ARTICLE
doi:10.1016/j.ymthe.2005.07.698
Inhibition of Simian/Human Immunodeficiency Virus Replication in CD4+ T Cells Derived from Lentiviral-Transduced CD34+ Hematopoietic Cells Stephen E. Braun,1,* Fay Eng Wong,1 Michelle Connole,1 Gang Qiu,1 Lorrin Lee,1 Jackie Gillis,1 Xiaobin Lu,2 Laurent Humeau,2 Vladimir Slepushkin,2 Gwendolyn K. Binder,2 Boro Dropulic,2,3,y and R. Paul Johnson1,4 1
Division of Immunology, New England Primate Research Center, Harvard Medical School, One Pine Hill Drive, Southborough, MA 01772, USA 2 VIRxSYS Corporation, Gaithersburg, MD 20877, USA 3 Sydney Kimmel Comprehensive Cancer Center, Johns Hopkins University School of Medicine, Baltimore, MD 21231, USA 4 Partners AIDS Research Center and Infectious Disease Unit, Massachusetts General Hospital, Boston, MA 02129, USA *To whom correspondence and reprint requests should be addressed. Fax: (508) 624 8172. E-mail:
[email protected]. y
Current address: Lentigen Corporation, 1450 South Rolling Road, Suite 4.054, Baltimore, MD 21227, USA.
Available online 15 September 2005
We examined the ability of a HIV-1-based vector (VRX494) encoding a 937-bp antisense HIV-1 envelope sequence to inhibit the replication of chimeric SIV/HIV-1 viruses encoding the HIV-1 envelope. Challenge of VRX494-transduced CEMx174 cells resulted in potent inhibition of HIV-1 and several SHIV strains. To evaluate the potential efficacy of the VRX494 vector for stem cell gene therapy, rhesus CD34+ bone marrow cells were transduced with VRX494 and then cultured on thymus stroma to induce T cell differentiation. Transduction conditions for CD34+ cells were optimized to yield high transduction efficiency with minimal effective multiplicity of infection. Purified CD4+ GFP+ T cells derived from VRX494-transduced CD34+ cells strongly inhibited SHIV HXBC2P 3.2 and SHIV 89.6P replication compared to controls. Southern blot analysis of VRX494transduced T cell clones revealed a subset of cells with multiple proviral copies per cell. Expression of GFP and the antisense inhibitor in VRX494-transduced cells was upregulated by Tat. Analysis of HIV1 envelope sequences in VRX494-transduced cells revealed modifications consistent with those mediated by double-stranded RNA-dependent adenosine deaminase. These results indicate that the macaque/SHIV model should serve as a useful preclinical model to evaluate this lentiviral vector expressing an HIV-1 antisense inhibitor for stem cell gene therapy for AIDS. Key Words: HIV-1, SHIV, gene therapy, lentiviral vectors, hematopoietic stem cells, nonhuman primates
INTRODUCTION Despite the dramatic success of highly active antiretroviral therapy (HAART) in inhibiting viral replication in HIV-infected subjects, a significant incidence of serious side effects, an increasing prevalence of resistant viruses, and virologic failure rates of HAART that exceed 50% in some cohorts [1,2] are making it increasingly clear that there is a compelling need for the development of complementary therapies. Over the past decade, a variety of genetic strategies for the inhibition of HIV replication have been developed, including intracellular antibodies,
MOLECULAR THERAPY Vol. 12, No. 6, December 2005 Copyright C The American Society of Gene Therapy 1525-0016/$30.00
dominant negative inhibitors, ribozymes, small inhibitory RNAs (siRNA), RNA decoys, aptamers, and antisense molecules (reviewed in [3]). RNA-based approaches should minimize the potential for an immune response against foreign proteins that is possible with proteinbased approaches [4,5]. While siRNAs have provided potent inhibition of HIV-1 [6], the susceptibility of siRNA-based approaches to the selection of viral escape mutants [7] with even single base pair mutations is likely to prove to be an important limitation. In contrast, antisense-based approaches, especially those utilizing
1157
ARTICLE
sequences N600 bp, are likely to be less susceptible to the effects of sequence variation [8,9]. Introduction of genes that inhibit HIV replication into hematopoietic stem cells (HSC) offers the potential to offer long-lived immune reconstitution in HIV-infected individuals by repopulating the immune system with cells resistant to HIV infection. Successful transduction of HSC with a vector expressing an inhibitory gene would have the distinct advantage of protecting multiple lineages against HIV-1 infection, including mature CD4+ T lymphocytes, macrophages, thymocytes, and dendritic cells. However, clinical trials employing transduced HSC have generally yielded disappointingly low rates of gene transfer [10,11], except in settings in which genetically modified cells have a survival advantage in vivo [12]. The inefficient rates of gene transfer to human hematopoietic stem cells are likely due in part to the use of murine oncoretroviral vectors, which require proliferation of the target cell to obtain efficient gene transfer [13]. As an alternative strategy, lentiviral vectors have been shown to transduce quiescent CD34+ human hematopoietic cells [14,15] and NOD/SCID repopulating cells [15–18] efficiently. Rhesus macaques have been used extensively in gene therapy studies and are generally considered to be the leading animal model for the study of AIDS [19]. Because HIV-1 does not replicate in rhesus macaques, the related lentivirus simian immunodeficiency virus (SIV) or recombinant chimeras of human/simian immunodeficiency virus (SHIV) have been widely used as models for disease pathogenesis and for potential therapies or vaccines [20–22]. Many SHIVs use HIV-1 envelope sequences along with the overlapping accessory genes tat and rev in the SIVmac239 viral backbone, thus allowing SHIV challenge of rhesus macaques to study therapeutic modalities targeting HIV envelope (env), tat, or rev in a relevant in vivo model. In this study we examined the ability of an HIV-1based lentiviral vector (VRX494) expressing a 937-bp antisense sequence derived from the HIV-1 envelope [23] to inhibit SHIV replication in transformed cell lines and primary CD4+ T cells derived from transduced CD34 + cells. Inhibition of HIV-1 replication by VRX494 may occur by decreasing levels of HIV-1 transcripts and interfering with packaging of wild-type RNA into virions [16,24,25]. This vector has provided potent inhibition of diverse HIV-1 isolates in primary CD4+ T lymphocytes [25] and its clinical version VRX496 has been evaluated in a phase I clinical trial using transduced CD4+ T lymphocytes [26]. We show here efficient gene transfer of VRX494 into CEMx174 cells and into rhesus CD34+ bone marrow cells, in vitro differentiation of CD34+ bone marrow cells into CD4+ T cells during thymus culture, and strong inhibition of HIV-1 and/or SHIV viral replication in VRX494-transduced CEMx174 cells and in VRX494-containing CD4+ T cells. These
1158
doi:10.1016/j.ymthe.2005.07.698
results support further study of this lentiviral vector as a stem cell gene therapy strategy for AIDS.
RESULTS In Vitro Inhibition of Viral Replication in VRX494-Transduced CD4+ Cells In the lentiviral vector VRX494, the HIV-1 LTR regulates transcription of 937 bp of antisense HIV-1 envelope sequence and the Rev-response element (RRE) from between the splice donor/splice acceptor sites and expresses enhanced green fluorescent protein (GFP) translated from the spliced message (Fig. 1). We initially evaluated inhibition of HIV-1, SHIV, and SIV replication by VRX494 in the CD4+ CEMx174 cell line. We transduced CEMx174 cells with VRX494 (CEMx174VRX494) at a multiplicity of infection (m.o.i.) of 5 IU/ cell, resulting in N90% GFP-expressing cells (data not shown), and then challenged them with HIV-1, several SHIV strains, or SIV. CEMx174 cells stably transduced with LZRS-GFP, a MLV vector expressing GFP, served as controls (CEMx174-GFP). As shown in Fig, 2A, replication of the HIV-1 NL4-3 strain in CEMx174-VRX494 was reduced by 103- to 104-fold compared to CEMx174GFP. Conversely and as expected because of the minimal homology (b70%) between HIV-1 and SIV envelopes, we observed no significant inhibition of SIVmac239 in CEMx174-VRX494 (Fig. 2B). To facilitate subsequent evaluation of the efficacy of the VRX494 vector in protecting against AIDS in nonhuman primates, we evaluated replication of SHIV isolates expressing different HIV-1 envelope sequences. As shown in Figs. 2C and 2D for SHIV 89.6P and HXBC2P 3.2, respectively, CEMx174-VRX494 inhibited viral replication by approximately 2 logs compared with CEMx174-GFP. We observed less potent inhibition with SHIV DH12R (Fig. 2E), as well with the nonpathogenic parental virus SHIV DH12 (Fig. 2F). The variable degree of inhibition by VRX494 among different SHIV strains was reproducible and did not clearly correlate with the degree of sequence heterogeneity between the antisense HIV-1 sequence and the SHIV envelope, which varied between 87 and 97%. Overall, these data demonstrate relatively vigo-
FIG. 1. Schematic diagram of the lentiviral vector VRX494. The vector contains the antisense HIV envelope (reverse arrow) situated with the Rev-responsive element (RRE; gray box) between the splice-donor (SD) and splice-acceptor (SA) sites and transcriptionally regulated by the HIV-1 LTR (open box), eGFP (right hatch) translated from the spliced message, and the cis-acting lentiviral elements C packaging signal (bold line) and central polypurine tract (cppt; triple line).
MOLECULAR THERAPY Vol. 12, No. 6, December 2005 Copyright C The American Society of Gene Therapy
doi:10.1016/j.ymthe.2005.07.698
ARTICLE
FIG. 2. CEMx174-VRX494 cells (closed symbols) and CEMx174-GFP cells (open symbols) were challenged with (A) HIV-1 NL4-3, (B) SIVmac239, (C) SHIV 89.6P, (D) SHIV HXBC2P 3.2, (E) SHIV DH12R, or (F) SHIV DH12. The m.o.i. were 0.01 (square) and 0.001 TCID50/cell (diamond) for (A) and (B) and 1 ng p27 per 106 cells (square) and 0.1 ng Gag p27 per 106 cells (diamond) for (C– F). Transduced cells were infected and followed for 2 weeks. Viral replication was assessed by ELISA determination of HIV-1 Gag p24 or SIV Gag p27 concentrations in cell-free culture supernatants. Results shown are representative of two experiments for each virus.
rous and sequence-specific inhibition of SHIV replication by VRX494. Optimization of Transduction of CD34+ Hematopoietic Cells With VRX494 Although lentiviral vectors have proved to be quite efficient for the transduction of CD34+ hematopoietic cells, frequently resulting in levels exceeding 80%, these results have often been achieved using relatively high m.o.i., which in some cases have exceeded 1000 IU per cell [14,15]. Because of increasing concerns regarding the potential hazards of insertional mutagenesis [27], we sought to optimize transduction conditions so as to maximize transduction efficiency, while minimizing the potential for multiple vector integrants per cell. We stimulated macaque CD34+ bone marrow cells with thrombopoietin (Tpo), Flt3 ligand (Flt3L), and stem cell factor (SCF) [28] in the presence of Retronectin [29] and transduced them with VRX494 for various cycles (1 to 4) at various m.o.i. (5–50 IU/cell). In initial experiments, we examined the effect of the number of cycles of transduction on transduction efficiency in CD34+ cells that were transduced at an m.o.i. of 25 IU per cell. Forty-eight hours after transduction, each population was analyzed by flow cytometry for expression of CD34 and GFP. As shown
MOLECULAR THERAPY Vol. 12, No. 6, December 2005 Copyright C The American Society of Gene Therapy
in Fig. 3A, after one exposure to VRX494 only 6.2 F 0.8% (mean F SD; N = 4) of CD34+ cells expressed GFP. After two, three, and four exposures to VRX494, the mean percentage of CD34+ cells expressing GFP increased to 11.0, 22.9, and 43.3%, respectively (Fig. 3B). The mean fluorescence intensity (MFI) for GFP in transduced CD34+ cells increased as the number of transduction cycles increased (Fig. 3A), suggesting the possibility of multiple copies of provirus per cell. With more than 70% of the gene transfer occurring during the third and fourth cycles, the substantial increases in transduction efficiency after several days of culture may reflect the fact that cytokine stimulation of CD34+ cells may enhance transduction efficiency by lentiviral vectors [30]. We also evaluated the effect of m.o.i. on transduction efficiency in CD34+ cells that were transduced four times with VRX494 at m.o.i. ranging from 5 to 50 IU per cell. Forty-eight hours after transduction, each population was analyzed by flow cytometry for expression of CD34 and GFP. The percentage of CD34+ cells that expressed GFP increased as the m.o.i. increased, eventually reaching a plateau around 50% (Fig. 3C). The number of viable cells was significantly reduced at the end of the 4-day transduction period at 50 IU/cell (data not shown). The MFI of GFP expression increased
1159
ARTICLE
doi:10.1016/j.ymthe.2005.07.698
FIG. 3. Transduction of rhesus CD34+ bone marrow cells with VRX494. (A) Expression of eGFP in rhesus CD34+ bone marrow cells 48 h after 1, 2, 3, and 4 days of cytokine stimulation and transduction with VRX494 at m.o.i. of 25 IU per cell. Analysis of CD34+ and GFP expression was performed using a forward- and sidescatter gate that included both normal and activated cells. The percentage of CD34+ cells that were GFP+ and the mean fluorescence intensity are shown in the upper right quadrants. (B) Effect of the number of cycles of transduction on the percentage of GFP+ CD34+ cells. Rhesus CD34+ cells were transduced with VRX494 (filled symbols) or LZRS-GFP (open symbols) for the indicated number of cycles at m.o.i. of 25 or 3–8, respectively. (C) Effect of m.o.i. on the percentage of GFP+ CD34+ cells. Rhesus CD34+ cells were transduced four times at the indicated m.o.i. over 4 days with either VRX494 (filled symbols) or LZRS-GFP (open symbols). The diamond, triangle, circle, and square symbols indicate separate experiments.
as the m.o.i. increased (data not shown), again indicating the possibility of multiple copies of provirus per cell. We observed transduction efficiencies with the MLV-based vector that were comparable to those observed with VRX494 at equivalent m.o.i. and transduction cycles (open symbols in Figs. 3B and 3C). T Cell Differentiation of VRX494-Transduced CD34+ Cells Because differentiation of T cells generally occurs only in the thymus, in vitro analysis of T cells derived from transduced CD34+ progenitor cells has been limited. We utilized rhesus thymic stromal cultures to support T cell differentiation of transduced rhesus CD34+ cells. We transduced rhesus CD34 + cells with VRX494 as described above using varying numbers of transduction cycles (1 to 4) and m.o.i. (5–25 IU/cell) and then cultured them on rhesus thymic stroma to support T cell differentiation. Nontransduced CD34+ cells were processed in parallel as controls.
1160
We cultured VRX494-transduced and control CD34+ cells with thymic stroma for 3 weeks and then expanded and analyzed them for mature T cell markers and for GFP expression (Fig. 4A). T cells derived from VRX494transduced CD34+ cells were similar to T cells derived from control CD34+ cells in the number of cells and the percentage of double-positive and single-positive CD4 or CD8 cells (data not shown). Compared to the percentage of GFP expression in transduced CD34+ cells, the percentage of GFP expression in T cells was consistently lower by two- to fivefold (compare Figs. 4B and 4C with Figs. 3B and 3C). For example using an m.o.i. of 25 over four cycles, the percentage of CD34+ cells expressing GFP ranged from 35 to 53%, while GFP expression in T cell progeny ranged between 7 and 20%. In Vitro Inhibition of SHIV Replication in CD4+ T Cells Derived from VRX494-Transduced CD34+ Cells To determine the ability of VRX494 to inhibit viral replication in T cells derived from transduced CD34+
MOLECULAR THERAPY Vol. 12, No. 6, December 2005 Copyright C The American Society of Gene Therapy
doi:10.1016/j.ymthe.2005.07.698
ARTICLE
FIG. 4. Expression of GFP in T cells derived from VRX494-transduced CD34+ cells. (A) T cells derived from VRX494-transduced rhesus CD34+ bone marrow cells. Left: CD4 versus CD8 expression in CD3+ lymphocytes. CD4+ CD8 cells, in the lower right quadrant, were gated. Right: Histogram of GFP expression in CD3+ CD4+ CD8 cells derived from VRX494-transduced CD34+ rhesus bone marrow cells. (B) Effect of the number of cycles of transduction on the percentage of GFP+ CD4+ T cells derived from CD34+ cells when transduced with VRX494 (filled) or LZRS-GFP (open) at m.o.i. 25 or 3 to 8, respectively. (C) Effect of m.o.i. on the percentage of GFP+ CD4+ T cells derived from CD34+ cells transduced four times over 4 days with VRX494 (filled) or LZRS-GFP (open) vectors. The diamond, triangle, circle, and square symbols indicate separate experiments.
cells, we expanded T cells containing VRX494 and restimulated them every 14 days with concanavalin A (ConA), IL-2, irradiated human PBMC, and rhesus B cells. We obtained purified CD3+ CD4+ CD8 GFP+ or CD3+ CD4+ CD8 GFP cells by sorting the VRX494transduced or the control nontransduced populations, respectively. We challenged these CD4+ T cells with SHIV 89.6P and SHIV HXBC2P 3.2 at viral concentrations of 1 and 0.1 ng p27 Gag per 1 106 cells and followed them for p27 Gag production for 14 days. As shown in Fig. 5A, control CD4+ T cells supported vigorous SHIV 89.6P replication, exceeding 250 ng p27 Gag per 106 CD4+ T cells, even at the lower m.o.i. However, in CD4+ T cells derived from VRX494-transduced CD34+ cells, SHIV 89.6P viral replication was inhibited 200- to 2000-fold, depending on the m.o.i. Similarly, we observed inhibition of SHIV HXBC2P 3.2 replication in vector-modified T cells (40- and 5-fold), although levels of SHIV HXBC2P 3.2 viral replication were slightly lower than observed with SHIV 89.6P, especially at the lower m.o.i. (Fig. 5B).
MOLECULAR THERAPY Vol. 12, No. 6, December 2005 Copyright C The American Society of Gene Therapy
Analysis of Vector Copy Number in T Cell Clones Derived from Transduced CD34+ T Cells The development of leukemia associated with integration of a retroviral vector in patients undergoing bone marrow transplantation with transduced bone marrow cells as treatment for severe combined immunodeficiency has highlighted concerns regarding the potential for insertional mutagenesis by retroviral vectors [27,31]. Although we optimized transduction conditions to minimize the possibility of multiple integrants per cell while maintaining efficient transduction, we wished to determine if multiple proviral integrants might be occurring in a subset of transduced cells. We obtained T cell clones by limiting dilution cloning of CD4+ GFP+ T cells derived from CD34+ cells that had been transduced four times with an m.o.i. of 25 IU/ cell, resulting in 45% GFP+ CD34+ cells and 13% GFP+ CD4+ T cells. Southern analysis of DNA from these T cell clones digested with NcoI, which cuts VRX494 only once, revealed that 5 of 16 clones (31%) had three integrated copies per cell, while the remaining
1161
ARTICLE
FIG. 5. CD4+ T cells derived from VRX494-transduced CD34+ cells (filled) or from nontransduced CD34+ cells (open) were challenged with (A) SHIV 89.6P or (B) SHIV HXBC2P 3.2 at 1 (square) and 0.1 (diamond) ng Gag p27 per 1 F 106 cells. The CD4+ T cells were infected and followed for 2 weeks. Viral replication was assessed by SIV Gag p27 ELISA. Results shown are representative of two experiments for each virus.
11 clones had only one integrated copy per cell (Fig. 6 and data not shown). Interestingly, all clones examined shared a common 4.7-kb fragment, while the clones containing three copies per cell also had common bands of 7.1 and 8.2 kb. This pattern most likely reflects transduction of previously transduced progenitors after cell division. Expansion of a small number of transduced T cell clones probably accounts for the observed clonal frequency. Southern analysis of DNA from these T cell clones digested with SacI, which cuts once in each of the HIV-1 LTRs and generates a single band corresponding to the length of the proviral insert, confirmed that no rearrangement of vector sequences had taken place in any of these T cell clones (data not shown). Examination of proviral copy number per cell by real-time PCR confirmed the presence of multiple vector copies per cell in the five clones that had multiple integrants on Southern blot analysis (data not shown). Thus, even using transduction conditions that resulted in transduction of only 45% of CD34+ cells, multiple integration events occurred in a significant subpopulation of T cells derived from these cells.
1162
doi:10.1016/j.ymthe.2005.07.698
Analysis of the Effects of Tat and Rev on Expression of GFP and Antisense Envelope Transcription and processing of HIV-1 messages are known to be dependent upon Tat and Rev [32]. However, we observed expression of GFP in VRX494-transduced cells in the absence of Tat or Rev. To determine the effect of HIV-1 accessory genes on expression of the VRX494 vector, we infected untransduced CEMx174 and CEMx174-VRX494 cells at an m.o.i. of 0.1 TCID50 per cell. After 4 days of culture, we collected infected and uninfected cells and stained them for intracellular expression of HIV-1 Gag (Fig. 7A). Four days postinfection, 16.3% of untransduced CEMx174 cells expressed p24 Gag (MFI 527). Uninfected CEMx174-VRX494 expressed GFP at moderate levels prior to challenge. Four days postinfection, only 8.4% of CEMx174-VRX494 changed gates and expression of p24 Gag was lower (MFI 337) than in CEMx174-NT; however, expression of GFP was substantially increased (MFI 4071) over uninfected CEMx174-VRX494 (MFI 118). These results demonstrate inhibition of Gag production in VRX494tranduced cells and increased expression of the VRX494 vector after HIV-1 infection. To determine the relative expression and the responsiveness of VRX494 transcripts to Tat and Rev, we transiently transfected Tat and Rev expression plasmids into 293T cells stably transduced with VRX494 (293TVRX494) and analyzed expression of GFP and the antisense inhibitor RNA by quantitative RT-PCR and expression of GFP by flow cytometry. As shown in Fig. 7B, expression of GFP RNA and GFP fluorescence occurred at detectable levels in 293T-VRX494 without Tat or Rev expression (Ctrl). However, in the presence of Tat, both GFP RNA and GFP fluorescence were signifi-
FIG. 6. Southern analysis of T cell clones. T cell clones were isolated from T cells derived in vitro from VRX494-transduced CD34+ cells. Genomic DNA from the clones was digested with NcoI (a restriction enzyme with one recognition site in VRX494), separated by electrophoresis, blotted to membranes, and probed with GFP. The sizes of the bands are indicated. Multiple bands are indicative of multiple lentiviral integrations. Six representative clones of 16 total are shown.
MOLECULAR THERAPY Vol. 12, No. 6, December 2005 Copyright C The American Society of Gene Therapy
ARTICLE
doi:10.1016/j.ymthe.2005.07.698
FIG. 7. Expression of VRX494 is responsive to the expression of Tat. (A) VRX494-transduced CEMx174 cells were infected with HIV-1 NL4-3 at 0.1 TCID50 per cell. After 4 days, cells were stained with a PE-conjugated antibody to HIV-1 Gag and analyzed by flow cytometry for expression of GFP and p24 Gag. R2 and R6 describe the gates for uninfected cells. R3 and R7 describe the gates for HIV-1-infected cells. (B) VRX494-transduced 293T cells were transiently transfected with control, Tat, Rev, or both Tat and Rev expression vectors. RNA levels for HIV envelope inhibitor (Antisense Env) and for GFP were determined by real-time RTPCR. Expression of GFP was determined by flow cytometry. Results show the average F standard deviation for three samples.
cantly increased (30- and 4.2-fold, respectively). Rev did not affect levels of GFP RNA or fluorescence, either by itself or in the presence of Tat (Fig. 7B). Expression of the antisense inhibitor in 293T-VRX494 followed expression of GFP; the inhibitor RNA was expressed at low levels in the absence of Tat and Rev, but increased approximately 30-fold with expression of Tat. There was no significant effect of Rev on expression of the antisense envelope sequence. Thus, although transcription of GFP and antisense envelope occurred in the absence of Tat, expression of the HIV-1 promoter in VRX494-transduced cells was significantly upregulated by Tat protein expression and by viral infection, leading to the inhibition of p24 Gag production. Molecular Mechanisms of Antisense HIV Envelope Inhibition Antisense inhibitors could potentially use several mechanisms to block expression of target genes. A previous study of antisense RNA-mediated regulation of early polyomavirus transcripts suggested that double-stranded RNA-specific adenosine deaminase (dsRAD) led to A-to-G nucleotide changes in antisense sequences and nuclear retention of the targeted transcripts [33]. Based on sequencing data of viruses produced in VRX494-transduced cells, Lu et al. observed a high rate of A-to-G mutations in the antisense target region [8]. To address whether a dsRAD-dependent mechanism was also involved in inhibition of HIV-1 replication by VRX494, we infected CEMx174-VRX494 cells with HIV-1 NL4-3 (m.o.i. of 0.1 TCID50 per cell) and analyzed for Gag
MOLECULAR THERAPY Vol. 12, No. 6, December 2005 Copyright C The American Society of Gene Therapy
production and for potential modification in RNA–RNA hybrids. As previously shown in Fig. 7A, production of p24 Gag after infection with HIV-1 NL4-3 was reduced in CEMx174-VRX494 compared to CEMx174-NT. To determine whether the RNA–RNA hybrids were modified by a dsRAD activity, we amplified HIV envelope sequences homologous to the antisense inhibitor in VRX494 by RTPCR from CEMx174-VRX494 and then digested them with DraI. Deamination of adenosine to inosine by dsRAD alters base pairing during the next round of DNA synthesis and results in A-to-G mutations [34]. Modifications in the DraI site (TTT^AAA recognition sequence with three potential deamination targets) will result in an RT-PCR product resistant to digestion. As shown in Fig. 8, the undigested RT-PCR product from the CEMx174-VRX494 is increased above the undigested product from the CEMx174-NT cells. Densitometric analysis of the electronic image revealed that 13.6% of the HIV-1 envelope sequences in CEMx174-VRX494 were resistant to DraI digestion and, therefore, had been modified/mutated; only 2.6% of the envelope sequences from CEMx174-NT were resistant. These results indicate that significant modification of the HIV-1 envelope sequences occurs in VRX494-transduced cells, most likely by dsRAD or a related enzyme.
DISCUSSION In these studies, we transduced CEMx174 cells and rhesus CD34+ bone marrow cells with the lentiviral vector VRX494, induced CD4+ T differentiation from the trans-
1163
ARTICLE
FIG. 8. Mechanism of antisense inhibition. Analysis for adenosine modifications in RNA–RNA hybrids in VRX494-transduced CEMx174 cells after infection with HIV-1 NL4-3. RNA samples were harvested from the cells on day 3. Potential hybrid sequences were amplified by RT-PCR and digested with DraI. Modifications to the recognition sequence result in the loss of the DraI restriction site (TTT^AAA).
duced CD34+ bone marrow cells during in vitro culture with rhesus fetal thymus stroma, and demonstrated potent inhibition of HIV-1 and several SHIV strains in VRX494-transduced cells mediated through antisense HIV-1 envelope sequences. These results demonstrate protection of progeny T cells with a clinically relevant lentiviral vector in an in vitro system of stem cell gene therapy for AIDS. Lentiviral vectors have a number of distinct advantages in a gene therapy strategy for AIDS, including the ability to transduce nondividing cells, Tat-regulated expression, and the potential to compete for accessory genes. As hematopoietic stem cells are thought to be quiescent, lentiviral vectors are being developed as an alternative strategy to introduce genes efficiently into these cells [14,15]. Successful transduction of hematopoietic stem cells with a vector expressing an inhibitory gene has the potential for protecting multiple hematopoietic cell lineages against HIV-1 infection for a lifetime. With the appropriate regulation of antiviral transcripts, constitutive high-level expression of foreign genes that results in unexpected toxicity may be avoided. We observed basal levels of expression of both GFP and the antisense Env molecule in VRX494-transduced cells but observed significant upregulation with the expression of Tat. The combination of basal expression coupled with Tatdependent upregulation that we observed with VRX494 may have distinctive advantages for stem cell gene therapy for AIDS, in providing a regulatable balance between optimal inhibition of viral replication and minimization of toxicity. Regulatory sequences in the lentiviral backbone may also bind to accessory proteins and provide an additional level of inhibition. Antisensebased strategies have been shown to provide potent inhibition against HIV-1 replication, particularly with longer sequences [8,9,35,36]. In contrast to siRNA-based
1164
doi:10.1016/j.ymthe.2005.07.698
strategies, the ability of antisense molecules to target multiple base pairs significantly reduces their susceptibility to evolution of escape mutations [8,9]. Previous studies with the lentiviral VRX494 vector have demonstrated potent inhibition of multiple primary HIV-1 isolates in transformed cell lines and primary human CD4 + T lymphocytes [25], although no prior studies have been conducted with VRX494 in an in vitro model for stem cell gene therapy. The molecular mechanisms that underlie antisensemediated inhibition of target genes are incompletely understood. Although we observed the strongest inhibition following challenge with HIV-1 NL4-3, we also observed relatively robust inhibition with diverse SHIV strains expressing the HIV-1 envelope and the lack of significant inhibition for SIVmac239, the backbone for the SHIV isolates. Similar to what has been observed in other systems [33], we demonstrated modifications within the HIV-1 NL4-3 envelope mRNA consistent with A-to-G mutations induced by dsRAD activity in VRX494-transduced cells after infection with HIV-1 [8]. Antisense-mediated inhibition by dsRAD pathway is believed to take place predominantly in the nucleus [33], and this characteristic is consistent with the fact that the unspliced antisense Env sequence will be localized primarily to the nucleus in the absence of Rev. We cannot exclude the contributions of other pathways to viral inhibition, for instance, induction of interferon by dsRNA or subsequent processing of dsRNA into short inhibitory RNA molecules that may mediate degradation through an RNAi mechanism [37]. Additionally, we did not detect any production of IFNa in the supernatant of transduced cells expressing HIV-1 envelope (data not shown). Competition of HIV1 lentiviral vector transcripts for packaging of wild-type HIV-1 RNA has been demonstrated by several groups [24,35,38] and may in part explain the higher degree of inhibition that we observed with HIV-1 NL4-3. Overall, these results strongly suggest that sequencespecific antisense interference of viral replication, rather than competition of VRX494 transcripts for packaging, is the major mechanism of inhibition of SHIV replication [8]. Although multiple reports have evaluated optimization of transduction of CD34+ hematopoietic cells with lentiviral vectors, we studied the effects of m.o.i. and number of transduction cycles on transduction efficiency so as to minimize the potential for multiple vector integrants. Even though lentiviral vectors have been shown to transduce nondividing cells even without stimulation [14,15], lentiviral vectors more effectively transduce cytokine-activated CD34+ cells and more primitive hematopoietic progenitor cells ([30,39] and our data). While multiple rounds of transduction used in our protocol create the opportunity for transduced cells to undergo additional integration events in subse-
MOLECULAR THERAPY Vol. 12, No. 6, December 2005 Copyright C The American Society of Gene Therapy
ARTICLE
doi:10.1016/j.ymthe.2005.07.698
quent rounds of transduction, we observed the most efficient transduction following the third and fourth stimulation/transduction cycles. We observed consistently lower transduction of CD4+ T cells derived from VRX494- and oncoretroviral-transduced CD34+ cells. Several factors may explain this finding, although less effective transduction of the subpopulation of CD34+ T cell progenitors compared to the bulk population of CD34+ by the VRX494 lentiviral and the oncoretroviral vectors probably accounts for most of this discrepancy, as has been observed for human T cell progeny [40,41]. Our transduction conditions may in part reflect the relative resistance of nonhuman primate cells to infection by HIV-1 or transduction with an HIV-1-based vector due to the TRIM-5a protein [42], whereas a SIV-based vector is likely to result in more efficient transduction with lower m.o.i. or fewer transduction cycles [43]. Concern for the potential of insertional mutagenesis is reinforced by our demonstration of multiple vector integrants in a subpopulation of CD4+ T cells derived from transduced CD34+ hematopoietic cells [44]. Although the risk of insertional mutagenesis by lentiviruses is unknown, the potential risk is compounded by multiple integration events even though HIV-induced insertional mutagenesis has been reported only rarely [45] and in stark contrast to the well-documented ability of oncoretroviruses to transform cells [46]. This may be due to the preferential integration sites of HIV-1 versus oncoretroviruses [47] or to the intrinsic activity of the different promoters/ enhancer elements in transactivating proximal genes. In the end, the optimal transduction conditions for HSC and T cell progenitors with lentiviral vectors are likely to be a balance between increasing the gene transfer efficiency and minimizing the risk of toxicity and multiple vector integrants. Overall, these results reinforce the importance of long-term in vitro experiments to optimize transduction conditions and the importance of nonhuman primate studies to address the safety of HIV-1-based lentiviral vectors. Rhesus macaques infected with SIV or SHIV represent the leading animal model for the study of AIDS and have also been widely employed for preclinical studies of stem cell gene therapy. The availability of pathogenic SHIV isolates containing HIV-1 envelope, tat, and rev sequences offers a valuable in vivo model to analyze the efficacy and toxicity of gene therapy strategies directed at these HIV-1 target genes. Because rhesus macaques offer an opportunity to address the many potential barriers to stem cell gene for AIDS, including the limited success of oncoretroviral and lentiviral vectors in large animal and human clinical trials, the possibility that bone marrow or thymic dysfunction may limit immune reconstitution, and the potential role of vector-induced insertional mutagenesis, ongoing studies in nonhuman primates are likely to play a key role in the preclinical evaluation of stem cell gene therapy strategies.
MOLECULAR THERAPY Vol. 12, No. 6, December 2005 Copyright C The American Society of Gene Therapy
MATERIAL
AND
METHODS
Cell culture. The cell line CEMx174 was cultured in RPMI 1640 (Sigma, St. Louis, MO, USA) plus 20% fetal bovine serum (FBS; HyClone, Logan, UT, USA), 10 mM Hepes (Cellgro/Mediatech, Fisher Scientific, Federal Way, WA, USA), 50 U/ml penicillin and 50 Ag/ml streptomycin (Cellgro/ Mediatech), and 2 mM l-glutamine (Cellgro/Mediatech) (R20 medium) at 378C with 5% CO2. 293T cells were cultured in DMEM plus 10% FBS, 10 mM Hepes, 50 U/ml penicillin and 50 Ag/ml streptomycin, and 2 mM lglutamine (D10 medium) at 378C with 5% CO2. Rhesus macaque bone marrow cells were harvested and CD34+ cells were isolated with immunomagnetic beads (Dynal, Lake Success, NY, USA) as previously described [5]. Fetal thymic stroma cells were isolated and cryopreserved and then cultured in 24-well plates with R10 medium as previously described [48]. Control or transduced rhesus CD34+ cells (2 to 4 105 cells per well) were cultured on thymus stroma for 21 days to support their differentiation into T cells. In vitro-derived T cell cultures and sorted CD4+ T cell cultures were expanded by stimulation with ConA (5 Ag/ml; Sigma) and recombinant human IL-2 (50 U/ml, provided by Dr. M. Gately, Hoffman-La Roche, Nutley, NJ, USA) in the presence of 0.5 to 10 106 irradiated (3000 rad) human PBMC feeder cells. T cell clones were isolated by plating CD4+ T cell cultures at 0.5, 1, and 5 cells per well, in the presence of 5 Ag/ml ConA, 50 U/ml recombinant human IL-2, and 105 irradiated human PBMC in 96-well plates. The percentage of wells exhibiting growth at these different plating densities ranged from 2 to 15%. Clones were reexpanded by repeated stimulation with ConA and irradiated human PBMC every 10 to 14 days as previously described [49]. Retroviral vectors. The lentiviral vector VRX494 containing the C packaging signal, the central polypurine tract, 937 bp of antisense HIV1 envelope derived from the HIV-1 strain NL4-3, the RRE, and eGFP transcriptionally regulated by the HIV-1 LTR was obtained from VIRxSYS (Gaithersburg, MD, USA). Virions were produced by calcium phosphatemediated transfection of the VRX494 transfer vector and the VIRPAC packaging construct, a plasmid that expresses Gag–Pol, Tat, Rev, and VSVG, into 293 cells. Supernatant was collected every 12 h from 24 to 48 h after transfection, pooled, and then concentrated by high-speed centrifugation at 10,000g for 12 h. The vector was resuspended at approximately 1/400 of its original volume in buffer containing 60 mM NaCl and 25 mM Hepes at pH 7.2 and then frozen at 808C. Dilutions of viral stock were used to transduce HeLa-Tat cells and the percentage GFP-positive cells was determined by flow cytometry. Stock titers ranged from 1 to 5 109 IU/ml. The vector preparation was thawed once, aliquoted, and refrozen at 808C. Supernatant for the oncoretroviral control vector LZRS-eGFP was generated from the Phoenix amphotropic packaging cell line in StemSpan SFEM medium (Stem Cell Technologies, Vancouver, BC, Canada), which produced titers of approximately 5 105 IU/ml as previously described [50]. Transduction. CEMx174 cells were transduced with one overnight exposure to the VRX494 vector at m.o.i. of 50, 5, and 0.5 IU per cell in R20 medium plus 8 Ag/ml Polybrene (Sigma). After 24 h, the cells were washed and expanded in R20 medium. CEMx174 GFP cells were generated by transduction with the LZRS-eGFP vector by overnight exposure to viral supernatants in the presence of 8 Ag/ml Polybrene [5] and subsequently sorted for GFP+ cells. 293T cells were transduced with VRX494 in D10 medium plus 8 Ag/ml Polybrene overnight. Rhesus CD34+ cells were cultured in 24-well plates coated with 20 Ag/well recombinant human fibronectin fragment CH-296 (Retronectin; BioWhittaker, Walkersville, MD, USA) at 2 105 cells per well in 2 ml StemSpan SFEM medium supplemented with 10 or 100 ng/ml human Tpo (R&D Systems, Minneapolis, MN, USA), 50 or 100 ng/ml Flt3L (R&D Systems), and 50 or 100 ng/ml SCF (R&D Systems). Purified VRX494 lentiviral vector was added to CD34+ cells at m.o.i. of 5, 10, 15, 25, and/or 50 IU/cell on days 0, 1, 2, and/or 3 of stimulation. VRX494-transduced CEMx174 cells and CD4+ T cells derived from transduced CD34+ cells were analyzed for the presence of replication-competent lentivirus by incubating supernatant from transduced cells with T2-SEAP cells (obtained from Welkin Johnson, NEPRC, HMS), in which expression of secreted embryonic alkaline
1165
ARTICLE
phosphate (SEAP) is Tat-dependent. SEAP expression in cell-free supernatant was measured 3 days postinfection using the Phospha-Light System (Tropix, Applied Biosystems). Based on experiments with HIV-1 NL4-3, this assay has a lower limit of detection of 50 infectious particles per milliliter. All assays for replication-competent lentivirus were negative. Flow-cytometric analysis. Suspensions of T cells were resuspended in PBS with 2% mouse serum (Sigma) and stained by incubation with macaquespecific PE-conjugated anti-CD3 antibodies (clone SP34; BD–PharMingen) or the appropriate isotype control (BD–PharMingen) and with APCconjugated anti-CD4 antibodies (clone SK3; BD–PharMingen), PerCPconjugated anti-CD8 antibodies (clone SK1; BD–PharMingen), or an isotype control (BD–PharMingen) for 30 min at 48C. The cells were washed and analyzed for the percentage of cells in each population by flow cytometry using a FACSCalibur (Becton–Dickinson). GFP expression was measured in the FITC channel. CD3+ CD4+ CD8 GFP+ T cells were sorted using a Becton–Dickinson FACSVantage. Intracellular HIV-1 p24 Gag expression was measured in CEMx174 using Perm and Fix (Caltag Laboratories, Burlingame, CA, USA) and staining with PE-conjugated HIV1 p24 Gag antibody (clone KC57; BD–PharMingen). The cells were washed and analyzed for expression of GFP and HIV-1 Gag by flow cytometry. Viral inhibition assays. HIV-1 strain NL4-3 and SIVmac239 were kindly provided by Ronald C. Desrosiers (NEPRC, HMS) and SHIV DH12 and SHIV DH12R by Malcom Martin (NIH) [20]; SHIV 89.6P was kindly provided by Keith Reimann (Beth Israel) [22] and SHIV HXBC2P 3.2 by Joseph P. Sodroski (Dana Farber) [21]. Viral stocks were generated by infection of CEMx174 cells and harvest of cell-free supernatants on day 8– 12 after infection. Virus stocks were analyzed for Gag production by ELISA (HIV p24 Coulter HIV-1 Core Antigen Assay or SIV p27 Coulter SIV Core Antigen Assay; Coulter International Corp., Miami, FL, USA) per the manufacturer’s instructions and/or titered for TCID50 values by limiting dilution assay as previously described [51]. VRX494-transduced and control LZRS-GFP- [5] transduced CEMx174 cells or VRX494-transduced GFP+ CD4+ T cells and nontransduced CD4+ T cells were resuspended in HIV-1, SHIV, or SIV viral supernatant at m.o.i. of 0.01 to 0.1 TCID50/cell or at concentrations of 0.1 to 1.0 ng/ml per 1 106 cells for 4 h before being washed, and cultures were initiated in 2 ml medium. At the indicated time points, cell-free supernatants were collected and infected cells were counted by trypan blue exclusion and were adjusted to 1 or 2 106 viable cells per well. Viral replication was assessed by measuring p24 or p27 Gag production in the supernatant with ELISA as described above. Molecular analysis. Genomic DNA was isolated from transduced cells using the Purgene DNA Isolation Kit (Gentra, Inc., St. Paul, MN, USA) or QIAamp Blood Mini Kits (Qiagen, Valencia, CA, USA). Quantitative Taqman PCR analysis of the HIV LTR was performed using the ABI Prism 7700 Sequence Detection System (PE Applied Biosystems, Foster City, CA, USA). The primer and probe sequences were specific for the HIV-1 LTR as follows: forward primer 5V-GTTTGACAGCCGCCTAGCA-3V, reverse primer 5V-CTCGATGTCAGCAGTTCTTGAAGT-3V, and fluorescent probe 6FAM–TCATCACATGGCCCGAGAGCTGC–TAMRA. Reaction mixtures containing 200 ng genomic DNA, 400 nM each primer, and 200 nM probe in 50 Al 1 PCR mixture (PE Applied Biosystems) were amplified with an annealing temperature of 608C, elongation temperature of 728C, and denaturation temperature of 948C for 40 cycles. Genomic DNA (10 Ag) from the T cell clones was digested with either SacI or SalI, separated by agarose gel electrophoresis, and transferred to a Nytran membrane using 0.4 M NaOH in the TurboBlotter transfer system (Schleicher and Schuell, Keene, NH, USA). The membrane was blocked and hybridized in QuikHyb (Stratagene, La Jolla, CA, USA) with GFP sequences that were radiolabeled ([a-32P]dCTP; Amersham Corp., Arlington Heights, IL, USA) using the PrimeIt II labeling kit (Stratagene). After two ambient temperature washes, the membrane was washed in 2 SSC/ 0.1% SDS for 30 min at 688C and exposed to film (Kodak X-OMAT; Eastman Kodak Co., Rochester, NY, USA). 293T-VRX494 cells (4–5 106 cells per 10-cm plate) were transiently transfected with control, Tat (2.5 Ag), Rev (2.5 Ag), or Tat and Rev
1166
doi:10.1016/j.ymthe.2005.07.698
expression plasmids (5 Ag total) by calcium phosphate coprecipitation (Stratagene). Cells were washed with PBS after 16 h and harvested after 48 h for expression of GFP by flow cytometry and for expression of the antisense HIV-1 envelope inhibitor or the GFP RNA by TaqMan RT-PCR. Total cellular RNA was isolated from the 293T cells using the Qiagen RNAeasy Mini Kit (Qiagen). Expression of the antisense HIV-1 envelope inhibitor in VRX494 was quantified using Taqman RT-PCR with forward primer (5V-AGAAGAACGGCATCAAGGTGAA-3V), reverse primer (5VGGACTGGGTGCTCAGGTAGTG-3V), and fluorescent probe (6FAM–AAGATCCGCCACAACATCGAGGACG–TAMRA), using the ABI Prism 7700 Sequence Detection System. Reaction mixtures containing 1 Ag RNA, 400 nM each primer, and 200 nM probe in 50 Al of 1 Master Mix (PE Applied Biosystems) were amplified for 40 cycles with a denaturation temperature of 958C for 15 s and annealing temperature of 608C for 60 s. The GFP sequences were quantified using Taqman RT-PCR with forward primer (5VCTGCACCACCGGCAA-3V), reverse primer (5V-GTAGCGGCTGAAGCACTG-3V), and fluorescent probe (6FAM–CCACCCTGACCTACGGCGTG– TAMRA) [52]. Reaction mixtures containing 1 Ag RNA, 400 nM each primer, and 200 nM probe in 50 Al of 1 Master Mix (PE Applied Biosystems) were amplified for 40 cycles with denaturation temperature of 958C for 15 s and annealing temperature of 608C for 60 s. Known copy numbers of NL4-3 envelope sequences or GFP sequences were used to generate the standard curves. Control CEMx174 cells and VRX494-transduced CEMx174 cells were infected with HIV-1 NL4-3 at m.o.i. of 0.1 TCID50 per cell for 4 h and then washed and cultured in R20 medium with 5% CO2. Cells were harvested after 72 h for analysis of HIV envelope mRNA and for intracellular Gag expression. To detect potential adenosine modifications (lack of restriction digestion indicates modifications to the recognition sequence), total RNA from the transduced 293T cells after transfection was reverse transcribed with R7001 (5V-TCTTCTTCTGCTAGACTGCC-3V) and PCR amplified with the addition of F6447 (5VCTTGTGGAGATGGGGGT-3V). Even though the target sequences are present in both the vector and the provirus, only proviral RNA should be detected since the R7001 primer was used for reverse transcription. The resulting 555-bp product was digested with DraI (TTT^AAA), generating 171- and 384-bp fragments. Samples were separated by agarose electrophoresis and stained with ethidium bromide. The image was captured using the Alpha Innoteck Corp. Imager program version 3.24 (Alpha Innoteck Corp., San Leandro, CA, USA) and each band was quantified using NIH Image software version 1.62.
ACKNOWLEDGMENTS These studies were supported by National Institutes of Health Grants CA 73473 and RR00168 and by a developmental award from the Partners/Fenway/ Shattuck Center for AIDS Research, an NIH-funded program (AI 42851). We thank Welkin Johnson (NEPRC, HMS) for the T2-SEAP cells, Malcolm Martin (NIH) for SHIV DH12 and SHIV DH12R viral stocks and for pNL4-3 (through the AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH), Mark Cayabyab and Joseph Sodroski (Dana Farber) for the SHIV HXBC2P 3.2 viral stock and viral genome, Keith Reimann (Beth Israel) for the SHIV 89.6P viral stock and for the SHIV 89.6P genome, Ronald Desrosiers (NEPRC, HMS) for the HIV NL4-3 and SIVmac239 viral stocks, and Mark Wainberg (McGill University) for the full-length SIVmac239 genome. We also thank Brian Harty for technical assistance and Carolyn O’Toole, Noel Bane, and Barbara Klinedinst for assistance with manuscript preparation. RECEIVED FOR PUBLICATION APRIL 28, 2004; REVISED JULY 10, 2005; ACCEPTED JULY 28, 2005.
REFERENCES 1. Little, S. J., et al. (2002). Antiretroviral-drug resistance among patients recently infected with HIV. N. Engl. J. Med. 347: 385 – 394. 2. Lucas, G. M., Chaisson, R. E., and Moore, R. D. (1999). Highly active antiretroviral therapy in a large urban clinic: risk factors for virologic failure and adverse drug reactions. Ann. Intern. Med. 131: 81 – 87. 3. Dornburg, R., and Pomerantz, R. J. (2000). HIV-1 gene therapy: promise for the future. Adv. Pharmacol. 49: 229 – 261.
MOLECULAR THERAPY Vol. 12, No. 6, December 2005 Copyright C The American Society of Gene Therapy
ARTICLE
doi:10.1016/j.ymthe.2005.07.698
4. Riddell, S. R., et al. (1996). T-cell mediated rejection of gene-modified HIV-specific cytotoxic T lymphocytes in HIV-infected patients. Nat. Med. 2: 216 – 223. 5. Rosenzweig, M., et al. (2001). Induction of cytotoxic T lymphocyte and antibody responses to enhanced green fluorescent protein following transplantation of transduced CD34+ hematopoietic cells. Blood 97: 1951 – 1959. 6. Lee, N. S., et al. (2002). Expression of small interfering RNAs targeted against HIV-1 rev transcripts in human cells. Nat. Biotechnol. 19: 500 – 505. 7. Boden, D., Pusch, O., Lee, F., Tucker, L., and Ramratnam, B. (2003). Human immunodeficiency virus type 1 escape from RNA interference. J. Virol. 77: 11531 – 11535. 8. Lu, X., et al. (2004). Antisense-mediated inhibition of human immunodeficiency virus (HIV) replication by use of an HIV type 1-based vector results in severely attenuated mutants incapable of developing resistance. J. Virol. 78: 7079 – 7088. 9. Rhodes, A., and James, W. (1991). Inhibition of heterologous strains of HIV by antisense RNA. AIDS 5: 145 – 151. 10. Kohn, D. B., et al. (1999). A clinical trial of retroviral-mediated transfer of a revresponsive element decoy gene into CD34(+) cells from the bone marrow of human immunodeficiency virus-1-infected children. Blood 94: 368 – 371. 11. Malech, H. L., et al. (1997). Prolonged production of NADPH oxidase-corrected granulocytes after gene therapy of chronic granulomatous disease. Proc. Natl. Acad. Sci. USA 94: 12133 – 12138. 12. Cavazzana-Calvo, M., et al. (2000). Gene therapy of human severe combined immunodeficiency (SCID)-X1 disease. Science 288: 669 – 672. 13. Miller, D. G., Adam, M. A., and Miller, A. D. (1990). Gene transfer by retrovirus vectors occurs only in cells that are actively replicating at the time of infection. Mol. Cell. Biol. 10: 4239 – 4242. 14. Case, S. S., et al. (1999). Stable transduction of quiescent CD34(+)CD38() human hematopoietic cells by HIV-1-based lentiviral vectors. Proc. Natl. Acad. Sci. USA 96: 2988 – 2993. 15. Miyoshi, H., Smith, K. A., Mosier, D. E., Verma, I. M., and Torbett, B. E. (1999). Transduction of human CD34+ cells that mediate long-term engraftment of NOD/ SCID mice by HIV vectors. Science 283: 682 – 686. 16. Davis, B. M., Humeau, L., and Dropulic, B. (2004). In vivo selection for human and murine hematopoietic cells transduced with a therapeutic MGMT lentiviral vector that inhibits HIV replication. Mol. Ther. 9: 160 – 172. 17. Davis, B., et al. (2004). ABC transporter inhibitors that are substrates enhance lentiviral vector transduction into primitive hematopoietic progenitor cells. Blood 104: 364 – 373. 18. Zielske, S. P., and Gerson, S. L. (2003). Cytokines, including stem cell factor alone, enhance lentiviral transduction in nondividing human LTCIC and NOD/SCID repopulating cells. Mol. Ther. 7: 325 – 333. 19. Kindt, T. J., Hirsch, V. M., Johnson, P. R., and Sawasdikosol, S. (1992). Animal models for acquired immunodeficiency syndrome. Adv. Immunol. 52: 425 – 475. 20. Endo, Y., et al. (2000). Short- and long-term clinical outcomes in rhesus monkeys inoculated with a highly pathogenic chimeric simian/human immunodeficiency virus. J. Virol. 74: 6935 – 6945. 21. Cayabyab, M., et al. (1999). Changes in human immunodeficiency virus type 1 envelope glycoproteins responsible for the pathogenicity of a multiply passaged simian-human immunodeficiency virus (SHIV-HXBc2). J. Virol. 73: 976 – 984. 22. Reimann, K. A., et al. (1996). A chimeric simian/human immunodeficiency virus expressing a primary patient HIV-1 isolate env causes an AIDS-like disease after in vivo passage in rhesus monkeys. J. Virol. 70: 6922 – 6928. 23. Lu, X., et al. (2004). Safe two-plasmid production for the first clinical lentivirus vector that achieves N99% transduction in primary cells using a one-step protocol. J. Gene Med. 6: 963 – 973. 24. Dropulic, B., Hermankova, M., and Pitha, P. M. (1996). A conditionally replicating HIV1 vector interferes with wild-type HIV-1 replication and spread. Proc. Natl. Acad. Sci. USA 93: 11103 – 11108. 25. Humeau, L., et al. (2004). Efficient lentiviral vector-mediated control of HIV-1 replication in CD4 lymphocytes from diverse HIV+ infected patients grouped according to CD4 count and viral load. Mol. Ther. 9: 902 – 913. 26. MacGregor, R. R. (2001). A phase 1 open-label clinical trial of the safety and tolerability of single escalating doses of autologous CD4 T cells transduced with VRX496 in HIVpositive subjects. Hum. Gene Ther. 12: 2028 – 2029. 27. Kohn, D. B., Sadelain, M., and Glorioso, J. C. (2003). Occurrence of leukaemia following gene therapy of X-linked SCID. Nat. Rev. Cancer 3: 477 – 488. 28. Piacibello, W., et al. (2002). Lentiviral gene transfer and ex vivo expansion of human primitive stem cells capable of primary, secondary, and tertiary multilineage
MOLECULAR THERAPY Vol. 12, No. 6, December 2005 Copyright C The American Society of Gene Therapy
29.
30.
31. 32. 33.
34. 35.
36.
37.
38. 39. 40.
41.
42. 43.
44.
45.
46. 47. 48. 49.
50.
51. 52.
repopulation in NOD/SCID mice: nonobese diabetic/severe combined immunodeficient. Blood 100: 4391 – 4400. Abonour, R., et al. (2000). Efficient retrovirus-mediated transfer of the multidrug resistance 1 gene into autologous human long-term repopulating hematopoietic stem cells. Nat. Med. 6: 652 – 658. Sutton, R. E., Reitsma, M. J., Uchida, N., and Brown, P. O. (1999). Transduction of human progenitor hematopoietic stem cells by human immunodeficiency virus type 1based vectors is cell cycle dependent. J. Virol. 73: 3649 – 3660. Hacein-Bey-Abina, S., et al. (2003). LMO2-associated clonal T cell proliferation in two patients after gene therapy for SCID-X1. Science 302: 415 – 419. Arya, S. K., Guo, C., Josephs, S. F., and Wong-Staal, F. (1985). Transactivator gene of human T-lymphotropic virus type III (HTLV-III). Science 229: 69 – 73. Kumar, M., and Carmichael, G. G. (1997). Nuclear antisense RNA induces extensive adenosine modifications and nuclear retention of target transcripts. Proc. Natl. Acad. Sci. USA 94: 3542 – 3547. Hajjar, A. M., and Linial, M. L. (1995). Modification of retroviral RNA by doublestranded RNA adenosine deaminase. J. Virol. 69: 5878 – 5882. Mautino, M. R., and Morgan, R. A. (2000). Potent inhibition of human immunodeficiency virus type 1 replication by conditionally replicating human immunodeficiency virus-based lentiviral vectors expressing envelope antisense mRNA. Hum. Gene Ther. 11: 2025 – 2037. Veres, G., et al. (1998). Comparative analyses of intracellularly expressed antisense RNAs as inhibitors of human immunodeficiency virus type 1 replication. J. Virol. 72: 1894 – 1901. Catalanotto, C., et al. (2004). Redundancy of the two dicer genes in transgeneinduced posttranscriptional gene silencing in Neurospora crassa. Mol. Cell. Biol. 24: 2536 – 2545. An, D. S., et al. (1999). An inducible human immunodeficiency virus type 1 (HIV-1) vector which effectively suppresses HIV-1 replication. J. Virol. 73: 7671 – 7677. Horn, P. A., et al. (2002). Lentivirus-mediated gene transfer into hematopoietic repopulating cells in baboons. Gene Ther. 9: 1464 – 1471. Banerjea, A. C., et al. (2003). Inhibition of HIV-1 by lentiviral vector-transduced siRNAs in T lymphocytes differentiated in SCID-hu mice and CD34+ progenitor cell-derived macrophages. Mol. Ther. 8: 62 – 71. Douglas, J. L., Lin, W. Y., Panis, M. L., and Veres, G. (2001). Efficient human immunodeficiency virus-based vector transduction of unstimulated human mobilized peripheral blood CD34+ cells in the SCID-hu Thy/Liv model of human T cell lymphopoiesis. Hum. Gene Ther. 12: 401 – 413. Stremlau, M., et al. (2004). The cytoplasmic body component TRIM5a restricts HIV-1 infection in Old World monkeys. Nature 427: 848 – 853. Hanawa, H., et al. (2004). Efficient gene transfer into rhesus repopulating hematopoietic stem cells using a simian immunodeficiency virus-based lentiviral vector system. Blood 103: 4062 – 4069. Woods, N. B., et al. (2003). Lentiviral vector transduction of NOD/SCID repopulating cells results in multiple vector integrations per transduced cell: risk of insertional mutagenesis. Blood 101: 1284 – 1289. Shiramizu, B., Herndier, B. G., and McGrath, M. S. (1994). Identification of a common clonal human immunodeficiency virus integration site in human immunodeficiency virus-associated lymphomas. Cancer Res. 54: 2069 – 2072. Baum, C., et al. (2004). Chance or necessity? Insertional mutagenesis in gene therapy and its consequences. Mol. Ther. 9: 5 – 13. Wu, X., Li, Y., Crise, B., and Burgess, S. M. (2003). Transcription start regions in the human genome are favored targets for MLV integration. Science 300: 1749 – 1751. Rosenzweig, M., et al. (1996). In vitro T lymphopoiesis of human and rhesus CD34+ progenitor cells. Blood 87: 4040 – 4048. Allen, T. M., et al. (1998). Characterization of the peptide binding motif of a rhesus MHC class I molecule (Mamu-A*01) that binds an immunodominant CTL epitope from SIV. J. Immunol. 160: 6062 – 6071. Rosenzweig, M., et al. (1997). Intracellular immunization of rhesus CD34+ hematopoietic progenitor cells with a hairpin ribozyme protects T cells and macrophages from simian immunodeficiency virus infection. Blood 90: 4822 – 4831. Johnson, V. A., and Walker, B. D. (1990). HIV-infected cell fusion assay. In Techniques in HIV Research (A.A.B.D. Walker Ed.), pp. 92 – 94. Stockton Press, New York. Kurre, P., Anandakumar, P., Harkey, M. A., Thomasson, B., and Kiem, H.-P. (2004). Efficient marking of murine long-term repopulating stem cells targeting unseparated marrow cells at low lentiviral vector particle concentration. Mol. Ther. 9: 914 – 922.
1167
