In vitro and in vivo quantification of elicitin expression in Phytophthora cinnamomi

Our reference: YPMPP 808

P-authorquery v6

AUTHOR QUERY FORM Journal: YPMPP

Please e-mail or fax your responses and any corrections to: E-mail: [email protected]

Article Number: 808

Fax: +31 2048 52789

Dear author, During the preparation of your manuscript for typesetting, some questions may have arisen. These are listed below and highlighted by flags in the margin of the proof. Please check your typeset proof carefully and mark any corrections in the margin of the proof or compile them as a separate list. In case artwork needs revision, please consult http://www.elsevier.com/artworkinstructions. Electronic file usage Sometimes we are unable to process the electronic file of your article and/or artwork. If this is the case, we have proceeded by:

,

Scanning (parts of) your article

,

Rekeying (parts of) your article

,

Scanning the artwork

Queries and/or remarks

,

Articles in Special Issues: Please ensure that the words ’this issue’ are added (in the list and text) to any references to other articles in this Special Issue.

Uncited references: References that occur in the reference list but not in the text - please position each reference in the text or delete it from the list Missing references: References listed below were noted in the text but are missing from the reference list - please make the list complete or remove the references from the text. Location Response in article Query / remark Q1 Please specify the significance of footnote "*" cited in the Table 1, as a corresponding footnote has not been provided. Q2 Please check the corresponding author address. Thank you for your assistance.

ARTICLE IN PRESS

YPMPP808_proof  16 March 2009  1/10

Physiological and Molecular Plant Pathology xxx (2009) 1–10

Contents lists available at ScienceDirect

Physiological and Molecular Plant Pathology journal homepage: www.elsevier.com/locate/pmpp 55 1

6 7 8 9

Marı´lia Horta

a, d, *

a

, Nelson Sousa , Ana C. Coelho

b, e

c

, Dina Neves , Alfredo Cravador

OF

4 5

In vitro and in vivo quantification of elicitin expression in Phytophthora cinnamomi a

a, d

Faculdade de Engenharia dos Recursos Naturais, Universidade do Algarve, Campus de Gambelas, 8005-139 Faro, Portugal b ˜o, Universidade do Algarve, Campus da Penha, 8005-139 Faro, Portugal Escola Superior de Educaça c ´ rio para a Cieˆncia, a Cultura e o Ambiente, Universidade do Algarve, Campus de Gambelas, 8005-139 Faro, Portugal Instituto Transfronteiriço Universita d IBB/CGB-UTAD Apartado 10103, 5001 Vila Real, Portugal e CIQA, FCT, Universidade do Algarve, Campus de Gambelas, 8005-139 Faro, Portugal

RO

2 3

10 11

a r t i c l e i n f o

a b s t r a c t

14 15

Article history: Accepted 27 February 2009

The differential expression of four Phytophthora cinnamomi elicitin genes was analysed by Real Time RTPCR. In in vitro cultures, the a-cinnamomin gene showed the highest level of expression, the b-cinnamomin gene (b-cin) was the most inducible, and the HAE transcripts were in low abundance. Transcription of all the elicitins was active during the active growth of the pathogen when infecting cork oak (Quercus suber) roots, and as host colonization progressed, the level of b-cin expression fell, while that of a-cin rose. In an antisense transgenic strain, the silencing of b-cin also negatively affected the expression of other elicitin genes in the cluster. The reduction in planta growth of the b-cin knock-out is related to the altered pattern of elicitin gene expression, supporting the idea that one of the functions of elicitins is related, directly or indirectly, with pathogenesis. Ó 2009 Published by Elsevier Ltd.

18 19 20 21 22 23

Keywords: Phytophthora cinnamomi Elicitin expression Pathogenesis Transformation Gene silencing Real time RT-PCR Quercus

TE

16 17

DP

12 13

24 25

EC

26 27

1. Introduction

30 31

The class oomycetes includes obligate biotrophs (e.g. downy mildews, white rusts), narrow host range hemibiotrophs (e.g. Phytophthora infestans, Phytophthora sojae) and wide range host necrotrophs such as Phytophthora cinnamomi likely to infect in excess of 3000 species of plants, including Quercus suber and Quercus ilex subspecies rotundifolia, evergreen oaks of major economic and ecological importance in the Iberian Peninsula. P. cinnamomi can grow saprophytically in the soil, producing asexual, biflagellate motile zoospores that are attracted, usually to fine roots of susceptible plants where they attach and develop ramifying hyphae. The elicitins, which belong to a group of conserved holoproteins, are thought to play a key role in the host/Phytophthora interaction. These small (typically 98 residue) proteins are abundantly secreted in vitro by almost all Phytophthora species, as well as by certain species of the related genus Pythium. Elicitin gene clusters have been identified in Phytophthora cryptogea [1], P. cinnamomi [2] (Fig. 1) and Phytophthora cambivora (unpublished results). The

34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 Q 2 53 54

UN

32 33

CO RR

28 29

* Corresponding author. Faculdade de Engenharia dos Recursos Naturais, Universidade do Algarve, Campus de Gambelas, 8005-139 Faro, Algarve, Portugal. Tel.: þ351 289 800 900x7814; fax: þ351 289 818 419. E-mail address: [email protected] (M. Horta).

structure of these gene clusters is rather conserved, and consists of four open reading frames arranged as two tandem pairs separated by ca. 2 kb. Two of the four genes share homology with the basic and acidic elicitin groups, but the other two encode elicitin isoforms sharing homology with the class II highly acidic elicitins. Elicitin and elicitin-like gene clusters with a different genomic arrangement have been observed in P. infestans [3], P. sojae and Phytophthora ramorum [4]. P. cryptogea expresses both the b- and acryptogein genes in vitro, but not the highly acidic elicitins [1]. Both b- and a-cinnamomins have been detected in P. cinnamomi culture filtrates [5], and an RT-PCR analysis of cultured mycelium revealed that all the elicitin genes belonging to the gene cluster were expressed [6]. Although some progress has been made towards an understanding of the function and mechanism of action of the elicitins, their overall role in the biology of Phytophthora remains puzzling (for a review see Ref. [7]). In addition to the canonical elicitins, some family members possess different structural domains which suggests a diversity of functions [1,2,4,8–11]. The canonical elicitins are able to load lipids (such as sterols) and effect their transfer between phospholipid membranes [12–17], and as a result, it has been suggested that in Phytophthora, they act as sensors to detect both the presence and/or abundance of potential hosts [7]. Antibiotic [18] and structural component [11,19] roles have also been proposed. In addition, some elicitin-like proteins were shown to display phospholipase A2 activity [20].

56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109

0885-5765/$ – see front matter Ó 2009 Published by Elsevier Ltd. doi:10.1016/j.pmpp.2009.02.003

Please cite this article in press as: Horta M, et al., In vitro and in vivo quantification of..., Physiological and Molecular Plant Pathology (2009), doi:10.1016/j.pmpp.2009.02.003

ARTICLE IN PRESS 2

YPMPP808_proof  16 March 2009  2/10

M. Horta et al. / Physiological and Molecular Plant Pathology xxx (2009) 1–10

175

111 112

176 177

113 114

178 179

115 116

180 181

117 118

182 183

119 120

184 185

121 122

186 187

F

110

123 124

136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166

2. Materials and methods

167 168

2.1. Biological material

169 170 171 172 173 174

OO

PR

134 135

and by a colorimetric molecular assay [33]. They were grown in the dark at 25  C in clarified V8 (Campbell Soup), either in semi-solid (agar) or liquid medium. For the production of elicitins, the cultures were transferred to ESM (Elicitin Secretion Medium) (0.05% w/v KH2PO4, 0.025% w/v MgSO4.7H2O, 0.1% w/v asparagine, 1 mg/l thiamine, 0.05% w/v yeast extract, 2% w/v glucose). These isolates are preserved at the Mycological Library of the Laboratory of Molecular Biotechnology and Phytopathology of the University of Algarve (UALG). Q. suber acorns were surface sterilized, germinated in sterile vermiculite and grown in a greenhouse until their root length reached 5–6 cm.

ED

133

CT

131 132

RR E

129 130

CO

127 128

The role of the elicitins in the pathogenicity of Phytophthora was until recently controversial, as it has been observed that they can act either as virulence or as avirulence factors. It has been proposed that they are non-specific toxins able to induce necrosis in any plant species [5,21], and act to facilitate pathogen colonization of the host by killing plant tissue via an attack on the membrane lipids [20]. Some authors, however, have shown that the host necrosis associated with the action of elicitin is restricted to certain plant species or even specific cultivars [19,22–25]. In tobacco, the role of the elicitins appears to be as an avirulence factor [26,27]. The elicitin genes are down-regulated during the early stages of pathogen infection involving P. infestans-potato [19] and Phytophthora parasitica-tobacco [28] compatible interactions, although expression of an elicitin gene in P. parasitica was retained throughout the compatible interaction with tomato [28]. Elicitin expression has also been observed during the infection process of Phytophthora quercina on Quercus robur [29]. This apparent diversity of behaviour in elicitin expression displaying dual and conflicting functions depending on the genotype of the host and other variables are better explained by the concept of effector, a neutral term that does not imply a negative or positive impact on the outcome of the disease interaction [30]. Viewed as effectors, elicitins are molecules that help the oomycete to manipulate biochemical and physiological processes in their host plants. In compatible interactions, effectors promote infection by suppressing defence responses, enhancing susceptibility, or inducing disease symptoms. In incompatible interactions effectors are recognized by the products of plant resistance genes, resulting in host cell death and effective defence responses. The objective of the present work was to determine the expression level of elicitin genes in P. cinnamomi. For this purpose, we have exploited both in vitro cultures of the pathogen, and infected plant tissues. In addition, we have sought to evaluate the effect of inhibiting the expression of the b-cinnamomin gene (b-cin) on the infection process of Q. suber, a species severely affected by a decline disease caused by P. cinnamomi [31,32] and that has a major economic importance to the economies of south-western Iberia and north-western Africa.

UN

125 126

Fig. 1. Schematic representation of the elicitin gene cluster in P. cinnamomi. Arrows show direction of transcription.

P. cinnamomi isolates PA46 and PA37 were isolated from soil samples from sites affected by the cork oak decline disease on the Algarve region (southern Portugal), using a plant bait (Granny Smith apples in aqueous soil solution). The isolates were identified by their morphology when grown in PARPH selective medium [32]

188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204

2.2. Transformation of P. cinnamomi

205 206

The pHAMT35H construct (based on pUC19, and kindly provided by Howard Judelson) contains an expression cassette consisting of the hygromycin phosphotransferase gene (hpt) (present in a 1253 bp SmaI fragment) regulated by the ham34 promoter (present in a 920 bp HindIII-SmaI fragment) and by the ham34 terminator present in a 550 bp SmaI-EcoRI fragment of Bremia lactucae (EMBL Genebank accession number: X16984). The pHAMT35-fatss plasmid contains the b-cin coding sequence and a 50 untranslated sequence in antisense orientation fused to the ham34 promoter. This was obtained by PCR amplification of a 416 bp fragment of b-cin, using as primers 50 -AGC TAC CCG GGG CTC CGT CAC ACG CAC GAC ATC and 50 -AGA CTC CCG GGT TAG AGC GAC GCG CAC TTG GAC, digesting this fragment with SmaI and finally cloning it into SmaI-digested pHAMT35H. Correctly oriented clones were selected by restriction analysis with BglI. Plasmids were propagated in Escherichia coli (TOP 10 F0 Cells, Invitrogen) and plasmid DNA was extracted and purified with the Qiagen Plasmid Midi Kit (Qiagen), following the manufacturer’s instructions. The transformation of P. cinnamomi was based on published protocols [26,34–36]. Mycelium was grown for three days and protoplasts were prepared by gentle agitation at 25  C for 2.5 h in the dark in a solution of 7 mg/ml Driselase (Sigma) and 7 mg/ ml Cellulase (Onozuka) in 0.64 M KCl, 0.2 M CaCl2. The addition of 80 mg Lipofectin (Life Technologies) mediated the co-transformation of 107 protoplasts with 20 mg pHAMT35H and 40 mg pHAMT35-fatss in MTC-20 buffer (1 M mannitol, 10 mM Tris– HCl, 20 mM CaCl2; pH 7.5). Protoplasts were diluted 10 in a mixture of clarified V8 liquid medium and 1 M mannitol solution (1:4 v/v). After 18 h at 25  C in the dark, young mycelia were recovered by centrifugation and dispersed on V8 agar containing 250-mg/ml hygromycin. Transformants emerged within ten days.

207 208

Please cite this article in press as: Horta M, et al., In vitro and in vivo quantification of..., Physiological and Molecular Plant Pathology (2009), doi:10.1016/j.pmpp.2009.02.003

209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239

255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289

2.4. Analysis of elicitins production ESM and V8 culture filtrates were harvested after five and 15 days of mycelial growth. Secreted proteins were concentrated by precipitation with trichloroacetic acid and separated by SDS-PAGE (17.5% PA). The proteins present in the gels were then electroblotted onto a nitrocellulose membrane using a Trans-blot SD Transfer Cell (Biorad) and immuno-detected with monoclonal mouse antibodies recognising b-cinnamomin (kindly provided by Carlos Novo) as follows: the membranes were treated with PBS–T (phosphate buffered saline, pH 7.4 – Tween 20 (0.5% v/v) solution (Sigma) for 30 min, exposed for 16 h to a 1:1000 dilution in PBS–T of the primary antibody, washed 3 for 10 min in PBS–T, exposed for 2 h to a 1:6700 dilution in PBS–T of the secondary antibody (goat anti-mouse IgG) conjugated with alkaline phosphatase), once again washed 3 for 10 min in PBS–T, and finally immersed in BCIP/NBT Liquid Substrate System (Sigma) in the dark for 10 min. The stained membranes were washed in distilled water and dried, before being photographed.

F

253 254

OO

251 252

Total RNA was isolated from mycelia and root using the Rneasy Plant Mini Kit (Qiagen), following the manufacturer’s instructions. The integrity of the RNA was assessed by formaldehyde agarose gel electrophoresis (1.2% agarose). Residual DNA was removed by DNase I (Roche) treatment, following the manufacturer’s instructions. Four mg of RNA were reverse transcribed using 400 U SuperScript II RNase H-Reverse Transcriptase (Invitrogen) in the presence of 4 ml random hexanucleotides (Roche), following the manufacturer’s instructions. Taqman primers and probes (Table 1) for the quantification of the expression of elicitin genes were designed using Primer Express Software (Applied Biosystems) and were synthesized by Eurogentec. The fluorogenic hybridization probes were labelled with TAMRA (tetramethylcarboxyrodamin) attached to the 30 end and FAM (6-carboxyfluorescein) covalently linked to the 50 end of the oligonucleotide. Real Time PCR was performed using an iCycler iQ Detection System (Biorad). Each 25 ml reaction contained 50 ng RNA equivalent (unknown samples) or 0.005–500 pg plasmid DNA (calibration curves), as well as 125 ml qPCR Master Mix (Eurogentec: dNPTs, Hot Goldstar DNA polymerase, MgCl2, Uracil-N-Glicosilase, stabilizers and passive reference), 300 nM of each primer and 200 nM Taqman probe. The reactions were run in triplicate and incubated at 50  C for 2 min, at 95  C for 10 min, followed by 45  95  C/15 s, 62  C/60 s. The endogenous control used to normalize the amount of sample RNA was a fragment of the P. cinnamomi actin gene. Amplification primers (given in Table 2) were targeted to the coding regions of the P. infestans [38] and Phytophthora megasperma [39] actin genes. Independent measures of the oomycete actin mRNA levels in in vitro and in planta conditions were made by Northern Blots using digoxigenin-labelled probes for actin and for LSU-rRNA as a loading control. Procedures followed the instructions supplied by the manufacturer (‘‘DIG Application Manual for Filter Hybridization’’; 2003, Roche Diagnostics Corporation). Taqman primers and probe for the specific quantification of the expression of P. cinnamomi actin were designed as described above (Table 1). No Q. suber transcripts were detected during real time PCR assays using these primers and probe. P. cinnamomi cDNA was generated by the reverse transcription of 5 mg total RNA with SuperScript II RNase H-Reverse Transcriptase (Invitrogen) primed with 1 ml of Oligo(dT)12–18, and the amplicon derived from this template was cloned via the TA Cloning Kit (Invitrogen) and sequenced to define the necessary Taqman primers and probe (Table 1). Fragments of each elicitin gene containing the entire coding sequence, were similarly amplified from the relevant

PR

249 250

2.5. Zoospore production and bioassay

Zoospores were prepared following the method described in Ref. [37]. Q. suber roots were covered in fully colonized V8 agar and incubated in the dark at 25  C for 12, 24 and 36 h. Negative controls were provided by roots in contact with non-colonized agar. After the incubation period, the agar was removed, along with all external mycelia growth. The roots were examined for the presence

290 291 292 293

Table 1 Sequences of the Taqman primer and probes.

294 295

Target mRNA amplicon size

296

Beta cin 67 bp

297 298

HAE Alfa cin 75 bp

301 302 Q 1

HAE Beta cin 68 bp

303 304

Actin 65 pb

310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354

357 358 Forward primer sequence (50 / 30 )

Reverse primer sequence (50 / 30 )

359 360

CCTTGGAGCACTGCGAGAAGG

361

ACGACGCCGAGGACGA

362 363

0

Taqman probe sequence (FAM-5 /3 -TAMRA)

Alfa cin 67 bp

306 307

355 356

0

299 300

305

308 309

2.6. Real time PCR assay

ED

247 248

CT

245 246

Genomic DNA was extracted and purified from the mycelium with the Dneasy Plant Mini Kit (Qiagen), following the manufacturer’s instructions. The presence of pHAMT35H in hygromycin resistant clones was verified by a PCR using primers 50 -CGC CGA TGG TTT CTA CAA and 50 -CCA CGC TCC GTC AGG ATC TTC, which amplify an 839 bp fragment of the hpt coding sequence. Similarly, the presence of pHAMT35-fatss was verified using primers 50 -CTT TTG CGT CCT ACC ATC CGT TA and 50 -GGG GCT CCG TCACAC GCA CGC CAT C, which amplify a segment of the ham34 promoter and all the b-cin antisense sequence (total length 754 bp). The PCR cycling conditions were 94  C/3 min, followed by 30  94  C/45 s; 65  C/ 45 s, 72  C/45 s, and ending with 72  C/7 min. Each 50 ml PCR contained 10 mM dNTP, 0.4 mM of each primer, 100 ng genomic DNA or 1 ng plasmid DNA, and 2.5 U Taq DNA polymerase in the appropriate buffer. Aliquots of the PCR reactions were separated on 1% (w/v) agarose gels and stained with ethidium bromide, to check for the presence of the expected amplicon.

RR E

243 244

3

and extent of necrosis and then frozen to 80  C. The assays were repeated three times with each pathogen strain.

2.3. Selection of transformants

CO

241 242

YPMPP808_proof  16 March 2009  3/10

M. Horta et al. / Physiological and Molecular Plant Pathology xxx (2009) 1–10

UN

240

ARTICLE IN PRESS

CAGACCGCCGCGTACAA ACGCTCGTGAGTATCCTGTCCGAGTCG GTTTGGTGATCAACGTGTACGA CACGTCGACACAAAGTCGTTCGAG CGGCGCAGTACAAGCTCAT CGTCGACGGCGTGCAACACC GGCCCAGTACAAGCTCATGTG TCGACGGCGTGCAACACCA* CGTGGTGTGCTTACGCTGAA CCCCATCGAGCACGGCATGC

AGCGTCACGATCTTCTTGATCA

364 365

TCAACGAGACGATCTCAGTGATC

366 367

TCCATGTCGTCCCAGTTGGT

368 369

Please cite this article in press as: Horta M, et al., In vitro and in vivo quantification of..., Physiological and Molecular Plant Pathology (2009), doi:10.1016/j.pmpp.2009.02.003

383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425

Reverse primer sequence (50 / 30 )

Actin 527 bp Beta Cin 490 bp Hae Alfa Cin 564 bp Alfa Cin 537 bp Hae Beta Cin 523 bp

GCCGGTGACGACGCCCCGCG ACATCCACTCGCCACCTCC CACCACTCAAGCCCCACTTCCG GCACCCTTCCTCCCCACCACC GCACAAACCTCTTCACCCACCC

CCACGCTCCGTCAGGATCTTC TGCTCCTCCATCCTCAGTAA GCTCGCCCTCATAACCAAGC GCTTTACAAACGCTCGAGCG CGGGTAAGTCTTTTGCAATG

cDNA (using the primers shown in Table 2), cloned using the TA Cloning Kit (Invitrogen) and sequenced. The resulting plasmids were linearized with NotI (New England Biolabs), and the optical density at 260 nm of various dilutions was measured for quantification (five replicated optical measurements per sample). These quantifications were used, along with an estimate for the molecular weight of single-stranded (ss) recombinant DNA (Vector NTI 8Ò program (Informax)), to create a set of calibration standards in the concentration range 109–101 ss DNA/ml. Sample normalisation was effected using the relationship: (normalized number of elicitin transcripts) ¼ [(number of actin transcripts produced by PA45 after 3 days of culture in V8 medium)/(number of actin transcripts in sample)]  number of the elicitin transcripts. The expression level of the cin genes was expressed relative to their level measured in 3-day-old cultures of PA45 in V8 medium (3d_PA45_V8).

containing and non-containing media showed that the transgenes were stably incorporated. When grown in vitro in the absence of antibiotic selection, no visible difference in growth rate between wild type and the transgenic strains was observed (data not shown). The expression of the endogenous b-cin in response to the presence of the antisense transgenic sequence in the FATSS strain was firstly assessed in culture filtrates following growth on ESM and V8 liquid media. A western blot analysis revealed that no bcinnamomin was produced by the FATSS strain (at least at levels detectable by the antibody hybridization assay) (Fig. 3), whereas, in contrast, it was produced by PA45, PA37 and strain 13C. Zoospores were not freely produced by either of the transgenic strains.

OF

381 382

Forward primer sequence (50 / 30 )

RO

379 380

Target gene amplicon size

DP

377 378

435

3. Results

3.2. Infection of Q. suber roots

As transgenic zoospores were not available, infection of the host roots was effected using mycelium. The earliest necrotic lesions on the roots of PA45, PA37 and 13C appeared after about 12 h, in those areas in direct contact with the inoculum; at this time, the FATSS strain gave no visible symptoms of infection on the roots. By 24 h, the original lesions caused by the wild type isolates and the 13C transformant had extended along the root, while roots infected with the FATSS strain showed the first sign of necrosis, similar in size to those which had developed within 12 h on the wild type and 13C strains (Fig. 4). By 36 h post-inoculation, the root necrosis caused by the FATSS strain had spread, while in the roots infected with the other strains, the lesions remained of similar size, were localised in the non-suberized region of the root, and showed early

TE

375 376

Table 2 Sequences of primers used to clone actin and elicitin genes.

3.1. Genetic transformation of P. cinnamomi

P. cinnamomi was particularly recalcitrant to transformation. Several transformants were obtained, but lost their ability to grow in the presence of hygromycin, except two which grew in a stable manner; one of these (FATSS) was derived from isolate PA45, and the other (13C) from isolate PA37. The FATSS strain carries both pHAMT35H and pHAMT35-fatss (Fig. 2A and C). The 13C strain only carries pHAMT35H (Fig. 2B). PCR amplification targeted to either hpt or ham34þfatss on genomic DNA extracted from the transformed strains after successive passaging on hygromycin-

EC

373 374

M. Horta et al. / Physiological and Molecular Plant Pathology xxx (2009) 1–10

CO RR

371 372

4

YPMPP808_proof  16 March 2009  4/10

UN

370

ARTICLE IN PRESS

436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490

426

491

427 428

492 493

429 430

494 495

431 432 433 434

Fig. 2. Screening for the presence of transgenes in wild type and transformed strains of P. cinnamomi by separation of PCR products in agarose gel electrophoresis. (A) and (B) refer to detection of hpt (as shown by an 839 bp amplicon); (C) refers to detection of ham34 þ fatss (as shown by a 754 bp amplicon). Templates for the PCRs were: (1) and (8) FATSS genomic DNA, (2) and (7) PA45 (wild type) genomic DNA, (3) and (6) pHAMT35H plasmid, (4) PA37 (wild type) genomic DNA, (5) 13C genomic DNA, (9) pHAMT35H-fatss, plasmid M1: 1 kb DNA ladder (Invitrogen), M2: 123 bp DNA ladder (Invitrogen).

Please cite this article in press as: Horta M, et al., In vitro and in vivo quantification of..., Physiological and Molecular Plant Pathology (2009), doi:10.1016/j.pmpp.2009.02.003

496 497 498 499

ARTICLE IN PRESS

YPMPP808_proof  16 March 2009  5/10

M. Horta et al. / Physiological and Molecular Plant Pathology xxx (2009) 1–10

5

565

501 502

566 567

503 504

568 569

505 506

570 571

507 508

572 573

509 510

574 575

511 512

576 577

513 514

OF

500

Fig. 3. Western blotting detection of b-cinnamomin (arrowed) in culture filtrates. (A) FATSS (tracks 1–4), PA45 (tracks 5–8). (1) 5-day ESM, (2) 15-day ESM, (3) 5-day V8, (4) 15-day V8, (5) 15-day ESM, (6) 5-day ESM, (7) 15-day V8, (8) 5-day V8. (B) (1) 15-day ESM culture filtrate of PA37, (2) 15-day ESM culture filtrate of 13C.

515 516

521 522 523 524 525 526 527

530 531

534 535

544 545 546 547 548 549 550 551 552 553 554 555

UN

542 543

584 585

CO RR

536 537

540 541

The choice of actin mRNA as a stable endogenous control to normalize the amount of sample RNA was validated by evaluation of the oomycete actin mRNA levels in in vitro and in planta conditions. Hybridization of Northern Blots at 60  C confirmed the full specificity of DIG labelled probes towards Phytophthora mRNA. The signal obtained with the LSU probe was proportional to that

EC

532 533

538 539

582 583

TE

528 529

580 581

3.3. Quantification of elicitin transcripts

RO

519 520

signs of tissue dehydration. For one set of roots, the infection was allowed to proceed for a further 12 h (48 h post-inoculation), by which time there was little visible difference between the appearance of roots infected with any of the strains, except that tissue dehydration was less advanced in the FATSS infected roots. Non-inoculated control roots displayed only a faint browning, an oxidation reaction caused by their exposure to air. The three independent assays produced comparable outcomes.

DP

517 518

578 579

586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620

556

621

557 558

622 623

559 560

624 625

561 562

626 627

563 564

Fig. 4. Infected roots, 24 h post-inoculation. Cork oak roots were covered in fully colonized V8 agar and incubated in the dark at 25  C. Necrotic tissue is indicated by an arrow. (A) PA45, (B) FATSS, (C) PA37, (D) 13C.

Please cite this article in press as: Horta M, et al., In vitro and in vivo quantification of..., Physiological and Molecular Plant Pathology (2009), doi:10.1016/j.pmpp.2009.02.003

628 629

647 648 649 650 651 652 653 654 655 656 657

660 661 662 663 664 665 666 667 668 669

684 685 686 687 688 689 690 691 692 693 694

13C, ESM,15 days

PA37, V8,15 days PA37, V8, 3days FATSS, ESM, 15 days FATSS, ESM, 3 days FATSS, V8, 15 days

Beta-cinnamomin

FATSS, V8, 3days PA45, ESM, 15 days PA45, ESM, 3 days

1,00E+01

1,00E+02

1,00E+03

1,00E+04

B

13C, ESM, 3 days 13C, V8,15 days 13C, V8, 3 days

PA37, ESM, 3 days

PA37, V8, 3 days

13C, ESM, 15 days 13C, ESM, 3days 13C, V8, 15 days

FATSS,ESM, 3 days FATSS, V8, 15 days

13C, V8, 3 days PA37, ESM, 15 days PA37, ESM, 3 days PA37, V8, 15 days PA37, V8, 3 days FATSS, ESM, 15 days FATSS, ESM, 3 days FATSS, V8, 15 days FATSS, V8, 3 days PA45, ESM, 15 days PA45, ESM, 3 days

PA45, ESM, 3 days

1,00E+01

1,00E+02

1,00E+03

1,00E+04

Expressed gene copy number

1,00E+04

1,00E+05

1,00E+05

D

13C, V8, 3 days

PA37, ESM, 3days

708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724

737 738 739 740 741 742

745 746

PA37, V8, 15 days PA37, V8, 3 days FATSS, ESM, 15 days

747 748

FATSS, ESM, 3 days FATSS, V8, 15 days

HAE Alfa-cinnamomin

FATSS, V8, 3 days PA45, ESM, 15 days

749 750 751

PA45, ESM, 3 days

1,00E+00

706 707

743 744

PA37, ESM, 15 days

PA45, V8, 3 days 1,00E+01

1,00E+03

13C, V8, 15 days

PA45, V8, 3 days 1,00E+00

1,00E+02

13C, ESM, 3 days

PA45, V8, 15 days

704 705

735 736

13C,ESM, 15 days

PA45, V8, 15 days

702 703

733 734

PA45, ESM,15 days

Expressed gene copy number

HAE Beta-cinnamomin

700 701

731 732

Alfa-cinnamomin

FATSS, V8, 3days

PA45, V8, 3 days

C

698 699

729 730

FATSS, ESM, 15 days

1,00E+00

696 697

727 728

PA37, V8,15 days

PA45, V8,15 days

1,00E+05

695

725 726

PA37, ESM,15 days

Expressed gene copy number

Isolate, Culture Medium, Age of Culture

682 683

PA37, ESM, 3 days

1,00E+00

674 675

680 681

13C, V8, 3 days PA37, ESM, 15 days

PA45, V8, 3days

672 673

678 679

13C, V8, 15 days

PA45, V8,15 days

670 671

676 677

A

13C, ESM, 3 days

Isolate, Culture Medium, Age of Culture

658 659

13C, ESM, 15 days

OF

645 646

RO

643 644

DP

641 642

Isolate, Culture Medium, Age of Culture

639 640

Isolate, Culture medium, Age of culture

637 638

to that of its wild type progenitor, PA37. However, in contrast, the FATSS strain lacked any transcript of either b-cin and HAEa-cin. The number of a-cin and HAEb-cin transcripts in 3-day V8 cultures of FATSS was, respectively, 1.8 and 1.6 less than 3d_PA45_V8. The extent of the induction of expression by the ESM medium was also less substantial, at only 2.8 (a-cin) and 2.5 (HAEb-cin) 3d_PA45_V8. In planta, the PA45, PA37 and 13C strains behaved identically – b-cin and HAEa-cin transcripts were detectable at the time of the first post-inoculation assay (12 h), and their expression level was, respectively, 154 and 496 fold more abundant than 3d_PA45_V8. The level of expression decreased with time (especially noticeable for HAEa-cin), as the root tissues became fully colonized. The expression of b-cin decreased by 11% (12–24 h) and 19.5% (12–36 h). HAEa-cin expression fell by 70.8% (12–24 h) and 86.5% (12–36 h). The a-cin transcript was readily detectable by 12 h post infection, and its expression increased with time, as the root tissue became fully colonized, but HAEb-cin was only detectable when the root tissue was fully colonized. After 12 h, a-cin was expressed 6 more abundantly than 3d_PA45_V8; after 24 h the level had increased to 13 and by 36 h to 20. The FATSS strain produced a quite different pattern of elicitin expression, since neither any b-cin nor any HAEacin transcripts were detectable. The a-cin transcript was not detectable 12 h post-inoculation, although pathogen biomass was present, as indicated by actin detection at this point (not shown). At

TE

635 636

obtained with the actin probe in the same sample. In RNA extracted from various in vitro cultures, all LSU bands had identical intensity, showing that an identical quantity of Phytophthora RNA was present in all lanes; the intensity of actin mRNA bands was similar for all samples, showing that actin mRNA levels were also identical. In RNA extracted from infected roots, samples with increasing times of infection showed a corresponding increase of the RNA LSU band signal intensity. This was expected, as it reflects a rise in Phytophthora RNA quantities with the time course of root infection. The signal of actin mRNA followed a similar pattern, increasing proportionally to the LSU signal. The quantification of elicitin gene expression is summarized in Figs. 5 and 6. The two wild type PA45 and PA37 isolates expressed the four elicitin genes present in the genomic cluster in both culture media. The general level of expression was substantially higher in ESM than in V8, and decreased in both media as the culture aged. In 3-day V8 cultures, a-cin was expressed about 15 more abundantly than b-cin, 23 more than HAEb-cin and 142 more than the HAEacin; in 3-day ESM cultures, a-cin was expressed about 1.5 more abundantly than b-cin, 18 more than HAEb-cin and 231 more than the HAEa-cin. The type of medium (V8 or ESM) had a large effect on the level of expression – for b-cin, this was 134 fold higher in ESM than in V8, while the equivalent induction for a-cin was only 14 fold, for HAEb-cin 17 fold and for HAEa-cin eight fold. The 13C transformant showed a pattern of elicitin gene expression similar

EC

633 634

YPMPP808_proof  16 March 2009  6/10

M. Horta et al. / Physiological and Molecular Plant Pathology xxx (2009) 1–10

CO RR

631 632

6

UN

630

ARTICLE IN PRESS

752 753 1,00E+01

1,00E+02

1,00E+03

1,00E+04

1,00E+05

Expressed genecopy number

Fig. 5. Quantification of the genetic expression of elicitin genes in vitro by Quantitative real time PCR. RNA was extracted from mycelia of the wild type isolates (PA45 and PA37) and from genetically transformed strains (FATSS and 13C) grown in V8 or ESM media during 3 or 15 days. Mean values obtained over three independent assays are expressed as the number of gene copies present in 50 ng of P. cinnamomi cDNA. Gene copy number was calculated using the absolute standard curve method and normalized against actin gene expression in PA45 mycelium grown in V8 for three days. A: b-cinnamomin; B: a-cinnamomin; C: HAE b-cinnamomin; D: HAE a-cinnamomin.

Please cite this article in press as: Horta M, et al., In vitro and in vivo quantification of..., Physiological and Molecular Plant Pathology (2009), doi:10.1016/j.pmpp.2009.02.003

754 755 756 757 758 759

ARTICLE IN PRESS

M. Horta et al. / Physiological and Molecular Plant Pathology xxx (2009) 1–10

788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805

1,00E+02

1,00E+03

1,00E+04

PA37, 36 h PA37, 24 h PA37, 12 h FATSS, 36 h FATSS, 24 h

HAE B e ta-cinnamomin FATSS, 12 h PA45, 36 h

PA45, 12 h 1,00E+01

1,00E+02

1,00E+03

1,00E+04

Expressed gene copy number

1,00E+05

24 h was 8 more abundant than 3d_PA45_V8, and after 36 h expression had increased a further 2.25. The HAEb-cin transcript was only detectable in the most advanced stage of infection (36 h), when its expression level was 42 higher than 3d_PA45_V8.

810 811

Reference genes classically used as control in gene expression research have been subjected to apparently contradictory results. For example, Yan and Liou (2006) [40] showed that actin and elongation factors may not be suitable controls in P. parasitica studies and indicated the ubiquitin-conjugating enzyme encoding gene (Ubc) as one of the best. Moreover, it was shown that the Ubc gene can be a bad choice for P. cinnamomi and that the elongation factor 1a is more appropriate [41]. The more suitable standard may vary with the specific conditions of each study, therefore it is very important to test the stability of the standards according to the type of biological material and the particular conditions of a given experiment. In our experimental conditions, northern blots proved that actin is acceptable as consitutive gene control. Both the P45 and P37 isolates expressed b-cin at a lower level than a-cin, which contrasts with the experience in P. cryptogea,

819 820 821 822 823 824

UN

4.1. In vitro studies

817 818

1,00E+01

838 839 1,00E+02

1,00E+03

1,00E+04

1,00E+05

Expressed gene copy number

13C, 36 h

D

13C, 24 h 13C, 12 h

840 841 842 843 844 845

PA37, 36 h

846 847

PA37, 24 h

848

PA37, 12 h

849 850

FATSS, 36 h FATSS, 24 h

HAE Alfa-cinnamomin

PA45, 36 h

855 856

PA45, 12 h 1,00E+00

851 852 853 854

FATSS, 12 h

1,00E+01

1,00E+02

1,00E+03

1,00E+04

1,00E+05

Expressed gene copy number

Fig. 6. Quantification of the genetic expression of elicitin genes in planta by Quantitative real time PCR. RNA was extracted from cork oak root tissues after 12, 24 or 36 h postinoculation with the wild type isolates (PA45 and PA37) and genetically transformed strains (FATSS and 13C). Mean values obtained over three independent assays are expressed as number of gene copies present in 50 ng of P. cinnamomi cDNA. Gene copy number was calculated using the absolute standard curve method and normalized against actin gene expression in PA45 mycelium grown in V8 for 3 days. A: b-cinnamomin; B: a-cinnamomin; C: HAE b-cinnamomin; D: HAE a-cinnamomin.

808 809

816

1,00E+00

834 835 836 837

PA45, 36 h

PA45, 24 h

PA45, 24 h

1,00E+00

Alfa- cinnamomin

PR

13C, 12 h

4. Discussion

814 815

FATSS, 12 h

1,00E+05

C

13C, 24 h

832 833

FATSS, 24 h

PA45, 12 h

806 807

812 813

PA37, 12 h FATSS, 36 h

PA45, 24 h

1,00E+01

830 831

PA37, 24 h

PA45, 12 h

826 827 828 829

PA37, 36 h

PA45, 24 h

Isolate,Time post-inoculation

786 787

PA45, 36 h

RR E

784 785

FATSS, 12 h

13C, 36 h

Isolate, Time post-inoculation

783

Beta-cinnamomin

13C, 12 h

Expressed gene copy number

777 778

781 782

FATSS, 24 h

1,00E+00

775 776

779 780

FATSS, 36 h

13C, 24 h

OO

773 774

PA37, 12 h

B

ED

771 772

PA37, 24 h

CT

769 770

PA37, 36 h

CO

767 768

Isolate, Time post-inoculation

765 766

13C, 12 h

825

13C, 36 h

A

13C, 24 h

7

F

13C, 36 h

761 762

Isolate,Time post-inoculation

760

763 764

YPMPP808_proof  16 March 2009  7/10

where the expression of the basic elicitin gene dominated in ESM medium [1] and a greater amount of the b-cryptogein than the acryptogein was present in culture filtrates [42]. Note, however, that probes for the Northern analysis on P. cryptogea were based on 30 UTR sequences, which present more variability than coding regions. Furthermore, a probe directed to the coding region of the basic cryptogein detected a number of genes in addition to the elicitin genes in the cluster [1]. As a result, the Northern signal is likely to have been restricted to transcript originating from the target genomic cluster. Rather than Northern analysis, we used a real time RT-PCR assay with primers and probes targeted to the four specific elicitin coding regions. These sequences are less locusspecific than are 30 UTR ones, so the possibility cannot be excluded that a part of the signal derived from transcripts of gene copies located outside the cluster. However, data on quantification of canonical cinnamomins in culture filtrates is missing and as yet the correlation between transcript number and protein abundance has not been properly established. An RT-PCR approach has been successfully used to detect highly acidic elicitin mRNAs in both P. cinnamomi [6] and Phytophthora insolita [7]. Our real time PCR experiments confirmed that HAE transcripts are present in P. cinnamomi, although their abundance is much lower than that of the canonical elicitins. This low expression level probably explains why HAE transcripts could not be detected

Please cite this article in press as: Horta M, et al., In vitro and in vivo quantification of..., Physiological and Molecular Plant Pathology (2009), doi:10.1016/j.pmpp.2009.02.003

857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889

ARTICLE IN PRESS

M. Horta et al. / Physiological and Molecular Plant Pathology xxx (2009) 1–10

903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931

936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954

CT

901 902

RR E

899 900

CO

897 898

The four elicitin genes known in P. cinnamomi presented different levels of expression, both in vitro and in planta. Moreover, the two pairs (b-cin and HAEa-cin; a-cin and HAEb-cin) showed apparently concerted patterns of induction/repression. In spite of the synthesis of each elicitin being directed by its own promoter HAE gene expression appears to be regulated by the same transcription factors that control the expression of the canonical elicitin gene located upstream in the cluster. Thus, either the highly acidic elicitins are functional and act in concert with the canonical elicitins that are expressed at the same time, or the HAE transcripts are only the product of pseudogenes expressed solely under the influence of factors that act preferably on canonical elicitin genes, inducing the expression of the closest HAE gene. The in planta differential expression pattern of the elicitin genes shows that the basic and acidic elicitins have different, although possibly correlated biological roles, with the former involved in the initial invasion of the host, and the latter in propagation and survival after colonization. More generally, the differential expression of each

UN

895 896

F

4.2. In planta studies

893 894

elicitin may reflect the response of the oomycete to its surrounding environment, adjusting the balance of elicitins present according to the prevailing pH conditions. In fact calculated pI varies from 3.38 for the most acidic one to 7.81 (the basic elicitin) and this difference could favour interactions with biological membranes and ease the load of lipid molecules by different elicitins under various pH conditions. The infection process on Q. suber roots was characterised by an increase in the expression of a-cin over time up to 36 h postinoculation, broadly consistent with the expression patterns of equivalent pathogen elicitors in other host/pathogen systems. In Phytophthora citricola, the a-citricolinin transcript was only detectable in the root of Fagus sylvatica some 6 h post-inoculation, and a significant rise in the level of expression occurred after three days and reached its maximum on the fifth day [50]. Similarly, ainfestin, produced by P. infestans was first detectable one day after the inoculation of tomato leaves, and its peak of expression occurred after four days [51]. Almost identical patterns of elicitin expression have been observed in potato [19] and tomato [28] infected with either P. infestans or P. parasitica. A more rapid host colonization was achieved in the present experiments, because the initial pathogen load was higher. As a result, the conditions necessary to induce a-cin expression were reached more rapidly. The peak expression of the a-elicitins is associated with the first appearance of host tissue necrosis, which represents the stage when sporulation begins. Thus the role of the a-elicitins may be connected with the process of sporulation and/or pathogen survival under saprophytic conditions; however, direct evidence for this role is lacking, since P. infestans not expressing a-infestin was unchanged with respect to both its virulence and sporulation phenotype [26]. It was shown that the invasion of Q. robur roots by P. quercina was characterised by the ubiquitous presence of b-quercinin, with its production increasing in concert with the increase in pathogen biomass over the first five days post infection [29]. The present observations concern the b-cin gene expression which does not have a direct relation with the totality of the pathogen biomass. The in planta expression of b-cin decreased during the infection process of Q. suber roots by wild type strains of P. cinnamomi. Probably, gene expression only occurs in the hyphae during first contact with the host, ceasing soon thereafter. This initial message is likely to be rapidly degraded but the translated elicitin will be retained. Thus, the transcripts detected reflect the early expression of the b-elicitin in hyphae present in the ‘‘battle front’’ with the host; its expression in the initial phase of tissue invasion indicates a role of the protein in pathogenesis. When P. infestans was transformed with the gene encoding bcryptogein, the quantity of heterologous protein was similar to that produced in P. cryptogea itself, and the level of endogenous ainfestin was reduced, leaving the total amount of elicitin present largely unchanged from that in a control transgenic strain expressing resistance to hygromycin B [52]. As a result, it has been suggested that, since the global amount of elicitin synthesized by a given strain is constant, there may well be a common role for the elicitins across all the Phytophthora spp. and, that the class IA and class IB elicitins are in effect interchangeable, with similar functions. However, the level of a-infestin did not fall below that present in the wild type, so there is most likely a residual specific function for a-infestin in P. infestans. Assuming that the quantity of canonical elicitin is conserved and that the biological roles of class IA and IB elicitin are identical, the prediction is that the FATSS transformant should have compensated for the absence of b-cinnamomin by an over-expression of a-cin. However, the experimental observation was that, on the contrary, the activity of a-cin was, if anything, partially down-regulated as silencing of b-cin also

OO

934 935

891 892

ED

932 933

in P. cryptogea [1], since the sensitivity of the Northern blot is some orders of magnitude less than that of real time RT-PCR [43]. However, whether these class II elicitin transcripts are effectively translated in vivo has yet to be demonstrated. The marked diminution in the expression of the elicitin genes in 15-day cultures suggests that the major demand for the elicitins occurs during the active growth phase of the mycelium. As cultures age and nutrient availability increasingly becomes limiting, active hyphal growth occurs only locally and chlamydospore formation is initiated. The large quantities of elicitin present in filtrates of aged ESM cultures therefore represent their accumulation during the stage of actively growing mycelium, rather than the product of active transcription and translation. Abundant b-cinnamomin was present in ESM cultures of P45, PA37 and 13C strains, but was lacking in the FATSS transformant. Thus, the absence of b-cinnamomin in culture filtrates of this strain must have been affected by the presence of the antisense b-cin sequence, rather than by any transgene sequence(s) shared with strain 13C. The antisense-driven inhibition of b-cin gene in FATSS acted at the transcription level, in the same way that other genes have been silenced in various Phytophthora spp [26,44–47]. This form of genetic silencing requires a level of sequence homology between the transgene and the endogenous target of at least 80% [48]. The antisense sequence of b-cin is highly homologous with the other three members of the elicitin cluster. In addition to the total suppression of b-cin, in the FATSS transformant, no HAEa-cin (77% homology with b-cin) and a reduction in the abundance of a-cin and HAEb-cin (83.5% and 81.2% homology, respectively) transcripts were observed. As the number of HAEa-cin transcripts is low in the wild type pathogen, its effective silencing is probably rather easily achieved. Alternatively, a failure in transcription resulting from transgenesis has been attributed to an induction of heterochromatin changes in the region of the silenced gene [48,49]. Of the four elicitin cluster members, HAEa-cin lies the closest to b-cin, and thus may be more susceptible than both a-cin and HAEb-cin to disruption of transcription caused by localised chromatin alterations. In the present study it is shown that the impaired capacity to produce zoospores is not related to cinnamomin production because the hygromycin expressing resistance 13C transformant produces cinnamomins while being similarly affected in zoosporogenesis as cinnamomin-silent FATSS strain. The fact that the transgenic strains did not freely produced zoospores were already reported [45] and was attributed to the expression of the resistance cassette.

890

PR

8

YPMPP808_proof  16 March 2009  8/10

Please cite this article in press as: Horta M, et al., In vitro and in vivo quantification of..., Physiological and Molecular Plant Pathology (2009), doi:10.1016/j.pmpp.2009.02.003

955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 1019

1033 1034 1035 1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068 1069 1070 1071 1072 1073 1074 1075 1076 1077 1078 1079 1080 1081 1082 1083 1084

OF

1031 1032

RO

1029 1030

DP

1027 1028

Acknowledgements

This work was financed by the EC – III Framework Programme for Research and Technological Development, co-financed by the European Social Fund (ESF) and by national funding from the Portuguese Ministe´rio da Cieˆncia e do Ensino Superior (MCES) (POCTI/AGR/34389/2000). MH. thanks Fundaça˜o para a Cieˆncia e a Tecnologia (FCT) and ESF (EC – III Framework Programme) for her Ph.D. grant SFRH/BD/1249/2000. References

[1] Panabie´res F, Marais A, Le Berre J-Y, Penot I, Fournier D, Ricci P. Characterization of a gene cluster of Phytophthora cryptogea which codes for elicitins, proteins inducing a hypersensitive-like response in tobacco. Molecular PlantMicrobe Interactions 1995;8:996–1003. [2] Duclos J, Fauconnier A, Coelho AC, Bollen A, Cravador A, Godfroid E. Identification of an elicitin gene cluster in Phytophthora cinnamomi. DNA Sequence. Journal of Sequencing and Mapping 1998a;9:231–7. [3] Jiang RHY, Dawe AL, Weide R, van Staveren M, Peters S, Nuss D, et al. Elicitin genes in Phytophthora infestans are clustered and interspersed with various transposon-like elements. Molecular Genetics and Genomics 2005;273:20–32. [4] Jiang RHY, Tyler BM, Whisson SC, Hardham AR, Govers F. Ancient origin of elicitin gene clusters in Phytophthora genomes. Molecular Biology and Evolution 2006;23:338–51. [5] Pernollet JC, Sallatin M, Salle´-Tourne M, Huet JC. Elicitin isoforms from seven Phytophthora species: comparison of their physico-chemical properties and toxicity to tobacco and other plant species. Physiological and Molecular Plant Pathology 1993;42:53–67. [6] Duclos J, Trinca˜o Aure´lio M, Graça J, Coelho AC, Fauconnier A, Jacquet A, et al. Identification of an elicitin gene cluster in Phytophthora cinnamomi and analysis of the necrotic activity of a purified recombinant b-cinnamomin. In: Proceedings of the twelfth forum for applied biotechnology. Belgium: University of Gent; 1998. p. 1695–8. [7] Ponchet M, Panabie`res F, Milat M-L, Mikes V, Montillet J-L, Suty L, et al. Are elicitins cryptograms in the plant – oomycete communications? Cellular and Molecular Life Sciences 1999;56:1020–47. [8] Baillieul F, Fritig B, Kauffmann S. Occurrence among Phytophthora species of a glycoprotein eliciting a hypersensitive response in tobacco and its relationships with elicitins. Molecular Plant-Microbe Interactions 1996;9:214–6. [9] Kamoun S, Lindqvist H, Govers F. A novel class of elicitin-like genes from Phytophthora infestans. Molecular Plant-Microbe Interactions 1997;10: 1028–30.

9

[10] Panabie`res F, Amselemb J, Galiana E, Berre J. Gene identification in the oomycete pathogen Phytophthora parasitica during in vitro vegetative growth through expressed sequence tags. Fungal Genetics and Biology 2005;42: 611–23. [11] Qutob D, Huitema E, Gijzen M, Kamoun S. Variation in structure and activity among elicitins from Phytophthora sojae. Molecular Plant Pathology 2003;4:119–24. [12] Boissy G, O’Donohue M, Gaudemer O, Perez V, Pernollet JC, Brunie S. The 2.1 A¨ structure of an elicitin-ergosterol complex: a recent addition to the sterol carrier protein family. Protein Science 1999;8:1191–9. [13] Mikes V, Milat ML, Ponchet M, Ricci P, Blein JP. The fungal elicitor cryptogein is a sterol carrier protein. FEBS Letters 1997;416:190–2. [14] Mikes V, Milat ML, Ponchet M, Panabie`res F, Ricci P, Blein J-P. Elicitins, proteinaceous elicitors of plant defense, are a new class of sterol carrier proteins. Biochemical and Biophysical Research Communications 1998;245:133–9. [15] Osman H, Mikes V, Milat ML, Ponchet M, Marion D, Prange T, et al. Fatty acids bind to the fungal elicitor cryptogein and compete with sterols. FEBS Letters 2001;489:55–8. [16] Rodrigues ML, Archer M, Martel P, Miranda S, Thomaz M, Enguita FJ, et al. Crystal structures of the free and sterol-bound forms of b-cinnamomin. Biochimica et Biophysica Acta 2006;1764:110–21. [17] Vauthrin S, Mikes V, Milat ML, Ponchet M, Maume B, Osman H, et al. Elicitins trap and transfer sterols from micelles, lipossomes and plant plasma membranes. Biochimica et Biophysica Acta 1999;1419:335–42. [18] Grant BR, Ebert D, Gayler KR. Elicitins: proteins in search of a role? Australasian Plant Pathology 1996;25:148–57. [19] Kamoun S, van West P, de Jong AJ, de Groot KE, Vleeshouwers VGAA, Govers F. A gene encoding a protein elicitor of Phytophthora infestans is down-regulated during infection of potato. Molecular Plant-Microbe Interactions 1997;10: 13–20. [20] Nespoulos C, Gaudemer O, Huet JC, Pernollet JC. Characterization of elicitinlike phospholipases isolated from Phytophthora capsici culture filtrate. FEBS Letters 1999;452:400–6. [21] Huet J-C, Salle´-Tourne M, Pernollet J-C. Amino acid sequence and toxicity of the a-elicitin secreted with ubiquitin by Phytophthora infestans. Molecular Plant-Microbe Interactions 1994;7:302–4. [22] Bonnet P, Bourdon E, Ponchet M, Blein JP, Ricci P. Acquired resistance triggered by elicitins in tobacco and other plants. European Journal of Plant Pathology 1996;102:181–92. [23] Devergne JC, Fort MA, Bonnet P, Ricci P, Vergnet C, Delaunay T, et al. Immunodetection of elicitins from Phytophthora spp. using monoclonal antibodies. Plant Pathology 1994;43:885–96. [24] Kamoun S, Young M, Glascock C, Tyler B. Extracellular protein elicitors from Phytophthora: host-specificity and induction of resistance to bacterial and fungal phytopathogens. Molecular Plant-Microbe Interactions 1993;6:15–25. [25] Yu LM. Elicitins from Phytophthora and basic resistance in tobacco. Proceedings of the National Academy of Sciences of USA 1995;92:4088–94. [26] Kamoun S, van West P, Vleeshouwers VG, de Groot KE, Govers F. Resistance of Nicotiana benthamiana to Phytophthora infestans is mediated by the recognition of the elicitor protein INF1. Plant Cell 1998;10:1413–25. [27] Kamoun S, Huitema E, Vleeshouwers VGAA. Resistance to oomycetes: a general role for the hypersensitive response? Trends in Plant Science 1999;4:196–200. [28] Colas V, Conrod S, Venard P, Keller H, Ricci P, Panabie´res F. Elicitin genes expressed in vitro by certain tobacco isolates of Phytophthora parasitica are down regulated during compatible interactions. Molecular Plant-Microbe Interactions 2001;14:326–35. [29] Brummer M, Arend M, Fromm J, Schlenzig A, Obwald WF. Ultrastructural changes and immunocytochemical localization of the elicitin quercinin in Quercus robur L. roots infected with Phytophthora quercina. Physiological and Molecular Plant Pathology 2002;61:109–20. [30] Kamoun S. Groovy times: filamentous pathogen effectors revealed. Current Opinion in Plant Biology 2007;10:358–65. [31] Brasier CM, Robredo F, Ferraz JFP. Evidence for Phytophthora cinnamomi involvement in Iberian oak decline. Plant Pathology 1993;42:140–5. [32] Moreira-Marcelino ACM. Aspectos da interacça˜o entre Phytophthora cinnamomi e a doença do declı´nio em Q. suber e Q. rotundifolia. PhD Thesis, Universidade do Algarve, Faro, Portugal; 2001. [33] Coelho AC, Cravador A, Bollen A, Ferraz JFP, Moreira AC, Fauconnier A, et al. Highly specific and sensitive non-radioactive identification of Phytophthora cinnamomi. Mycological Research 1997;101:1499–507. [34] Bottin A, Larche L, Villalba F, Gaulin E, Esquerre´-Tugaye´ M-T, Rickauer M. Green fluorescent protein (GFP) as gene expression reporter and vital marker for studying development and microbe-plant interaction in the tobacco pathogen Phytophthora parasitica var. nicotianae. FEMS Microbiology Letters 1999;176:51–6. [35] Judelson HS, Tyler BM, Michelmore RW. Transformation of the oomycete pathogen Phytophthora infestans. Molecular Plant-Microbe Interactions 1991;4:602–7. [36] Judelson HS, Coffey MD, Arredondo FR, Tyler BM. Transformation of the oomycete pathogen Phytophthora megasperma f. sp. glycinea occurs by DNA integration into single or multiple chromosomes. Current Genetics 1993;23:211–8.

TE

1025 1026

EC

1023 1024

affected a-cin expression. Thus, one (or both) of the prior assumptions above cannot be justified. Evidence that each elicitin group has its particular and distinct function has recently been provided by Jiang et al. (2006), who used a phylogenetic comparison to show that the elicitin family diversified prior to speciation, and that in various Phytophthora spp., variation is maintained by selective purification. The lack of any growth rate difference between the wild type and the transgenic strains in the absence of antibiotic selection showed that the slower infectivity of the FATSS transformant was not due to any per se defect in growth, nor to the presence of the selective marker (hpt) gene, which was also present in the 13C strain. Thus we have concluded that the depression of virulence must be a direct consequence of the silencing of b-cin – unless the FATSS strain suffered from other (unknown) genetic changes as a result of the transformation process (induced, for example by the random insertion of transformation vectors on the genome). This could best be resolved by the isolation of further transgenic lines of P. cinnamomi, in which b-cin has been silenced. It is however, a hard task at this stage, as this species is highly recalcitrant to transformation. The FATSS transformant, with its altered patterns of elicitin expression, suffered a loss in virulence compared to its wild type progenitor. Its ability to degrade host roots appears, from preliminary evidence, to also be considerably impaired. We are presently investigating comparative expression profiling platforms such as cDNA-AFLP to reveal the genes related to the action of elicitins or responsible for the determination of virulence.

CO RR

1021 1022

YPMPP808_proof  16 March 2009  9/10

M. Horta et al. / Physiological and Molecular Plant Pathology xxx (2009) 1–10

UN

1020

ARTICLE IN PRESS

Please cite this article in press as: Horta M, et al., In vitro and in vivo quantification of..., Physiological and Molecular Plant Pathology (2009), doi:10.1016/j.pmpp.2009.02.003

1085 1086 1087 1088 1089 1090 1091 1092 1093 1094 1095 1096 1097 1098 1099 1100 1101 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 1116 1117 1118 1119 1120 1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131 1132 1133 1134 1135 1136 1137 1138 1139 1140 1141 1142 1143 1144 1145 1146 1147 1148 1149

M. Horta et al. / Physiological and Molecular Plant Pathology xxx (2009) 1–10

[47]

[48] [49]

[50]

[51]

[52]

OF

[46]

wall deposition and adhesion to cellulosic substrates. Journal of Cell Science 2002;115:4565–75. Latijnhouwers M, Govers F. A Phytophthora infestans G-protein b subunit is involved in sporangium formation. Eukaryotic Cell 2003;2:971–7. Latijnhouwers M, Ligterink W, Vleeshouwers VG, van West P, Govers F. A G alpha subunit controls zoospore motility and virulence in the potato late blight pathogen Phytophthora infestans. Molecular Microbiology 2004;51:925–36. Kamoun S. Molecular genetics of pathogenic oomycetes. Eukaryotic Cell 2003;2:191–9. Judelson HS, Tani S. Transgene-induced silencing of the zoosporogenesisspecific NIFC gene cluster of Phytophthora infestans involves chromatin alterations. Eukaryotic Cell 2007;6:1200–9. Fleischmann F, Koehl J, Portz R, Beltrame AB, Oßwald W. Physiological changes of Fagus sylvatica seedlings infected with Phytophthora citricola and the contribution of its elicitin ‘‘Citricolin’’ to pathogenesis. Plant Biology 2005;7:650–8. Huitema E, Vleeshouwers VGAA, Cakir C, Kamoun S, Govers F. Differences in intensity and specificity of hypersensitive response induction in Nicotiana spp by INF1, INF2A and INF2B of Phytophthora infestans. Molecular Plant-Microbe Interactions 2005;18:183–93. Panabie`res F, Birch PRJ, Unkles SE, Ponchet M, Lacourt I, Venard P, et al. Heterologous expression of a basic elicitin from Phytophthora cryptogea in Phytophthora infestans increases its ability to cause leaf necrosis in tobacco. Microbiology 1998;144:3343–9.

CO RR

EC

TE

DP

[37] Byrt P, Grant BR. Some conditions governing zoospore production in axenic cultures of Phytophthora cinnamomi Rands. Australian Journal of Botany 1979;27:103–15. [38] Unkles SE, Moon RP, Hawkins AR, Duncan JM, Kinghorn JR. Actin in the oomycetous fungus Phytophthora infestans is the product of several genes. Gene 1991;100:105–12. [39] Dudler R. The single-copy actin gene of Phytophthora megasperma encodes a protein considerably diverged from any other known actin. Plant Molecular Biology 1990;14:415–22. [40] Yan HZ, Liou RF. Selection of internal control genes for real time quantitative RT-PCR assay in the oomycete plant pathogen Phytophthora parasitica. Fungal Genetics and Biology 2006;43:430–8. [41] King M. PhD Thesis, Murdoch University, Australia; 2007. [42] Le Berre JY, Panabie`res F, Ponchet F, Bonnet P, Marais A, Ricci P. Occurrence of multiple forms of elicitins in Phytophthora cryptogea. Plant Physiology and Biochemistry 1994;32:251–8. [43] Bustin SA. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. Journal of Molecular Endocrinology 2000;25:169–93. [44] Blanco F, Judelson H. A bZIP transcription factor from Phytophthora interacts with a protein kinase and is required for zoospore motility and plant infection. Molecular Microbiology 2005;56:638–48. [45] Gaulin E, Jauneau A, Villalba F, Rickauer M, Esquerre´-Tugaye´ M-T, Bottin A. The CBEL glycoprotein of Phytophthora parasitica var. nicotianae is involved in cell

RO

10

YPMPP808_proof  16 March 2009  10/10

UN

1150 1151 1152 1153 1154 1155 1156 1157 1158 1159 1160 1161 1162 1163 1164 1165 1166 1167 1168

ARTICLE IN PRESS

Please cite this article in press as: Horta M, et al., In vitro and in vivo quantification of..., Physiological and Molecular Plant Pathology (2009), doi:10.1016/j.pmpp.2009.02.003

1169 1170 1171 1172 1173 1174 1175 1176 1177 1178 1179 1180 1181 1182 1183 1184 1185 1186 1187