THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 285, NO. 38, pp. 29367–29374, September 17, 2010 © 2010 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.
In Vitro Activities of the Multifunctional RNA Silencing Polymerase QDE-1 of Neurospora crassa*□ S
Received for publication, April 28, 2010, and in revised form, July 13, 2010 Published, JBC Papers in Press, July 20, 2010, DOI 10.1074/jbc.M110.139121
Antti P. Aalto‡1, Minna M. Poranen‡, Jonathan M. Grimes§, David I. Stuart§, and Dennis H. Bamford‡2 From the ‡Institute of Biotechnology and Department of Biosciences, Biocenter 2, P.O. Box 56, University of Helsinki, FIN-00014 Helsinki, Finland and the §Division of Structural Biology, The Henry Wellcome Building for Genomic Medicine, Oxford University, Oxford OX3 7BN, United Kingdom
Gene expression of most eukaryotic organisms is regulated by an immense assortment of small RNAs and proteins that associate with them. These various components form networks known as RNA silencing pathways, most important of which employ small interfering RNAs (siRNAs), microRNAs, or piwiinteracting RNAs to achieve sequence specificity (1–3). RNA silencing associated cell-encoded RNA-dependent RNA polymerases (RdRPs)3 are found commonly as components of the RNA silencing pathways of plants, fungi, and nematodes (1, 4).
* This work was supported by the Academy of Finland Finnish Centre of Excellence Programme 2006-2011 (1129684, to D. H. B.) and by the United Kingdom Medical Research Council and SPINE2COMPLEXES (LSHGCT-2006-031220). □ S The on-line version of this article (available at http://www.jbc.org) contains supplemental Table S1–S4, Figs. S1–S4, and additional references. 1 Fellow of the Helsinki Graduate School in Biotechnology and Molecular Biology. 2 To whom correspondence should be addressed: Institute of Biotechnology and Dept. of Biosciences, Biocenter 2, P.O. Box 56, University of Helsinki, FIN-00014 Helsinki, Finland. Tel.: 358-0-9-191-59100; Fax: 358-0-9-19159098; E-mail:
[email protected]. 3 The abbreviations used are: RdRP, RNA-dependent RNA polymerase; DdRP, DNA-dependent RNA polymerase; ds, double-stranded; ss, singlestranded; TNTase, terminal nucleotidyltransferase; nt, nucleotide(s); qiRNA, QDE-2-interacting small RNA.
SEPTEMBER 17, 2010 • VOLUME 285 • NUMBER 38
The functions of cellular RdRPs have been largely elusive, but recent studies have shed some light on their enigmatic character. Caenorhabditis elegans RdRPs have been shown to synthesize secondary siRNAs that are important for amplifying the initial silencing signal (5–7). Tetrahymena termophila RdRP (Rdr1) is known to interact with Dicer to produce endogenous siRNAs, whereas the RdRP (Rdp1) of Schizosaccharomyces pombe is critical for heterochromatic gene silencing (2, 8, 9). Arabidopsis thaliana has six genes that code for RdRPs, but only a few of these have been studied in detail (10, 11). Most of the above studies imply that the main function of cellular RdRPs is in synthesizing siRNAs directly or making doublestranded RNA (dsRNA) from single-stranded RNA (ssRNA) templates to be used as Dicer substrate. For a long time, it was thought that cellular RdRPs are absent in insects and mammals, but recently, robust RdRP activities have been detected in Drosophila melanogaster and humans (12, 13) suggesting that cellular RdRPs may have crucial functions throughout the eukaryotic domain. Neurospora crassa is a filamentous fungus that displays remarkable genomic stability (14, 15). One of the cellular mechanisms that affect to this stability is an RNA-silencing pathway known as quelling (16). Quelling is initiated by repetitive genetic elements and is dependent on three genes: qde-1 (quelling defective) encoding an RdRP, qde-2 (a member of the Argonaute family), and qde-3 (a RecQ-like DNA helicase) (17–19). It has been shown that overexpression of QDE-1 results in increased silencing and that expression of hairpin dsRNA molecules abolishes the need of QDE-1 activity, suggesting that the primary function of QDE-1 is to synthesize dsRNA to be used as substrates for the two Dicers (DCL-1 and DCL-2) of Neurospora (15, 20 –25). The Argonaute protein QDE-2 has slicer activity and interacts with an exonuclease known as QIP (25). The expression of QDE-2 is induced by dsRNA, and its steadystate levels are regulated by the DCLs (15). The biochemical roles of QDE-3 largely are unknown, but it has been suggested to have roles in both DNA repair and quelling (18, 26, 27). The classical model of transgene quelling in Neurospora begins by RNA polymerase II and QDE-3 synthesizing an aberrant RNA molecule, which is recognized by QDE-1 and converted into dsRNA (24). This dsRNA is digested to doublestranded siRNAs by the DCLs. These associate with QDE-2, which nicks the passenger strand of the siRNA that is degraded subsequently by the QIP exonuclease (25). QDE-2, now containing a single-stranded siRNA guide strand, finds its complementary mRNA (or aberrant RNA) targets, which leads to JOURNAL OF BIOLOGICAL CHEMISTRY
29367
Downloaded from http://www.jbc.org/ by guest on February 6, 2016
QDE-1 is an RNA- and DNA-dependent RNA polymerase that has functions in the RNA silencing and DNA repair pathways of the filamentous fungus Neurospora crassa. The crystal structure of the dimeric enzyme has been solved, and the fold of its catalytic core is related closely to that of eukaryotic DNA-dependent RNA polymerases. However, the specific activities of this multifunctional enzyme are still largely unknown. In this study, we characterized the in vitro activities of the N-terminally truncated QDE-1⌬N utilizing structure-based mutagenesis. Our results indicate that QDE-1 displays five distinct catalytic activities, which can be dissected by mutating critical amino acids or by altering reaction conditions. Our data also suggest that the RNA- and DNA-dependent activities have different modes for the initiation of RNA synthesis, which may reflect the mechanism that enables the polymerase to discriminate between template nucleic acids. Moreover, we show that QDE-1 is a highly potent terminal nucleotidyltransferase. Our results suggest that QDE-1 is able to regulate its activity mode depending on the template nucleic acid. This work extends our understanding of the biochemical properties of the QDE-1 enzyme and related RNA polymerases.
Activities of an RNAi Polymerase
EXPERIMENTAL PROCEDURES Site-directed Mutagenesis—The expression vectors for QDE-1⌬N point mutants were generated by site-directed mutagenesis using PCR. The mutagenic primers are listed in supplemental Table S1. Plasmid pEM69 (30) encoding for a His-tagged QDE-1⌬N (missing amino acids 1–376) was used as a template in 50-l PCR reactions each containing sense and antisense primers, and 2.5 units of PfuTurbo DNA polymerase (Stratagene). After completion, the reactions were treated with 10 units of DpnI (Fermentas) and transformed into CaCl2 competent Escherichia coli XL1-Blue cells (Stratagene). The correct constructs were verified by restriction enzyme analysis and sequencing. Yeast Expression and Protein Purification—The recombinant proteins were expressed and purified as described previously for QDE-1⌬N (pEM69; (30)). Briefly, the plasmids were introduced into Saccharomyces cerevisiae strain INVSc1 (Invitrogen), the recombinant proteins were expressed at ⫹28 °C for 22 h and purified to near homogeneity. The yeast cells were first
29368 JOURNAL OF BIOLOGICAL CHEMISTRY
harvested and disrupted by a French press. The cell lysates were then cleared by centrifugation, and the supernatants were loaded onto nickel-nitrilotriacetic acid affinity columns (Qiagen), washed with 5 mM and 25 mM imidazole-containing buffers, and eluted with 200 mM imidazole. Subsequently, the proteins were purified by HiTrapTM heparin HP and Q HP columns (GE Healthcare) and eluted by increasing NaCl gradients. The purified proteins were stored in 50 mM Tris-HCl (pH 8.0), 0.1 mM EDTA, 0.13% Triton X-100, 100 mM NaCl, and 62.5% glycerol at ⫺20 °C. The oligomeric status of the recombinant polymerases was analyzed by size-exclusion chromatography using a Superdex 200 16/60 gel filtration column (GE Healthcare) with appropriate control proteins (Sigma). Template RNAs and DNAs—Plasmid pLM659 (32) contains a cDNA copy of the S segment of bacteriophage 6 under a T7 promoter. For the production of ssRNA, pLM659 was linearized by SmaI digestion, purified using a PCR purification kit (Qiagen), and used as a template for run-off transcription by T7 RNA polymerase. The template DNA was degraded with DNaseI (Promega) and the ssRNA purified by chloroform extraction and LiCl precipitation. To generate a ssDNA molecule of the same length and sequence, SmaI-digested pLM659 was used as a template in PCR reactions containing primers AO49 and AO50 (see supplemental Table S4) and Phusion威 DNA polymerase (Finnzymes). AO50 contains a 5⬘-biotin. The biotinylated PCR product was immobilized onto Dynabeads威 MyOneTM streptavidin C1 magnetic beads (Invitrogen) according to the manufacturer’s instructions. The immobilized PCR product was dissolved by treating the DNA briefly with fresh 0.1 M NaOH. The ssDNA was precipitated with sodium acetate and ethanol and gel-purified through agarose gel electrophoresis. Prior to 5⬘-labeling, the ssRNA was treated with alkaline phosphatase (Finnzymes). Both ssRNA and ssDNA were 5⬘-labeled with [␥-32P]ATP (NEN Radiochemicals, PerkinElmer Life Sciences) and T4 polynucleotide kinase (Fermentas). M13mp18 ssDNA was purchased from New England Biolabs. The oligonuleotides (AO49 –52) were purchased from biomers.net or Eurofins MWG Operon. Polymerase Activity Assays—Polymerase reactions were performed essentially as described (29, 33). The standard QDE-1 reaction mixture contained 50 mM HEPES-KOH (pH 7.8), 20 mM ammonium acetate, 1 mM MgCl2, 1 mM MnCl2, 6% (w/v) polyethylene glycol 4000, 0.1 mM EDTA, 0.1% Triton X-100, 0.2 mM of each NTP, 1 unit/l RNasin威 ribonuclease inhibitor (Promega), and 0.01– 0.02 g/l QDE-1⌬N. In some of the pH experiments, HEPES-KOH (pH 7.2–7.8) was replaced by BisTris (pH 6.0 – 6.9) or Tris-HCl (pH 8.0 – 8.9). The ladder reactions were programmed with 5 mM MgCl2. Reactions were supplemented with 0.1 mCi/ml of [␣-32P]UTP (GE Healthcare or NEN Radiochemicals, PerkinElmer Life Sciences) or other radioactive NTPs where indicated. The reactions were incubated at ⫹30 °C for 1 h and quenched with U2 (8 M urea, 10 mM EDTA, 0.2% SDS, 6% (v/v) glycerol, 0.05% bromphenol blue, and 0.05% xylene cyanol) loading buffer. Some reaction products were extracted with phenol:chloroform:isoamyl alcohol (25:24:1) and chloroform:isoamyl alcohol (24:1), precipitated with NH4OAc and ethanol, and dissolved in milli-Q water. VOLUME 285 • NUMBER 38 • SEPTEMBER 17, 2010
Downloaded from http://www.jbc.org/ by guest on February 6, 2016
the silencing of both transgenic and endogenous transcripts. Recently, this model has been challenged by the discovery that quelling components have essential roles in the nucleus associated with DNA repair (27, 28). QDE-1 was shown to co-purify with ssDNA binding replication protein A (RPA), and DNA damage was shown to induce QDE-2 expression. Immunoprecipitation of QDE-2 from DNA damaged Neurospora cultures revealed a novel type of small RNAs known as QDE-2-interacting small RNAs that are mostly derived from the ribosomal DNA (rDNA) locus (27). qiRNA production is dependent on QDE-1, QDE-3, and the DCLs but not on QDE-2. Notably, QDE-2-interacting small RNAs are derived from aberrant RNAs that are synthesized by QDE-1 and not by any of the canonical RNA polymerases. QDE-1 was shown to have a robust DNA-dependent RNA polymerase (DdRP) activity, generating a DNA/RNA hybrid from an ssDNA template (27). Much insight into the structure and function of cellular RdRPs has come from the studies of a recombinant QDE-1 and its catalytically active C-terminal portion QDE-1⌬N (residues 377–1402 of the wild-type) (29 –31). The recombinant polymerase is able to initiate RNA synthesis without a primer and convert heterologous ssRNAs into double-stranded molecules. In addition to making full-length dsRNA copies of ssRNA templates, QDE-1 was observed to synthesize small 9 –21-nt RNAs scattered along template RNAs (29). The crystal structure of QDE-1⌬N showed that the molecule is a dimer and that the catalytic core has a fold that is related to those in eukaryotic DdRPs (31). In this study, we demonstrate that QDE-1⌬N displays five distinct in vitro activities. We use structure-based mutagenesis to show that the activities can be dissected by mutating critical amino acid residues and suggest that RdRP and DdRP activities have different initiation mechanisms and pH optima. The biochemical data presented in this study imply a recognition mechanism that discerns a DNA template from an RNA template. These results have broader ramifications in eukaryotic RNA- and DNA-dependent RNA polymerases associated with RNA silencing pathways.
Activities of an RNAi Polymerase Some samples were treated with RNase T1 (Fermentas) for 15 min at ⫹37 °C. The samples were subjected to standard Tris-Borate-EDTA or Tris-Acetate-EDTA agarose gel electrophoresis or denaturing, formaldehyde-containing agarose gel electrophoresis (34). The gels were visualized by ethidium bromide staining and dried, and radioactivity was detected by phosphorimaging (Fuji FLA-5000) and analyzed by densitometry with AIDA software (Raytest Isotopenmegera¨te). Some samples were subjected to denaturing PAGE by urea-containing 20% sequencing gels. These were either desalted by Zeba Spin Desalting Columns (Thermo Scientific) or purified by phenol extraction and ethanol precipitation. Prior to loading, the samples were mixed with Gel Loading Buffer II (Ambion) and heated to ⫹95 °C for 5 min.
SEPTEMBER 17, 2010 • VOLUME 285 • NUMBER 38
FIGURE 1. QDE-1 displays five distinct activities. A, QDE-1 reactions were programmed with the same amounts of ssRNA or ssDNA, NTPs or UTP, and QDE-1⌬N or QDE-1⌬NDA as indicated. All reactions contained trace amounts of [␣-32P]UTP. The control nucleic acids were labeled in the 5⬘-end with [␥-32P]ATP and polynucleotide kinase. Reaction mixtures were incubated for 1 h at ⫹30 °C, quenched with U2 loading dye, and analyzed by native agarose gel electrophoresis. Upper panel, ethidium bromide-stained gel; lower panel, autoradiogram of the same gel. Positions of templates (ss) and products (ds) are indicated. The band migrating in between ss and ds on lanes 5, 7, and 8 is a conformer of the ssDNA template. B, a schematic presentation of different QDE-1 in vitro activities. See text for details.
templates in a template-independent fashion (11, 35). Activity (v) (Fig. 1A and supplemental Fig. S1) was assigned as a ladder activity because it generates RNA products of all sizes. When the reaction products of a reaction without a template were analyzed on a denaturing sequencing gel, they migrated at onenucleotide increments (starting from ⬃8 nts) forming a “ladder” (supplemental Fig. S1A). This activity is template-independent because omitting the template does not affect the formation of the ladder (Fig. 1A, lane 9). However, the sensitivity of the ladder activity to varying reaction conditions suggests that it is an in vitro side reaction occurring at high enzyme and substrate conditions (supplemental Fig. S1). The in vitro activities of QDE-1⌬N are summarized schematically in Fig. 1B. QDE-1 Uses Different Initiation Mechanisms on ssDNA and ssRNA Templates—As QDE-1 displays both RNA- and DNAdependent RNA polymerase activities, we further studied the nature of these reactions. We programmed polymerization JOURNAL OF BIOLOGICAL CHEMISTRY
29369
Downloaded from http://www.jbc.org/ by guest on February 6, 2016
RESULTS QDE-1 Displays Five Distinct Activities—To elucidate the different catalytic activities of QDE-1⌬N, standard polymerization reactions were carried out with ssRNA or ssDNA templates in different conditions (Fig. 1A). Mixing QDE-1⌬N with ssRNA, all four NTPs and [␣-32P]UTP resulted in dsRNA synthesis as well as decreased mobility (shifting) and labeling of the ssRNA template (lane 2). In addition, labeled RNA products were detected that varied in size from tens of nucleotides to several hundreds. Some of these products did not enter the agarose gel and remained in the wells. No labeled products were detected when the catalytically inactive QDE-1⌬NDA was used in the reaction mix (lane 3) (29). When the reactions were carried out with only UTP and trace amounts of [␣-32P]UTP, the template ssRNA was efficiently labeled without dsRNA synthesis (lane 4), indicating that QDE-1⌬N is a potent terminal nucleotidyltransferase (TNTase). QDE-1⌬N displays also a strong DNA-dependent RNA polymerase activity (lane 6) (27). None of the template ssDNA migrates as template-sized but is very efficiently converted to the DNA/RNA hybrid form (lane 6). Again, substituting the ⌬N polymerase with QDE-1⌬N DA abolishes this activity (lane 7). The TNTase activity also is very prominent with an ssDNA template (lane 8). Using only UTP as the substrate, the ssDNA template migrates at its normal position (upper panel) but is extensively labeled (lower panel). The above experiments show that QDE-1⌬N displays five distinct activities (Fig. 1, A and B): (i) RNA-dependent RNA polymerase activity (Fig. 1A, lane 2) (29), (ii) DNA-dependent RNA polymerase activity (Fig. 1A, lane 6) (27), (iii) ssRNA template shift and labeling activity (Fig. 1A, lane 2), (iv) TNTase activity (Fig. 1A, lanes 4 and 8), and (v) ladder activity (Fig. 1A, lanes 2, 6, and 9) (supplemental Fig. S1). Activities (i) and (ii) have been described previously (27, 29). Activity (iii) has been suggested previously to result from the synthesis of 9 –21-nt small RNAs that are scattered across the ssRNA template, as well as to be the main in vitro reaction product of QDE-1⌬N (29). However, in this work, the intensity of the ssRNA labeling was not significantly more extensive than the labeling of the dsRNA product (Fig. 1A, lane 2), suggesting that the “small RNAs” are not the main reaction product. The identity of this activity is further discussed below. TNTase activity (iv) (see below) has been detected previously in both viral and eukaryotic RdRPs, where nucleotides are added to the 3⬘-ends of the
Activities of an RNAi Polymerase
reactions with ssRNA or ssDNA templates of the same length and sequence, purified the reaction products, and analyzed them by denaturing formaldehyde-containing agarose gel electrophoresis. As controls we labeled the templates at the 5⬘-end with [␥-32P]ATP and polynucleotide kinase (Fig. 2A). As has been shown previously (29), most of the product that accumulated using an ssRNA template migrated more slowly than the template, indicating that the strands of the dsRNA molecule are covalently linked together (“back-priming”). In contrast, the products of the reaction using an ssDNA template migrated as template-sized or smaller, indicating that the mode of RNA synthesis initiation differs between these two templates. This result is further supported by an experiment where RdRP and DdRP reactions were carried out with an initiating nucleotide that was 32P-labeled at the ␥-phosphate (Fig. 2B). In this experimental setup, the product RNA can be labeled only if the ␥-phosphate remains within the first nucleotide of the new strand. Conversely, if RNA synthesis is initiated by back-priming, the ␥-phosphate is removed from the product RNA. As expected, radioactivity was detected only in the doublestranded products of the ssDNA template (DNA/RNA hybrids) and the template-sized products of the ssRNA template (resulting from abortive initiation, see below). dsRNA was not labeled. In addition, we performed QDE-1⌬N activity assays with both ssRNA and ssDNA templates in the same reaction mixture simultaneously (supplemental Fig. S2). The RdRP or DdRP activities did not inhibit each other, but both templates were processed into products. The ssDNA template in this experiment was circular, indicating that QDE-1⌬N is able to initiate RNA synthesis without the need for a free 3⬘-end (supplemental Fig. S2). All in all, these data suggest that QDE-1 is able to discriminate between ssRNA and ssDNA templates. Mutant Polymerases Display Altered Activities—The crystal structure of QDE-1⌬N has been solved previously (31). Using the structural information, we designed eight point mutations
29370 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 285 • NUMBER 38 • SEPTEMBER 17, 2010
Downloaded from http://www.jbc.org/ by guest on February 6, 2016
FIGURE 2. QDE-1 has different initiation mechanisms for DNA and RNA templates. A, QDE-1⌬N reactions were programmed as described in Fig. 1 and incubated for 1 h at ⫹30 °C. The reactions were purified by phenol extraction and ethanol precipitation, and the samples were subjected to denaturing agarose gel electrophoresis. On control (CTL) lanes are the template nucleic acids labeled in the 5⬘ end. Shown is the autoradiogram of the gel. B, QDE-1⌬N reactions were programmed with ssRNA or ssDNA with the same length and sequence. Both templates end with CC-3⬘. All four NTPs and trace amounts of [␥-32P]GTP were added in the reactions. The products were analyzed by native agarose gel electrophoresis, and shown are EtBr-stained gel (upper panel) and autoradiogram of the same gel (lower panel).
that were predicted to functionally disrupt QDE-1⌬N (Fig. 3A and supplemental Fig. S3 and Tables S1 and S2). The constructs were transformed into S. cerevisiae, and the recombinant proteins were expressed. All of the mutant enzymes were soluble and purified to near homogeneity and behaved like the wildtype during purification (data not shown). Initial screening of the RdRP and DdRP activities of the point mutants revealed that they possessed characteristics that differed from the wildtype polymerase (supplemental Fig. S4A). As expected (as these were assumed to be catalytically essential aspartic acids), QDE1⌬NDA (D1011A) (29) and D1007A were catalytically completely inactive. Of the active point mutants, five (R738A, R944E, K1119W, M1357D, and M1357C) were chosen for more extensive studies due to their catalytic properties. Arg738 lies within a channel that is predicted to accommodate the reaction product of QDE-1⌬N and direct it away from the active site (Fig. 3A). The R944E mutation is predicted to partly block the communication tunnel that links the two active sites in a QDE1⌬N dimer (Fig. 3A). The K1119W mutation was designed to occlude a pore in QDE-1⌬N that apparently allows substrate nucleotides to enter the active site. The M1357D and M1357C mutations are predicted to respectively weaken and lock together the dimeric interface of the QDE-1⌬N head domains (Fig. 3A). However, the interface of the entire QDE-1 dimer is so extensive that mutating Met1357 should not affect the oligomerization state of the enzyme. To confirm this, we performed analytical gel filtration chromatography with QDE-1⌬N WT in different conditions, some of the point mutant enzymes, and control proteins of various sizes (Table 1). Dimeric QDE-1⌬N is predicted to be ⬃230 kDa in size, whereas a monomer would have the predicted size of ⬃120 kDa (31). Our results establish that all QDE-1⌬N enzymes are dimeric, regardless of the surrounding pH (Table 1). This has been deduced previously from the crystal structure, as each of the subunits has ⬎2000 Å2 of contact area with the neighboring subunit (31). All of the five point mutants under closer scrutiny were catalytically active on both ssRNA and ssDNA templates (Fig. 3B). The catalytic activity of R738A is reduced to approximately half of that of the wild-type regardless of the template (Fig. 3C), in accordance with a nonspecific charge steering role for this residue. In addition, R738A is incapable of shifting and labeling the ssRNA template (Fig. 3B and supplemental Fig. S4A). The DdRP activity of R944E is close to that of the native polymerase. However, its RdRP activity is only ⬃20% of the wild-type (Fig. 3C). It shifts the ssRNA template and labels it efficiently (Fig. 3B and supplemental Fig. S4A). These results are consistent with a role for the tunnel bridging the active sites of the dimer to initiate RNAtemplated polymerization (see below). The RdRP and DdRP activities of K1119W are close to those of the wild-type, the former activity even being slightly higher (Fig. 3C). However, this mutant shows dramatically reduced activities (iii) and (iv) (shifting of the template ssRNA and TNTase activity) (Fig. 3B and supplemental Fig. S4, A and B), which may reflect a slight weakening of nonspecific charge stabilization of a product complex by this residue close to the active site. Both M1357D and M1357C mutants display catalytic activities that are very similar to wild-type (Fig. 3, B and C). The ssRNA tem-
Activities of an RNAi Polymerase
SEPTEMBER 17, 2010 • VOLUME 285 • NUMBER 38
JOURNAL OF BIOLOGICAL CHEMISTRY
29371
Downloaded from http://www.jbc.org/ by guest on February 6, 2016
plate shift and labeling in M1357D seems to be somewhat more extensive, and the amount of dsRNA product seems smaller than in the wild-type. This result suggests that mutating a single amino acid at the dimerization interface of the head domain has negligible effects on QDE-1 in vitro activity. In general, DdRP activity is less sensitive to mutations than RdRP activity, further suggesting that QDE-1 is primarily a DNA-dependent RNA polymerase (see below). The activities of the different point mutants are summarized in supplemental Table S3. pH Has a Differential Effect on RdRP and DdRP Activities of QDE1⌬N—Point mutations to QDE-1 structure introduce internal variations to the protein. To study external factors on the catalytic properties of the enzyme, we assayed the pH dependence of QDE-1⌬N on RdRP and DdRP activity by using a linear ssRNA or a circular ssDNA as templates in reactions with QDEFIGURE 3. QDE-1⌬N point mutants display characteristics that differ from the wild-type enzyme. 1⌬N WT (Fig. 4A). To our surprise, A, schematic presentation of the QDE-1⌬N dimer and the mutations introduced by site-directed mutagenesis. Subunit A of the dimer is colored according to domains: blue, slab; purple, catalytic; pink, neck; and we observed that the RdRP activity orange, head. Subunit B is colored gray (for domain definition, see Ref. 31), and the approximate positions was high at a low pH (optimum at of the NTP pore, the bridging tunnel between active sites, and product channel in subunit A are high- approximately pH 6.3) and delighted by arrows. The left panel is a view approximately orthogonal to that of the main image and shows a close-up of the active site of subunit A with the mutated residues drawn as sticks, and the Mg2⫹ ion is creased as the pH increased. In conshown as a cyan sphere. The right panel shows a view of the mutations (by ⬃90 o about the vertical axis) trast, the DdRP activity was low at a introduced into the bridging tunnel between the active sites of the molecule. This figure was produced low pH and increased with the using PyMOL. B, standard QDE-1 reactions were programmed with ssRNA (left panel) or ssDNA (right panel), NTPs, [␣-32P]UTP, and equal amounts of QDE-1⌬N enzymes as indicated. The reaction products increasing pH (optimum at approxwere analyzed by native agarose gel electrophoresis. Upper panel, ethidium bromide-stained gel; lower imately pH 7.4). Similar results were panel, autoradiogram of the same gel. Positions of templates (ss) and products (ds) are indicated. On control (CTL) lanes are the template nucleic acids labeled in the 5⬘ end. C, equal amounts of ssRNA or obtained when the QDE-1⌬N WT ssDNA templates with the same length and sequence were used as templates in QDE-1⌬N reactions. reactions were programmed with Incorporated radioactivity in the products was quantified by phosphorimaging. The activity of the wild- linear ssRNA or ssDNA of the same type enzyme was set as 100%. The experiment was repeated independently three times. Error bars indilength and sequence at pH 6.3, 7.4, cate the S.E. and 8.3 (Fig. 4B). The DdRP activity was, however, always higher than the RdRP activity. We also performed reactions with all the TABLE 1 QDE-1⌬N point mutants varying the pH (Fig. 4C and data not Analytical gel filtrations of QDE-1⌬N mutant polymerases shown). Interestingly, the K1119W mutant was catalytically Elution was performed in 50 mM HEPES-KOH pH 7.4, 150 mM NaCl. QDE-1⌬N inactive at pH 6.3 with both ssRNA and ssDNA templates, WT and alcohol dehydrogenase were also analyzed in 25 mM Bis-Tris (pH 6.3), 150 regaining its activity as the pH increased (Fig. 4C). These data mM NaCl, and 50 mM Tris-HCl (pH 8.9), 150 mM NaCl. Protein Peak elution time indicate that pH might be one of the factors regulating RdRP and DdRP activities. min Apoferritin (Sigma), 113.47 Mutations Affecting TNTase Activity Suggest a Mechanism 443 kDa for Template Recognition—Terminal nucleotidyltransferase QDE-1⌬N WT 129.52 (pH 6.3), 127.76 (pH 7.4), 128.03 (pH 8.9) QDE-1⌬N D1007A 126.75 activity has been described in both viral and cellular RdRPs (11, QDE-1⌬N P964A 127.92 35). QDE-1⌬N WT displays a strong TNTase activity (iv) on QDE-1⌬N R738A 127.23 QDE-1⌬N M1357D 127.23 linear ssRNA and ssDNA templates (Fig. 1A). To ensure that QDE-1⌬N K1119W 127.23 the detected activity truly occurs at the 3⬘-end of the template, QDE-1⌬N R944E 127.12 we designed a 30-nt-long RNA oligonucleotide that has a single Alcohol dehydrogenase 137.42 (pH 6.3), 137.31 (pH 7.4), 135.82 (pH 8.9) (Sigma), 150 kDa G residue at the 10th position from the 5⬘-end (Fig. 5A). When
Activities of an RNAi Polymerase
29372 JOURNAL OF BIOLOGICAL CHEMISTRY
DISCUSSION In this study, we have shown that QDE-1 displays five distinct activities on RNA or DNA templates (Fig. 1) and that these activities can be dissected by altering the reaction conditions (Fig. 4) or utilizing mutant polymerases (Fig. 3). Interestingly, both DdRP and TNTase activities also have been described for RDR6 of Arabidopsis (11), suggesting that such biochemical activities may be conserved evolutionally among cellular RdRPs. Our results indicate that QDE-1 is most VOLUME 285 • NUMBER 38 • SEPTEMBER 17, 2010
Downloaded from http://www.jbc.org/ by guest on February 6, 2016
FIGURE 4. pH has an effect on RdRP and DdRP activities. A, a linear ssRNA and a circular ssDNA were used as templates in QDE-1⌬N WT reactions containing 25 mM Bis-Tris (pH 6.0 to 6.9), 50 mM HEPES-KOH (pH 7.2 to 7.8) or 50 mM Tris-HCl (pH 8.0 to 8.9) in addition to all the standard components. The maximum (max.) activity of each reaction set (RdRP or DdRP) was set as 100%. The experiment was repeated independently three times. Error bars indicate S.E. B, equal amounts of ssRNA or ssDNA templates with the same length and sequence were used as templates in QDE-1⌬N WT reactions in the indicated pH values. The maximum activity of each reaction set (RdRP or DdRP) was set as 100%. The experiment was repeated independently three times. Error bars indicate S.E. C, equal amounts of QDE-1⌬N WT or K1119W were used in reactions similar as above. Shown are the autoradiograms of native agarose gels.
this oligonucleotide was labeled at the 5⬘-end with [␥-32P]ATP and polynucleotide kinase and subsequently digested with RNase T1 (that specifically cleaves ssRNA at 3⬘ of G residues), the labeled product was 10-nt-long (Fig. 5A, lanes 1 and 2). When an unlabeled oligonucleotide was incubated with QDE1⌬N WT and [␣-32P]UTP, the reaction product migrated at a position corresponding to ⬃31 nt. As this product was digested with RNase T1, the position of the label corresponded to ⬃21 nt (Fig. 5A, lanes 3 and 4). These results indicate that QDE-1 transfers approximately one nucleotide to the 3⬘-end of the template. In addition to UTP, the other NTPs (ATP, GTP, and CTP) were accepted as substrates as well (data not shown). To further investigate the TNTase activity, we used all eight point mutants in a TNTase assay with both ssRNA and ssDNA templates (supplemental Fig. S4B). QDE-1⌬NDA and D1007A were completely inactive, suggesting that the TNTase activity resides in the same catalytic site as the other activities. The point mutants labeled the templates with different efficiencies, with R738A and K1119W showing very little activity. To our surprise, we noticed that the P964A mutant was able to label the ssRNA but not the ssDNA. When QDE-1⌬N structure (31) was superimposed with yeast RNA polymerase II elongation complex (based on the conserved double-psi -barrels) the incoming DNA template could be modeled very close to Pro964 (36 and data not shown). Mutation P964A introduces changes to the course of the polypeptide chain in its proximity but is far enough from the active site (11 Å) to produce only a subtle effect. When QDE-1⌬N WT and P964A polymerases were combined with both template types and NTPs or UTP, the P964A mutant differed from the ⌬N WT only in being unable to add a terminal UTP to the 3⬘-end of the ssDNA (Fig. 5B). We also performed the TNTase assays with 30-nt-long ssRNA or ssDNA oligonucleotides and analyzed the reaction products on a denaturing polyacrylamide gel (Fig. 5C). The ⌬N WT and P964A enzymes both added ⬃1 nucleotide on the 3⬘-end of the ssRNA. The ⌬N WT also was capable of adding ⬃1 nt on the 3⬘-end of the ssDNA template, albeit less efficiently, whereas the P964A mutant was inactive when the ssDNA template was applied. These results indicate that QDE-1 is able to distinguish between ssRNA and ssDNA. Although the ssRNA and ssDNA oligonucleotides have the same sequence, the ssRNA migrated more slowly on the denaturing gel than the ssDNA due to its higher molecular weight (9189 g/mol versus 8821 g/mol). As the molecular weight of uridyl monophosphate is ⬃324 g/mol, this result shows that in these conditions QDE-1 adds only one nucleotide to the 3⬘-end of the template. However, in higher NTP concentrations, the number of added nucleotides may increase (data not shown).
Activities of an RNAi Polymerase
SEPTEMBER 17, 2010 • VOLUME 285 • NUMBER 38
JOURNAL OF BIOLOGICAL CHEMISTRY
29373
Downloaded from http://www.jbc.org/ by guest on February 6, 2016
different conformations (31). There also is a distinct communication tunnel connecting the catalytic sites of the two subunits (31; see also Fig. 3A). Mutation R994E partly blocks this tunnel resulting in significant reduction in the RdRP activity (i) but with no effect on the DdRP activity (ii) (Fig. 3B). We therefore propose that the DdRP activity of QDE-1 is a “monomeric” feature of the enzyme, whereas for RdRP activity, the ssRNA template would have to be guided through the communication tunnel to the active site of the other subunit for dsRNA synthesis, making the RdRP activity a “dimeric” property of the enzyme. Indeed, in the structurally similar yeast DdRP elongation complex, there is no 2-fold symmetry (36) supporting the idea that the DNA-dependent reaction of QDE-1 would occur independently at the two active sites. The different pH optima (Fig. 4), the FIGURE 5. The terminal nucleotidyl transferase activity of QDE-1. A, sequence and RNase T1 cleavage different initiation modes (Fig. 2), as products of the 30-nt-long ssRNA (upper panel). Control and QDE-1⌬N reactions were purified by phenol well as the observation that the two extraction and ethanol precipitation and analyzed on a denaturing 20% urea-PAGE (lower panel). The band activities may occur simultaneously migrating at ⬃20 nt on lane 1 is a conformer of the ssRNA. B, standard QDE-1 reactions were programmed with ssRNA or ssDNA, NTPs or UTPs, [␣-32P]UTP and equal amounts of QDE-1⌬N enzymes as indicated. The reaction (supplemental Fig. S2) further supproducts were analyzed by native agarose gel electrophoresis, and shown is the autoradiogram of the gel. port the idea that the RdRP and Positions of single- and double-stranded nucleic acids are indicated. C, TNTase reactions with QDE-1⌬N WT or P964A were programmed with unlabeled 30-nt-long ssRNA (AO51) or ssDNA (AO52) and [␣-32P]UTP. The DdRP activities are uncoupled. reaction products were purified by phenol extraction and ethanol precipitation and analyzed on a denaturing DdRP activity is likely the pri20% urea-PAGE. Control (CTL) lanes contain the oligonucleotides labeled to the 5⬘-ends. mary activity of QDE-1 as it is constantly considerably higher than effective in vitro as a DdRP and that the initiation mechanism of the RdRP activity (Figs. 1 and 3B). Apparently, the RNA moleRNA synthesis is different with ssRNA and ssDNA templates cules also are directed via the “DdRP” site through the communication tunnel to the “RdRP” site of the dimer. However, not all (Fig. 2 and supplemental Fig. S2). It was suggested previously that the template shift (iii) seen in ssRNA molecules would reach the RdRP site at the other subthe RdRP reaction of QDE-1 results from the synthesis of small unit under the in vitro conditions applied. They would be RNAs of 9 –21 nt that are scattered across the template ssRNA labeled erroneously by the DdRP active site, which would result (29). Subsequent studies have, however, shown that the main in in an abortive product that then appears as activity (iii) (as vivo functions of QDE-1 are aberrant RNA (on a DNA tem- exemplified by R944E in Fig. 3B and labeling of ssRNA in Fig. plate) and dsRNA (on an RNA template) synthesis, and the 2B). Such small RNAs that were predicted previously to cause “small RNAs” may not be relevant biologically (15, 20, 27). the shifting of the ssRNA template (29) have not been observed Indeed, when dsRNA is produced from hairpin constructs in in vivo (15, 20, 27). It is possible that the TNTase activity (iv) would target an Neurospora, the requirement for QDE-1 is abolished, but RNA silencing is not compromised (15, 20). Our results suggest that ssRNA template on the other subunit for dsRNA synthesis. the template shift is not required for efficient dsRNA synthesis This is supported by the notion that the TNTase activity in the (see, for example, R738A, R944E, and K1119W in Fig. 3B), and P964A mutant labels only ssRNA but not ssDNA. The mutated it is not detected when using an ssDNA template. Thus, it seems proline lies close to the active site and might convey the templausible that this shift is not an essential step in the reaction plates in proper directions. The incoming DNA template pathway leading to dsRNA production but rather a side reac- apparently passes very close to residue P964 indicating that it might be expected to impact the discrimination of RNA and tion resulting from abortive RNA polymerization initiation. Based on the biochemical and genetic evidence obtained DNA templates. This is precisely what was observed biochemhere, we suggest a model for QDE-1 activity in vitro. It is plau- ically (Fig. 5, B and C). As pH has a clear differential effect on the RdRP and DdRP sible that the dimeric nature of the polymerase is crucial for its activity; QDE-1⌬N is a functional dimer, and the two activities of QDE-1, it may be that this would reflect pH differsubunits, tightly associated with each other, have slightly ences in various cellular compartments (e.g. nucleus and cyto-
Activities of an RNAi Polymerase plasm). However, because the QDE-1 dimer is known to associate with several proteins and other cellular factors (15, 27) it is obvious that there are many regulatory mechanisms that control the activity of this multifunctional polymerase. This work lays the biochemical foundations for the properties of QDE-1. Consequently, it is possible to apply this knowledge in future in vivo studies, allowing us to probe the effect of amended polymerases in quelling and other activities. Acknowledgments—We thank Riitta Tarkiainen, Satu Hyva¨rinen, Xiaoyu Sun, and Sampo Vehma for excellent technical assistance. REFERENCES 1. 2. 3. 4. 5.
8. 9. 10. 11. 12. 13.
14.
29374 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 285 • NUMBER 38 • SEPTEMBER 17, 2010
Downloaded from http://www.jbc.org/ by guest on February 6, 2016
6. 7.
Siomi, H., and Siomi, M. C. (2009) Nature 457, 396 – 404 Moazed, D. (2009) Nature 457, 413– 420 Ghildiyal, M., and Zamore, P. D. (2009) Nat. Rev. Genet. 10, 94 –108 Rana, T. M. (2007) Nat. Rev. Mol. Cell Biol. 8, 23–36 Ruby, J. G., Jan, C., Player, C., Axtell, M. J., Lee, W., Nusbaum, C., Ge, H., and Bartel, D. P. (2006) Cell 127, 1193–1207 Pak, J., and Fire, A. (2007) Science 315, 241–244 Sijen, T., Steiner, F. A., Thijssen, K. L., and Plasterk, R. H. (2007) Science 315, 244 –247 Lee, S. R., and Collins, K. (2007) Nat. Struct. Mol. Biol. 14, 604 – 610 Sugiyama, T., Cam, H., Verdel, A., Moazed, D., and Grewal, S. I. (2005) Proc. Natl. Acad. Sci. U.S.A. 102, 152–157 Gazzani, S., Lawrenson, T., Woodward, C., Headon, D., and Sablowski, R. (2004) Science 306, 1046 –1048 Curaba, J., and Chen, X. (2008) J. Biol. Chem. 283, 3059 –3066 Lipardi, C., and Paterson, B. M. (2009) Proc. Natl. Acad. Sci. U.S.A. 106, 15645–15650 Maida, Y., Yasukawa, M., Furuuchi, M., Lassmann, T., Possemato, R., Okamoto, N., Kasim, V., Hayashizaki, Y., Hahn, W. C., and Masutomi, K. (2009) Nature 461, 230 –235 Catalanotto, C., Nolan, T., and Cogoni, C. (2006) FEMS Microbiol. Lett. 254, 182–189
15. Choudhary, S., Lee, H. C., Maiti, M., He, Q., Cheng, P., Liu, Q., and Liu, Y. (2007) Mol. Cell. Biol. 27, 3995– 4005 16. Romano, N., and Macino, G. (1992) Mol. Microbiol. 6, 3343–3353 17. Cogoni, C., and Macino, G. (1997) Proc. Natl. Acad. Sci. U.S.A. 94, 10233–10238 18. Cogoni, C., and Macino, G. (1999) Science 286, 2342–2344 19. Cogoni, C., and Macino, G. (1999) Nature 399, 166 –169 20. Goldoni, M., Azzalin, G., Macino, G., and Cogoni, C. (2004) Fungal Genet. Biol. 41, 1016 –1024 21. Catalanotto, C., Azzalin, G., Macino, G., and Cogoni, C. (2002) Genes Dev. 16, 790 –795 22. Catalanotto, C., Pallotta, M., ReFalo, P., Sachs, M. S., Vayssie, L., Macino, G., and Cogoni, C. (2004) Mol. Cell. Biol. 24, 2536 –2545 23. Forrest, E. C., Cogoni, C., and Macino, G. (2004) Nucleic Acids Res. 32, 2123–2128 24. Fulci, V., and Macino, G. (2007) Curr. Opin. Microbiol. 10, 199 –203 25. Maiti, M., Lee, H. C., and Liu, Y. (2007) Genes Dev. 21, 590 – 600 26. Pickford, A., Braccini, L., Macino, G., and Cogoni, C. (2003) Curr. Genet. 42, 220 –227 27. Lee, H. C., Chang, S. S., Choudhary, S., Aalto, A. P., Maiti, M., Bamford, D. H., and Liu, Y. (2009) Nature 459, 274 –277 28. Nolan, T., Cecere, G., Mancone, C., Alonzi, T., Tripodi, M., Catalanotto, C., and Cogoni, C. (2008) Nucleic Acids Res. 36, 532–538 29. Makeyev, E. V., and Bamford, D. H. (2002) Mol. Cell 10, 1417–1427 30. Laurila, M. R., Salgado, P. S., Makeyev, E. V., Nettelship, J., Stuart, D. I., Grimes, J. M., and Bamford, D. H. (2005) J. Struct. Biol. 149, 111–115 31. Salgado, P. S., Koivunen, M. R., Makeyev, E. V., Bamford, D. H., Stuart, D. I., and Grimes, J. M. (2006) PLoS Biol. 4, e434 32. Gottlieb, P., Strassman, J., Qiao, X., Frilander, M., Frucht, A., and Mindich, L. (1992) J. Virol. 66, 2611–2616 33. Yang, H., Makeyev, E. V., and Bamford, D. H. (2001) J. Virol. 75, 11088 –11095 34. Sambrook, J., and Russell, D. (2001) Molecular cloning: a laboratory manual (3rd edition), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. 35. Poranen, M. M., Koivunen, M. R., and Bamford, D. H. (2008) J. Virol. 82, 9254 –9264 36. Gnatt, A. L., Cramer, P., Fu, J., Bushnell, D. A., and Kornberg, R. D. (2001) Science 292, 1876 –1882
SUPPLEMENTAL DATA Figure S1. The ladder reaction is sensitive to varying reaction conditions. (A) A standard QDE-1 reaction was programmed without a template and incubated at +30ºC for two hours. The reaction was desalted, denatured by heat and analyzed on a 20 % urea-containing polyacrylamide gel. Positions of 1 nt and 30 nts are indicated on the left. (B) and (C) Equal amounts of ssRNA or ssDNA templates with the same length and sequence were used as templates in QDE-1 N WT reactions at the indicated NaCl concentrations (B) or temperatures (C). The templates were omitted in ladder reactions. The maximum activity of each reaction set (RdRP, DdRP or ladder) was set as 100 %. The experiments were repeated independently two times. Error bars indicate the standard errors of the mean. (D) Standard QDE-1 reactions were programmed without a template. NTPs and trace amounts of corresponding -32P-NTPs were added as indicated. The reaction products were analyzed by native agarose gel electrophoresis, and shown is the autoradiogram of the gel. The ladder occurs only with combinations of ATP and UTP.
Figure S2. RdRP and DdRP reactions can occur simultaneously. Standard QDE-1 reactions were conducted with a linear ssRNA template, a circular ssDNA template and QDE-1 N WT. In each reaction set the concentrations of two variables were kept equimolar, while the third was added incrementally as indicated. Titration of (A) QDE-1 N WT, (B) ssDNA and (C) ssRNA. The reactions were incubated at +30ºC for one hour and the reaction products were analyzed by native agarose gel electrophoresis. Upper panels: autoradiograms of the gels. The faint band between the DNA/RNA and dsRNA bands is a conformer of the DNA/RNA product. Lower panels: the incorporated radioactivity was quantified for each reaction product and shown are plots of increasing relative concentration of (A) QDE-1 N WT, (B) ssDNA and (C) ssRNA as a function of
1
relative QDE-1 activity (% of maximal value, filled circles: dsRNA, open circles: DNA/RNA hybrid). Shown are the means of two independent experiments. Error bars indicate the standard deviations.
Figure S3. Mutation sites within QDE-1 sequence. The figure shows the amino acid sequence of wild-type QDE-1 (accession number EAA29811). The sequence of QDE-1 N is in bold, and the missing N-terminus is overlined in gray. The mutated amino acids are depicted in red and the mutations are indicated above the residues. Three subdomains (DPBB1, DPBB2 and FLAP) of the catalytic domain are outlined by cyan boxes. DPBB is an abbreviation from double-psi -barrel.
Figure S4. Overview of the activities of the point mutant enzymes. (A) A linear ssRNA and a circular ssDNA were used as templates in standard QDE-1 N reactions. As a control, the ssRNA was labeled in the 5’ end. The samples were analyzed by native agarose gel electrophoresis. Upper panel: ethidium bromide stained gel, lower panel: autoradiogram of the same gel. (B) Terminal nucleotidyl transferase (TNTase) activity of QDE-1 N enzymes was analyzed by mixing them with cold UTP, -32P-UTP and linear ssRNA or ssDNA of the same length and sequence. The samples were analyzed by native agarose gel electrophoresis and shown are autoradiograms of the gels.
2
Table S1. Plasmids and mutagenesis primer sequences. Plasmid
Mutation
Sense primer
Antisense primer
D1007A
CTTGCTAAGAAGCTTTCTGGTGGAGCCT
CCATATCGCCGTCGTAGGCTCCACCAGAAAGCT
ACGACGGCGATATGG
TCTTAGCAAG
GTCCTCGTGGCGCGATCGGCAGCCCATT
GATATCACTAGGGAAATGGGCTGCCGATCGCG
TCCCTAGTGATATC
CCACGAGGAC
GCATGTGCACTAACTACAAAGAAGCGC
CACTATTGTTGATGTAACAGAGCGCTTCTTTGT
TCTGTTACATCAACAATAGTG
AGTTAGTGCACATGC
GATGTGCCCTCTGCAGTGCAAGGGGCG
CTTGGCCGAACCAAACGCCCCTTGCACTGCAGA
TTTGGTTCGGCCAAG
GGGCACATC
GTTCATGTATGCGGGCTTGGACCCGGAT
CTTCGTAAACTTCTTATCCGGGTCCAAGCCCGC
AAGAAGTTTACGAAG
ATACATGAAC
GTTCATGTATGCGGGCTTGTGCCCGGAT
CTTCGTAAACTTCTTATCCGGGCACAAGCCCGC
AAGAAGTTTACGAAG
ATACATGAAC
GAAACCTCGTCGATCAGAGCTGGCAAG
CGTTAAAGACAATACCTTGCCAGCTCTGATCGA
GTATTGTCTTTAACG
CGAGGTTTC
CATGTCGGATTCTCATCAAAGTTCGAGG
GTAAAAGACTCCTCCTCGTCCTCGAACTTTGAT
ACGAGGAGGAGTCTTTTAC
GAGAATCCGACATG
name pAA8 pAA9 pAA10 pAA11 pAA12 pAA13 pAA14 pAA15
P964A R1091A R738A M1357D M1357C K1119W R944E
Table S2. Predicted mutations of the QDE-1 enzymes. Plasmid name
Mutation
Mutation site
pEM69
None
None
pEM56
D1011A
Active site
pAA8
D1007A
Active site
pAA9
P964A
Active site
pAA10
R1091A
Incoming RNA
pAA11
R738A
Channel RNA away
pAA12
M1357D
Dimer helical head domain interface
pAA13
M1357C
Dimer helical head domain interface
pAA14
K1119W
Block nucleotide pore entrance
pAA15
R944E
Communication tunnel
3
Table S3. Activities of the QDE-1 enzymes. QDE-1 enzyme
RdRP (i)
DdRP (ii)
RNA shift (iii)
TNTase (iv)
Ladder (v)
++
+++
++
+++
+++
R738A
+
+
-
+
-
R944E
+
+++
+++
++
-
K1119W
+++ (pH*)
+++ (pH*)
-
+
-
M1357D
+
+++
+++
+++
+++
M1357C
++
+++
++
+++
+++
P964A
++
++
+
N WT
ssRNA ++ ssDNA -
* K1119W is inactive at a low pH and regains its activity as pH increases.
Table S4. Primer sequences. Primer name
Primer sequence
AO#49
5´- ACTCTTATATAAGTGCCCTTAGC -3´
AO#50
5´- BIO-GGTCCTATTGGACGCTC -3´
AO#51 (RNA)
5´- CCCUACCCCGCCCUAUUUCCCCCUUUCCCC -3´
AO#52 (DNA)
5´- CCCTACCCCGCCCTATTTCCCCCTTTCCCC -3´
4
-
Figure S1. B
120
Activity (% of max.)
A
ssRNA ssDNA Ladder 80
40
0 0
50
150
100
250
200
NaCl (mM)
30 C
Activity (% of max.)
120 ssRNA ssDNA Ladder 80
40
0 30
35
45
40
50
Temperature (°C) D
ATP GTP CTP UTP
+ -
+ -
+ -
+
1-
5
+ + -
+ + -
+ +
+ + -
+ +
+ +
+ + + -
+ + +
+ + +
+ + +
+ + + +
Figure S2.
A
C
B
Relative concentrations: QDE-1 D N 0 0.03 0.08 0.15 0.3 ssRNA 1 1 1 1 1 ssDNA 1 1 1 1 1
1 1 1
2 1 1
1 1 0
1 1 1 1 1 1 0.1 0.25 0.5
1 1 1
1 0 1
1 1 1 0.1 0.25 0.5 1 1 1
1 1 1
DNA/RNA -
dsRNA -
100 80 60 40 20
dsRNA DNA/RNA
0
120
Relative activity (% of max.)
120
Relative activity (% of max.)
Relative activity (% of max.)
120
100
100
80 60 40 20
dsRNA DNA/RNA
0 0
0.5
1.0
1.5
2.0
Relative QDE-1 conc.
0
0.2
0.4
0.6
0.8
1.0
Relative ssDNA conc.
6
80 60 40 20
dsRNA DNA/RNA
0 0
0.2
0.4
0.6
0.8
1.0
Relative ssRNA conc.
Figure S3.
1 MNPITPRKRN SPVEEIINRL NNDYNLGLQC VADTTLTPHR RKELAESDED FGRHDKIYRA 61 LNFLYWRKDD SLNQAEANFF IEAKAASSNW VPKAHADPDT LPWSKEPPRA ATAGQQWALQ 121 TVLLEVLNRF MPPPNNTPGR TFGRTLSGPS GLSRPTSTNT KRKDEPANVT FADPPKRSLT 181 RSATGPPIHG AAIPLKFPDP VNTGSKRPSL ESENLNQCTK RAKGKLSDNV AAAAAPPVPI 241 ASALDKVPTR RHANTRDPTA TGHRRADQVD SFDTSQGTSY GSSVFSACRH NQSTTQSSFE 301 APPSQPREKR PVDATVFEAG HLIESPSKGR TTKSHIDNQP LSSSSQGETS FSTYYESFPS 361 SGGEGAIPEP SRSNGLARSE ESARSQVQVH APVVAARLRN IWPKFPKWLH EAPLAVAWEV 421 TRLFMHCKVD LEDESLGLKY DPSWSTARDV TDIWKTLYRL DAFRGKPFPE KPPNDVFVTA 481 MTGNFESKGS AVVLSAVLDY NPDNSPTAPL YLVKLKPLMF EQGCRLTRRF GPDRFFEILI 541 PSPTSTSPSV PPVVSKQPGA VEEVIQWLTM GQHSLVGRQW RAFFAKDAGY RKPLREFQLR 601 AEDPKPIIKE RVHFFAETGI TFRPDVFKTR SVVPAEEPVE QRTEFKVSQM LDWLLQLDNN DPBB1 661 TWQPHLKLFS RIQLGLSKTY AIMTLEPHQI RHHKTDLLSP SGTGEVMNDG VGRMSRSVAK R738A
721 RIRDVLGLGD VPSAVQGRFG SAKGMWVIDV DDTGDEDWIE TYPSQRKWEC DFVDKHQRTL 781 EVRSVASELK SAGLNLQLLP VLEDRARDKV KMRQAIGDRL INDLQRQFSE QKHALNRPVE 841 FRQWVYESYS SRATRVSHGR VPFLAGLPDS QEETLNFLMN SGFDPKKQKY LQDIAWDLQK DPBB2 R944E 901 RKCDTLKSKL NIRVGRSAYI YMIADFWGVL EENEVHVGFS SKFRDEEESF TLLSDCDVLV P964A
D1007A
D NDA
961 ARSPAHFPSD IQRVRAVFKP ELHSLKDVII FSTKGDVPLA KKLSGGDYDG DMAWVCWDPE 1021 IVDGFVNAEM PLEPDLSRYL KKDKTTFKQL MASHGTGSAA KEQTTYDMIQ KSFHFALQPN FLAP R1091A K1119W 1081 FLGMCTNYKE RLCYINNSVS NKPAIILSSL VGNLVDQSKQ GIVFNEASWA QLRRELLGGA 1141 LSLPDPMYKS DSWLGRGEPT HIIDYLKFSI ARPAIDKELE AFHNAMKAAK DTEDGAHFWD 1201 PDLASYYTFF KEISDKSRSS ALLFTTLKNR IGEVEKEYGR LVKNKEMRDS KDPYPVRVNQ 1261 VYEKWCAITP EAMDKSGANY DSKVIRLLEL SFLADREMNT WALLRASTAF KLYYHKSPKF M1357D/C
1321 VWQMAGRQLA YIKAQMTSRP GEGAPALMTA FMYAGLMPDK KFTKQYVARL EGDGSEYPDP 1381 EVYEVLGDDD FDGIGFTGNG DY DPBB1: 678-792 DPBB2: 916-1018 FLAP: 1025-1161 7
Figure S4. A
L
CT
T W DA N N D D D C A A 1 1 - E- 07 4A 91 8A 357 357 19W44E E 0 3 L D D 0 6 1 7 1 1 11 9 Q Q D1 P9 R R M M K R CT
ssRNA
T W DA N N D D D C A A 1 1 - E- 07 4A 91 8A 357 357 19W44E E 0 3 D D 0 6 1 7 1 1 11 9 Q Q D1 P9 R R M M K R
ssDNA
B L
CT
T W DA N D N D D C A A 1 1 - E- 007 4A 091 38A 357 357 19W44E E 6 D D 1 9 1 7 1 1 11 9 Q Q D P R R M M K R
ssRNA
ssDNA
8
In Vitro Activities of the Multifunctional RNA Silencing Polymerase QDE-1 of Neurospora crassa Antti P. Aalto, Minna M. Poranen, Jonathan M. Grimes, David I. Stuart and Dennis H. Bamford J. Biol. Chem. 2010, 285:29367-29374. doi: 10.1074/jbc.M110.139121 originally published online July 20, 2010
Access the most updated version of this article at doi: 10.1074/jbc.M110.139121 Alerts: • When this article is cited • When a correction for this article is posted
Supplemental material: http://www.jbc.org/content/suppl/2010/07/20/M110.139121.DC1.html This article cites 35 references, 19 of which can be accessed free at http://www.jbc.org/content/285/38/29367.full.html#ref-list-1
Downloaded from http://www.jbc.org/ by guest on February 6, 2016
Click here to choose from all of JBC's e-mail alerts
