 kDa; βamylase, 200 kDa; alcohol dehydrogenase, 150 kDa; bovine serum albumin, 66 kDa; and carbonic anhydrase, 29 kDa. Proteins were eluted with the same buffer. The elution fractions were analyzed by SDS-PAGE. 2.4. Mass spectrometry In-gel tryptic digestion was performed using 5 μg of purified T. cruzi recombinant kynureninase subjected to SDS-PAGE (Fig. 3). Tryptic peptides were cleaned up with C-18 Zip tips (Millipore) and mixed with 60% acetonitrile and 0.1% trifluoroacetic acid. Purified sample (1 μl) was mixed with 1 μl of α-cyano-4-hydroxycinnamic acid (10 mg/ml), spotted on a target plate, and submitted to mass spectrometric analyses on MALDI-TOF equipment (Autoflex Bruker, Universidade Federal do Paraná, by kind permission of Dr. Emanuel Maltempi de Souza). Search parameters for the MASCOT search program (www.matrixscience.com) were, kynureninase primary structure, one trypsin missed cleavage, 50 ppm error tolerance, cysteine carbamidomethylation was set as fixed modification and methionine oxidation was set as variable modification. 2.5. Kinetic assay Kynureninase activity was measured spectrophotometrically at 37 °C by following the decrease in absorbance at 370 nm as 3hydroxy-DL-kynurenine was hydrolyzed to 3-hydroxyanthranilate and L-alanine or at 360 nm when L-kynurenine was hydrolyzed to anthranilate and L-alanine (Momany et al., 2004; Lima et al., 2007). Temperature, pH and substrate concentration were optimized. Specific activity assays contained 3 mM 3-hydroxy-DL-kynurenine or L-kynurenine, potassium phosphate buffer 30 mM pH 7.0 and enzyme at a concentration of 0.7 μM. 2.6. Circular dichroism spectroscopy Circular dichroism (CD) spectra were measured in a Jasco J-715 spectropolarimeter. The far-UV spectra of T. cruzi recombinant kynureninase were measured over a wavelength range of 195– 260 nm using an average of 5 spectra with 50 nm/min scan speed and a step resolution of 0.2 nm. The measurements were carried out in a 0.1-mm path-length cuvette using protein at a concentration of 34 μM in phosphate buffer (20 mM sodium phosphate, 20 mM NaCl, pH 7.4). 2.7. Recombinant kynureninase structure modeling Structural model of T. cruzi kynureninase was obtained by ProModII of SWISS-MODEL (automated protein modeling server developed at GlaxoSmithKline in Geneva, Switzerland). The complete amino acid sequence of the protein was submitted to the SWISSMODEL server using the alignment of Fig. 1 and Pseudomonas fluorescens kynureninase (PDB ID: 1QZ9) as template. 3. Results 3.1. Identification of the T. cruzi kynureninase open reading frame and sequence alignment A putative kynureninase gene more expressed in infective forms of T. cruzi as compared to non-infective and replicative forms of the parasite was identified from a T. cruzi project aiming at the structural and functional characterization of more than 100 proteins differentially expressed during metacyclogenesis. This gene encodes a protein with high similarity to Homo sapiens kynureninase. This gene consisted of an ORF of 1395 bp, coding for a protein of 465 amino acids. The T. cruzi kynureninase (monomeric theoretical molecular mass, 51 650.73 Da) is
similar in size and sequence to the well-studied kynureninase from H. sapiens (52 351.60 Da; 465 amino acids). T. cruzi kynureninase sequence was aligned with those of other eukaryotic and bacterial kynureninases. The alignment shows that this enzyme shares high identity with kynureninases from other organisms, such as Saccharomyces cerevisiae and P. fluorescens (Fig. 1); T. cruzi kynureninase shared the highest identity (50–66%) with sequences assigned as kynureninases in the genomes of other Trypanosomatids. T. cruzi kynureninase contains the conserved Asp-241, expected for an aminotransferase fold, and most of the active site residues conserved among kynureninases (Momany et al., 2004): Asn-59, Leu-61, Pro-151, His-244, Cys-264, Tyr-266, Pro-273 and Arg-441. The residue in position 267, which binds to PLP and is a Lys in all kynureninases known to date, is replaced by an Arg in T. cruzi kynureninase. The strictly conserved Phe at position 150 is replaced by a Ser in T. cruzi kynureninase. Residues that are important for oligomerization are conserved in T. cruzi kynureninase. An exception is the residue in position 298, normally a Trp strictly conserved in kynureninases from bacteria to humans, but in T. cruzi kynureninase it is replaced by a Ser (Lima et al., 2009). These residues, Leu-61, Trp-79, Trp94, Pro-273 and Trp 298, lie at the dimer interface in P. fluorescens kynureninase (Momany et al., 2004). Several additional amino acids in the kynureninases are conserved through compensating double mutations. The structural volumes associated with Trp-87 and neighboring Thr-326 in bacterial kynureninases are largely matched by a histidine/asparagine pair in the eukaryotes, present as an asparagine/asparagine pair in T. cruzi kynureninase. Another compensating mutation set is the Gly-263 and Phe-278 (or Tyr/Ile) pair observed in most bacterial kynureninases shifting to tryptophan and glycine, these residues conserved in T. cruzi kynureninase (Momany et al., 2004). 3.2. Protein expression and purification T. cruzi recombinant kynureninase was expressed in E. coli strain Bl21(DE3) pLysS and purified by metal chelate chromatography. Almost all impurities were eliminated with different concentrations of imidazole before the kynureninase elution. The recombinant enzyme was eluted at nearly 250 mM imidazole (Fig. 2). The protein was further purified by gel filtration (Fig. 3). The purification procedure yielded, on average, about 2.9 mg of purified protein from a 500-ml bacterial culture. The protein sample was analyzed by SDS/PAGE (10% acrylamide), under reducing conditions: purified kynureninase behaved as a 51-kDa polypeptide, a value consistent with the theoretical molecular mass (51.6 kDa) predicted for the full-length recombinant protein. 3.3. Gel filtration To determine the oligomeric state of T. cruzi recombinant kynureninase in solution, the elution profile on a gel filtration column (Superdex 200 Prep Grade, GE Healthcare) was determined and compared with that of protein size markers. T. cruzi kynureninase eluted as a peak at 75.12 ml (Fig. 3), which lie after the elution volume of alcohol dehydrogenase (68.98 ml, 150 kDa) and before bovine serum albumin (76.85 ml, 66 kDa). This result suggests that the native recombinant protein is a homodimer. 3.4. Mass spectrometry The identity of the purified protein was ascertained by MALDI-TOF mass spectrometry of trypsin-digested recombinant kynureninase. The tryptic digest yielded a series of fragments whose molar masses were consistent with the expected primary structure (Fig. 1) and which covered 25% of the protein sequence.
G. Ecco et al. / Gene 448 (2009) 1–6
Fig. 2. Purification of recombinant T. cruzi kynureninase. (1) Molecular weight markers; (2) soluble bacterial extract; (3) proteins that did not bind to the resin; (4) 40 mM imidazole wash; (5) 60 mM imidazole wash; (6) proteins ligated to the resin before elution; (7 and 8) 100 mM imidazole elution; (9 and 10) 250 mM imidazole elution. Recombinant kynureninase eluted with 250 mM imidazole. SDS-PAGE was performed under reducing conditions in 10% acrylamide gels and the proteins were visualized by Coomassie brilliant blue R-250 staining.
5
Fig. 4. Circular dichroism of T. cruzi recombinant kynureninase. The negative band at 222 nm and a shoulder at 214 nm indicate a mixture of α-helix and β-sheet structure, expected for an aminotransferase fold.
3.5. Kynureninase activity
3.7. Molecular modeling
The recombinant kynureninase has a Km of 471.3 ± 30 μM for 3hydroxy-L-kynurenine. For L-kynurenine, its Km is 955.3 ± 40 μM. These results suggest that the recombinant T. cruzi kynureninase catabolizes both substrates with similar efficacy. However this recombinant enzyme displays higher Km values when compared to human and rat kynureninases (10-fold higher for 3-hydroxy-Lkynurenine and 2-fold higher for L-kynurenine, for both organisms) (Toma et al., 1997).
A model for the T. cruzi kynureninase 3D structure was developed to better understand the residues substitutions when comparing this enzyme with P. fluorescens kynureninase 3D structure. Fig. 5A shows the PLP binding site of the T. cruzi protein model, using P. fluorescens kynureninase as a template (PDB ID: 1QZ9). Fig. 5B shows the PLP binding site of P. fluorescens kynureninase for comparison. The residues involved in the PLP interaction in P. fluorescens and human kynureninases are represented in Fig. 5. Asp 132 in P. fluorescens, a negatively charged residue, is replaced by a Ser (highlighted in red in Fig. 2A) in T. cruzi kynureninase. This Asp residue is also present in human kynureninase at position 168. Furthermore, other residues interacting with PLP in P. fluorescens kynureninase, Thr 96, Thr 97 and Ser 98, are replaced in T. cruzi kynureninase by Ser, Phe and Gly, respectively, and may modulate cofactor binding.
3.6. Circular dichroism The secondary structure of recombinant T. cruzi kynureninase was investigated by circular dichroism measurements. The far-UV CD spectrum displayed the negative band at 222 nm and a shoulder at 214 nm, indicating a mixture of α-helix and β-sheet structure, expected for an aminotransferase fold. Analysis with the CDSSTR program (Compton and Johnson, 1986) suggested that T. cruzi kynureninase is composed of 44% α-helices, 5% β-sheets and a remaining part assumed to consist of randomly coiled structures (Fig. 4). These results are in close agreement with the human kynureninase crystal structure, PDB 2HZP, which also presents high α-helical content (Lima et al., 2007).
4. Discussion The results reported herein suggest that we cloned, expressed and purified the kynureninase from T. cruzi. Interestingly, this enzyme catabolizes L-kynurenine, preferentially hydrolyzed by prokaryotic inducible kynureninases, and also 3-hydroxy-L-kynurenine, the preferred substrate of kynureninase in fungi and vertebrates (Momany et al., 2004; Lima et al., 2007). This enzyme is highly
Fig. 3. Analysis of T. cruzi recombinant kynureninase samples by gel filtration and SDS-PAGE. (A) Gel filtration analysis in a Superdex 200 Prep Grade connected to an ÄKTA system. Arrows indicate the positions of elution of the molecular weight markers (I–VI). I, thyroglobulin (51.13 ml, 669 kDa); II, apoferritin (56.97 ml, 443 kDa); III, β-amylase (63.67 ml, 200 kDa); IV, alcohol dehydrogenase (68.98 ml, 150 kDa); V, bovine serum albumin (76.85 ml, 66 kDa); and VI, carbonic anhydrase (89.50 ml, 29 kDa). T. cruzi kynureninase eluted as a peak at 75.12 ml, corresponding to a homodimer. (B) SDS-PAGE analysis of the kynureninase eluted peak. MWM, molecular weight markers; K, purified recombinant kynureninase.
6
G. Ecco et al. / Gene 448 (2009) 1–6
(Santa Catarina State Proteomics Network; http://www.rpsc.ufsc.br), Ministério de Ciência e Tecnologia (MCT), Financiadora de Estudos e Projetos (FINEP), Fundação de Apoio ao Desenvolvimento Científico e Tecnológico do Estado de Santa Catarina (FAPESC) and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES), for financial support. References
Fig. 5. Structural model of T. cruzi kynureninase. (A) Model obtained by ProModII of SWISS-MODEL. Note that the model using human kynureninase as template yielded a high-energy conformation, leading to an incomplete cycle of Swiss model protocols. The PLP binding site and the amino acid side chains that interact with PLP are shown in green. Asp replaced by Ser at position 153 is highlighted in red. For comparison, the crystal structure of P. fluorescens kynureninase is shown (B).
similar to the human and P. fluorescens kynureninases, with 35% and 25% sequence identity, respectively. Thus, the three-dimensional structures must be similar and T. cruzi kynureninase may also have an aminotransferase fold, this prediction is supported by the presence of the conserved Asp-241. Furthermore, residues that are important for oligomerization are conserved in T. cruzi kynureninase and its gel filtration profile revealed that this enzyme is also a homodimer in solution. The sequence alignment shows several unusual features: an Arg instead of a Lys at position 267, a Ser replacing a Phe at position 150, and a strictly conserved Trp replaced by Ser at position 298, all these positions being involved in cofactor binding. These substitutions are also present in the Trypanosoma brucei putative kynureninase sequence, except for Cys 298. The model for the T. cruzi kynureninase 3D structure showed the substitution of Asp 132 in P. fluorescens, a negatively charged residue, by a Ser in T. cruzi kynureninase. This Asp residue is also present in human kynureninase at position 168. Furthermore, other residues interacting with PLP in P. fluorescens kynureninase, Thr 96, Thr 97 and Ser 98, are replaced in T. cruzi kynureninase by Ser, Phe and Gly, respectively, and may modulate cofactor binding. Further structural and biochemical analyses are necessary to fully understand the implications of these substitutions on the structure and mechanism of T. cruzi kynureninase. The use of a highly purified and properly folded enzyme, as described in this paper, would be advantageous to fully understand the importance of this enzyme for T. cruzi metabolism. Acknowledgements The authors thank the Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), Rede Proteoma de Santa Catarina
Allegri, G., Bertazzo, A., Biasiolo, M., Costa, C.V., Ragazzi, E., 2003. Kynurenine pathway enzymes in different species of animals. Adv. Exp. Med. Biol. 527, 455–463. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. Cazzulo Franke, M.C., Vernal, J., Cazzulo, J.J., Nowicki, C., 1999. The NAD-linked aromatic alpha-hydroxy acid dehydrogenase from Trypanosoma cruzi. A new member of the cytosolic malate dehydrogenases group without malate dehydrogenase activity. Eur. J. Biochem. 266, 903–910. Compton, L.A., Johnson, W.C., 1986. Analysis of protein circular dichroism spectra for secondary structure using a simple matrix multiplication. Anal. Biochem. 155, 155–167. Gaertner, F.H., Shetty, A.S., 1977. Kynureninase-type enzymes and the evolution of the aerobic tryptophan-to-nicotinamide adenine dinucleotide pathway. Biochim. Biophys. Acta 482, 453–460. Gaertner, F.H., Cole, K.W., Welch, G.R., 1971. Evidence for distinct kynureninase and hydroxykynureninase activities in Neurospora crassa. J. Bacteriol. 108, 902–909. Guillemin, G.J., Brew, B.J., Noonan, C.E., Takikawa, O., Cullen, K.M., 2005. Indoleamine 2,3-dioxygenase and quinolinic acid immunoreactivity in Alzheimer's disease hippocampus. Neuropathol. Appl. Neurobiol. 31, 395–404. Heyes, M.P., et al., 2001. Elevated cerebrospinal fluid quinolinic acid levels are associated with region-specific cerebral volume loss in HIV infection. Brain 124, 1033–1042. Jakoby, W.B., Bonner, D.M., 1953. Kynureninase from Neurospora: purification and properties. J. Biol. Chem. 205, 699–707. Katoh, A., Uenohara, K., Akita, M., Hashimoto, T., 2006. Early steps in the biosynthesis of NAD in Arabidopsis start with aspartate and occur in the plastid. Plant Physiol. 141, 851–857. Koushik, S.V., Sundararaju, B., McGraw, R.A., Phillips, R.S., 1997. Cloning, sequence, and expression of kynureninase from Pseudomonas fluorescens. Arch. Biochem. Biophys. 344, 301–308. Kurnasov, O., et al., 2003. NAD biosynthesis: identification of the tryptophan to quinolinate pathway in bacteria. Chem. Biol. 10, 1195–1204. Lima, S., Khristoforov, R., Momany, C., Phillips, R.S., 2007. Crystal structure of Homo sapiens kynureninase. Biochemistry 46, 2735–2744. Lima, S., Kumar, S., Gawandi, V., Momany, C., Phillips, R.S., 2009. Crystal structure of the Homo sapiens kynureninase-3-hydroxyhippuric acid inhibitor complex: insights into the molecular basis of kynureninase substrate specificity. J. Med. Chem. 52, 389–396. Magni, G., Amici, A., Emanuelli, M., Orsomando, G., Raffaelli, N., Ruggieri, S., 2004. Enzymology of NAD+ homeostasis in man. Cell. Mol. Life Sci. 61, 19–34. Meng, Y., Katsuma, S., Mita, K., Shimada, T., 2009. Abnormal red body coloration of the silkworm, Bombyx mori, is caused by a mutation in a novel kynureninase. Genes Cells 14, 129–140. Momany, C., Levdikov, V., Blagova, L., Lima, S., Phillips, R.S., 2004. Three-Dimensional structure of kynureninase from Pseudomonas fluorescens. Biochemistry 43, 1193–1203. Shägger, H., von Jagow, G., 1987. Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Ana. Biochem. 166, 368–379. Shetty, A.S., Gaertner, F.H., 1973. Distinct kynureninase and hydroxykynureninase activities in microorganisms: occurrence and properties of a single physiologically discrete enzyme in yeast. J. Bacteriol. 113, 1127–1133. Shetty, A.S., Gaertner, F.H., 1975. Kynureninase-type enzymes of Penicillium roqueforti, Aspergillus niger, Rhizopus stolonifer, and Pseudomonas fluorescens: further evidence for distinct kynureninase and hydroxykynureninase activities. J. Bacteriol. 122, 235–244. Silva, A.A.F., Vieira, L.C., Krieger, M.A., Goldenberg, S., Zanchin, N.I.T., Guimaraes, B.G., 2007. Crystal structure of chagasin, the endogenous cystein-protease inhibitor from Trypanosoma cruzi. J. Struct. Biol. 157, 416–423. Stone, T.W., Darlington, L.G., 2002. Endogenous kynurenines as targets for drug discovery and development. Nat. Rev. Drug Discov. 1, 609–620. Stoy, N., et al., 2005. Tryptophan metabolism and oxidative stress in patients with Huntington's disease. J. Neurochem. 93, 611–623. TDR/WHO, 2007. Scientific Working Group on Chagas disease report (April 2005), Buenos Aires, Argentina. Toma, S., et al., 1997. Cloning and recombinant expression of rat and human kynureninase. FEBS Lett. 408, 5–10. Ying, W., 2008. NAD+/NADH and NADP+/NADPH in cellular functions and cell death: regulation and biological consequences. Antioxid. Redox Signal 10, 179–206.
