BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS ARTICLE NO.
227, 433–439 (1996)
1525
Import into Mitochondria of Phospholipid Hydroperoxide Glutathione Peroxidase Requires a Leader Sequence Masayoshi Arai,* Hirotaka Imai,* Daigo Sumi,* Tsuneo Imanaka,† Tatsuya Takano,† Nobuyoshi Chiba,‡ and Yasuhito Nakagawa*,1 *School of Pharmaceutical Sciences, Kitasato University, 5-9-1 Shirokane, Minato-ku, Tokyo 108, Japan; †Department of Microbiology and Molecular Pathology, Faculty of Pharmaceutical Sciences, Teikyo University, Sagamiko, Kanagawa 199-01, Japan; and ‡Japan Energy Corporation, 3-17-35 Niizo-Minami, Toda-shi, Saitama 335, Japan Received September 4, 1996 An in vitro import system was used to characterize the mechanism of import of phospholipid hydroperoxide glutathione peroxidase (PHGPx) into mitochondria. Mitochondria were isolated from rat liver and incubated at 257C with [35S]methionine-labeled products of the in vitro translation of mRNA that encoded 23-kDa and 20-kDa PHGPx. 23-kDa PHGPx was imported into mitochondria in a time-dependent manner and was processed to yield the 20-kDa form of PHGPx. The 20-kDa form of PHGPx, without a leader sequence, associated weakly with mitochondria but was not imported. An analysis with an uncoupler of oxidative phosphorylation showed that a membrane potential in the mitochondria was also required for the import of PHGPx. It appears, therefore, that the leader sequence in the precursor to PHGPx is the signal for import into the mitochondria. This is the first report to indicate that the precursor to PHGPx is imported into the mitochondria via the action of a leader sequence. q 1996 Academic Press, Inc.
Mitochondria are recognized as a major physiological source of reactive oxygen species, which can be generated during mitochondrial respiration (1). The presence of superoxide radicals, formed from minor side-reactions of the mitochondrial electron-transport chain or by an NADH independent enzyme, can lead to formation H2O2 and the powerful oxidant, the hydroxyl radical (2). For these reasons, mitochondria are also considered as the most important sites at which peroxidative processes, for example, the peroxidation of membrane lipids, can occur, with subsequent damage to electron-transfer activities (3). There are several antioxidant enzymes in mitochondria, namely, phospholipid hydroperoxide glutathione peroxidase (PHGPx), classical glutathione peroxidase and Mn-superoxide dismutase. However, the mechanisms for targeting and importing of these enzymes into the mitochondria are not clearly understood. PHGPx has been detected in the cytoplasm and mitochondria as well as in plasma and nuclear membranes (4). PHGPx is a unique selenoenzyme, that can directly reduce peroxidized phospholipids (5) and cholesterol (6) at the expense of glutathione. PHGPx has, therefore, been considered to be the main enzymatic defense against the oxidative destruction of biomembranes in mitochondria and other organelles (7). In the mitochondria of the rat testis, PHGPx is localized in the intermembrane space, possibly at the contact sites of the two membranes (8). The cytosolic and membrane-associated mitochondrial forms of PHGPx from rat testis appear to be identical; in view of their identical molecular masses of 19.7 kDa, and their crossreactivity with antisera (9). 1
Corresponding author. Fax: 03-3444-4943. E-mail:
[email protected]. Abbreviations: PHGPx, phospholipid hydroperoxide glutathione peroxidase; CCCP, carbonyl cyanide m-chlorophenyl-hydrazone. 433 0006-291X/96 $18.00 Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.
AID
BBRC 5514
/
690d$$$381
09-26-96 10:34:11
bbrca
AP: BBRC
Vol. 227, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
We recently cloned a cDNA for PHGPx from the rat (10) and demonstrated that overexpression of PHGPx suppressed cell death due to oxidative damage (11). The cDNA for PHGPx included two potential sites for initiation of translation. One deduced product was a 19.7 kDa protein of 170 amino acids, which had the same molecular mass as the protein purified from tissues. The deduced product was a 23 kDa protein of 197 amino acids, of which the additional 27 amino acids at the amino terminus included the features of a mitochondrial targeting sequence (12). However, the larger form of PHGPx has not been detected in the cytosol or in mitocondria (9) and the structural basis for its subcellular localization and details of the binding to, import into and processing within mitochondria have not been determined. To characterize the mechanism of import of PHGPx into the mitochondria, we used the products of translation in vitro of mRNA for PHGPx and an in vitro import system that included isolated mitochondria from rat liver. We showed that the leader sequence in the precursor 23 kDa PHGPx is the signal for import into the mitochondria and that the precursor 23 kDa PHGPx is processed to the mature 20 kDa PHGPx in the mitochondria. Moreover, we also obtained evidence that the membrane potential in the mitochondria required for the import of the precursor. MATERIALS AND METHODS Materials. [35S]Methionine (46.3 TBq/mmol) was purchased from Amersham (Japan). Carbonyl cyanide m-chlorophenyl hydrazone (CCCP), protein G-agarose, leupeptin, antipain, chymostatin, pepstatin A and phenylmethylsulfonyl fluoride (PMSF) were obtained from Sigma (St.louis, MO,USA). The rabbit reticulocyte lysate, cell-free protein synthesis system was from Promega. Plasmids. The cDNA clone, pRPHGPx3, encoding 19.7 kDa PHGPx was used as described previously (11). Clone pRPHGPx3 contained mutations that converted UGA, which encodes selenocysteine, to UGU, which encodes cysteine. Clone pRPHGPx3 contained the second but not the first initiation codon. A full-length cDNA clone, pRPHGPx4, encoding 23 kDa PHGPx,which contained the first initiation codon, was cloned from a rat brain cDNA library as described previously (10). The sequence of the 5*-terminal end of the insert in pRPHGPx4,which contained the first initiation codon, was 66 base pairs longer than that of pRPHGPx3. The extra sequence was as follows: 5*GCTGGCTCCGGCCGCCGAGATGAGCTGGGGCCGTCTGAGCCGCTTATTGAAGCCAGCACTGCTGTG-3*. The encoded leader sequence is MSWGRLSRLLKPALLCGALAMPGLAGT, which includes features of a mitochondrial import signal. Clone pRPHGPx5,which contained that first initiation codon and mutations that converted UGA, which encodes selenocysteine, to UGU, which encodes cysteine, was constructed by insertion of the BamHI-ClaI fragment of pRPHGPx4 between the BamHI and ClaI sites of pRPHGPx3. Transcription and translation in vitro. The cDNA clones (pRPHGPx3 and pRPHGPx5) encoding the 19.7 kDa PHGPx (Cys) and 23 kDa PHGPx (Cys) were inserted between the BamHI sites of the pTZ18R vector (Toyobo, Osaka, Japan). The plasmid was linearized by digestion with HindIII of the cDNA and was transcribed in vitro by T7 RNA polymerase. In a typical experiment, 5 mg of plasmid DNA were transcribed in 50 ml of transcription mixture (Promega, USA) with 0.5 mM m7G(5*)ppp(5*)G. Three mg of mRNA that had been transcribed were used for translation in a rabbit reticulocyte lysate, cell-free protein synthesis system (Promega) with [35S]methionine. After translation, the reaction mixture was centrifuged for 1 h at 10,0001g and the supernatant was used for the import assay as described previously (13). Preparation of mitochondria from rat liver. Mitochondria were isolated from rat liver by differential centrifugation as described previously (14) and suspended in import buffer (0.22 M mannitol, 0.07 M sucrose, 1 mM MgCl2 , 1 mM DTT, 10 mM HEPES-KOH, pH 7.4, and 1 mM EDTA). The CCCP treated mitochondria were prepared by incubation of 2.1 mg as protein of mitochondria in 200 ml of import buffer that contained 1 mM CCCP at 07C for 30 min. Binding of PHGPx to and import into isolated mitochondria in vitro. The products of translation were incubated in 50 ml of the buffer for an ATP-generating system with isolated mitochondria (100 mg of protein) from rat liver at 257C for the indicated times. The buffer for the ATP-generating system contained 40m M NADH, 0.5 mM ATP, 0.1 mM GTP, 1.5 mM creatine phosphate, 15 mg/ml creatine phosphokinase and 2 mg/ml each protease inhibitor (leupeptin, antipain, chymostatin, pepstatin A) in the import buffer as described (14). Transport was stopped by the addition of 100 ml of import buffer that contained 0.1 mM dinitrophenol and then it was centrifuged at 5,0001g for 10 min in a refrigerated microcentrifuge. The supernatant and the pelleted mitochondria were subjected to SDS-PAGE with subsequent fluorography. To quantify PHGPx that had been imported into mitochondria, the pelleted mitochondria were treated with 150 ml of a solution of 10mg/ml proteinase K in import buffer for 25 min at 07C after the import assay, and the reaction was stopped by addition of 1 ml of 250 mM PMSF and then centrifuged at 5,0001g for 10 434
AID
BBRC 5514
/
690d$$$381
09-26-96 10:34:11
bbrca
AP: BBRC
Vol. 227, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. (A) The structure of cDNAs (pRPHGPx5 and pRPHGPx3) that encoded the long and short forms of rat PHGPx and were used for translation system in vitro. The predicted molcular mass of the long form of PHGPx is 23 kDa and that of the short form of PHGPx, which lacks the amino terminal 27 amino acids of the long form, is 19.7 kDa. (B) Synthesis in vitro of the long and short forms of PHGPx. PHGPx was synthesized from pRPHGPx5 (lanes 1 and 2) and pRPHGPx3 (lanes 3 and 4) by coupling transcription and translation in vitro. Translation in vitro of the RNA from pRPHGPx5 produced predominantly proteins of 23 kDa (L-1) and 20 kDa (L-2), whereas the mRNA transcribed from pRPHGPx3 produced 20 kDa (S-1) and 17.3 kDa (S-2) proteins. The products of translation in vitro were immunoprecipitated with antibodies against PHGPx (lanes 2 and 4).
min. The pelleted proteinaseK treated mitochondria were subjected to SDS-PAGE with susequent autoradiography. Quantitative analysis was performed with a Bio-imaging analyzer (BAS2000, Fuji Film,Tokyo). Immunoprecipitaion. Immnoprecipitation of in vitro synthesized PHGPx was performed with anti-PHGPx by the previously described method (11).
RESULTS AND DISCUSSION
The cDNAs for rat, human (15), and pig PHGPx (16) encode a 23 kDa protein of 197 amino acids, which is initiated at the first AUG codon of the mRNA, and a 19.7 kDa protein of 170 amino acids which is initiated at the second AUG codon (Figure1A). However, biochemical analysis of the purified protein in the cytosol and mitochondria has shown that PHGPx is a 19.7 kDa protein. No PHGPx of 23 kDa has been found in tissues and cultured cells, even though a 23 kDa PHGPx was generated in an in vitro translation system (17). We showed previously that cytosolic PHGPx that is initiated at the second AUG codon is a 19.7 kDa protein in cultured RBL2H3 (11) and COS-7 (10) cells in transfection experiments. The long form should be the precurser to the PHGPx that is present in the mitochondria since the amino terminal 27 amino acids of the long form include the motif of a mitochondrial import signal that forms an amphiphilic a-helical structure, with positively charged and hydrophobic amino acids on opposite faces of the helix. To clarify the import into and processing within the mitochondria of PHGPx, we first prepared two products of translation, the long and the short forms of PHGPx, using an in vitro tranlation system. The 861 bp of cDNA (pRPHGPx5) that encoded the 23 kDa PHGPx and the 761 bp of cDNA (pRPHGPx3) that encoded the 19.7 kDa PHGPx were transcribed in vitro, and the synthetic RNAs were translated in a rabbit 435
AID
BBRC 5514
/
690d$$$381
09-26-96 10:34:11
bbrca
AP: BBRC
Vol. 227, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. The association with and import into mitochondria of the long and short forms of PHGPx. The long form (A, B and C) and the short form (D, E and F) of [35S]PHGPx, synthesized in the in vitro translation system, were incubated with rat liver mitochondria at 257C for the times indicated. After import, reactions were stopped by addition of dinitrophenol and centrifugation to yeild the supernatant (A and D) and the pelleted mitochondria (B and E). The pelleted mitochondria were treated with proteinase K for 30 min at 07C (C and F). After treatement, mitochondria were reisolated and [35S]PHGPx was analyzed by 12.5% SDS-PAGE, with subsequent autoradiography.
reticulocyte lysate system (Figures 1A and 1B). As shown in Figure1B, the 23 kDa and 20 kDa PHGPx produced from pRPHGPx5 were designated L-1 and L-2, respectively. The 20 kDa and 17.3 kDa proteins produced from pRPHGPx3 were designated S-1 and S-2, respectively. These four products of translation (L-1, L-2, S-1 and S-2) all appeared to have originated from mRNA for PHGPx since all of them were completedly immunoprecipitated with antibodies against PHGPx ( Figure 1B). 23 kDa (L-1) and 20 kDa (S-1) are the predicted molecular masses of PHGPx. Other products of 20 kDa (L-2) and 17.3 kDa (S-2) might have been translated from some internal codons for methionine residues in the PHGPx cDNA. There have been several reports of the production of intermediates synthesized in in vitro translation systems (13,14). L-2 might even have been S-1. The long and short forms of [35S]PHGPx that had been synthesized in vitro were incubated for 0 min to 30 min at 257C in the presence of purified mitochondria from rat liver, to investigate whether the 23 kDa protein is imported into the mitochondria with subsequent processing to the 20 kDa PHGPx. After incubation, the reaction mixture was centrifugated at 5,000 1 g to separate the supernatant (Figures 2A and 2D) from the mitochondria (Figures 2B and 2E). The mitochondria were treated with proteinase K for 25 min at 07C after the import assay to remove any PHGPx associated with the surface of the mitochondria (Figures 2C and 2F). The 23 kDa (L-1) PHGPx rapidly disappeared from the supernatant within 5 min (Figure 2A), while the amount of the L-2 form did not change significantly throughout the incubation period (Figure 2A). With the disappearance of the 23kDa PHGPx from the supernatant, the amounts of the 23 kDa and 20 kDa PHGPx increased in the mitochondria (Figure 2B). Treatment with proteinaseK removed the 23 kDa PHGPx, while the 20 kDa protein remained in the mitochondrial fraction (Figure 2C). This result shows that the PHGPx imported into the mitochondria was a 20kDa protein. The changes in the amounts of 23 kDa and 20 kDa PHGPx in the supernatant and mitochondria with time are shown in Figures 3A and 3B. The 23 kDa 436
AID
BBRC 5514
/
690d$$$381
09-26-96 10:34:11
bbrca
AP: BBRC
Vol. 227, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 3. Time-dependent import of the long form of PHGPx into mitochondria. The relative radioactivity of 23 kDa and 20 kDa PHGPx after SDS-PAGE, as shown in Figures 2A, 2B and 2C, was measured with a Bio-imaging analyzer. (A) The decrease in the level of the L-1 form of PHGPx in the supernatant during the incubation. The vertical axis indicates the percentage of radioactivity of 23 kDa (L-1) and 20 kDa (L-2) PHGPx in the supernatant relative to the radioactivity of PHGPx in the supernatant at 0 min (closed squares, L-1, 23 kDa PHGPx; open squares, L-2, 20 kDa PHGPx). (B) The increase in the level of 23 kDa PHGPx associated with the mitochondria and of the imported 20 kDa PHGPx during the incubation. The vertical axis indicates the increase in the percentage of radioactivity of 23 kDa PHGPx associated with the mitochondria and the imported 20 kDa PHGPx relative to the radioactivity of 23 kDa (L-1) PHGPx in the supernatant at 0 min (closed circles, 20 kDa PHGPx that had been imported into mitochondria; open circles, 23 kDa PHGPx that had associated with mitochondria). Data represent means { SE of results from three experiments.
PHGPx was rapidly lost from the supernatant, but the level of the 20 kDa PHGPx (L-2) did not change (Figure3A). By contrast, the amount of 23 kDa PHGPx that was associated with the mitochondria and that of the imported 20 kDa PHGPx increased during the incubation (Figure3B). The decrease in the level of the 23 kDa PHGPx in the supernatant corresponded to the sum of the increased amount of the 23 kDa protein associated with the mitochondria and the 20 kDa PHGPx in the mitochondria. Therefore, it appeared that the 20 kDa PHGPx 437
AID
BBRC 5514
/
690d$$$381
09-26-96 10:34:11
bbrca
AP: BBRC
Vol. 227, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 4. Effect of CCCP and temperature on the import of PHGPx into mitochondria. (A) Mitochondria were preincubated with CCCP at 07C for 30 min. The untreated (lanes 1, 2, 5, and 6) or pretreated mitochondria (lanes 3 and 4) were incubated with the long form of PHGPx at 257C (lanes 1-4) or at 07C (lanes 5 and 6) for 30 min. After this incubation, the mitochondria were further incubated with and without proteinase K, reisolated and analyzed by 12.5% SDS-PAGE, with subsequent autoradiography and quantitative analysis with the Bio-imaging analyzer. (B) The vertical axis indicates the percentage of PHGPx imported into mitochondria that had been treated with CCCP or incubated at 07C relative to the radioactivity of PHGPx imported in the mitochondria in the absence of CCCP at 257C (control). Data represent the means of triplicate results.
in the mitochondria was mainly produced from the 23 kDa PHGPx, and not from the 20 kDa PHGPx in the supernatant. These results revealed that only the 23 kDa PHGPx (L-1) was imported into mitochondria, and that the imported 23 kDa PHGPx was processed to the 20 kDa PHGPx in the mitochondria. A small amount of the S-1 form of the 20 kDa PHGPx was associated with the mitochondria (Figure 2D). The amounts of the S-1 form of the 20kDa PHGPx in the supernatant, as well as in the mitochondria remained constant throughout the incubation (Figures 2D, 2E, and 2F). These results showed that the short forms of PHGPx with a deleted leader sequence associated weakly with the mitochondria but were not imported into the mitochondria. Our results reveal that the mitochondrial import of phospholipid hydroperoxide glutathione peroxidase requires the leader sequence of the 23 kDa precursor to mature PHGPx. To determine whether import of PHGPx requires a membrane potential, we preincubated mitochondria with CCCP, an uncoupler of oxidative phosphorylation (19). As shown in Figures 4A and 4B, import of PHGPx into the mitochondria was inhibited by approximately 90% during the incubation at 07C and was also suppressed by 70% by pretreatment of the mitochondria with CCCP. Thus, a membrane potential was required for the import of the 23kDa form of PHGPx. In our in vitro import system, the 23 kDa PHGPx and the 20 kDa PHGPx could associate with the mitochondria, but only the 23 kDa PHGPx was imported into the mitochondria. We conclude that the 23 kDa PHGPx is the precursor to the mitochondrial PHGPx and is processed to the 20 kDa mature form of PHGPx in the mitochondria. The leader sequence in the precursor to PHGPx includes the signal for import into the mitochondria. A membrane potential in the mitochondria is also required for the import of the precursor. These results suggest that PHGPx might play a very important role in the defense against lipid peroxidation in surface and inner membranes of the mitochondria, which are a major physiological source of reactive oxygen species in the cell. REFERENCES 1. Guarnieri, C., Muscari, C., and Caldarera, C. M. (1992) Free Radicals and Aging (Emerit, I., and Chance, B., Eds.), pp. 73–77, Birkhauser Verlag, Basel, Switzerland. 438
AID
BBRC 5514
/
690d$$$381
09-26-96 10:34:11
bbrca
AP: BBRC
Vol. 227, No. 2, 1996 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19.
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
Nohl, H. (1987) FEBS Lett. 214, 269–273. Guarnieri, C. (1985) Advances in Myocardiology, Vol. 5, pp. 191–199, Plenum Publishing. Roveri, A., Mariorino, M., and Ursini, F. (1994) Methods Enzymol. 233, 202–212. Ursini, F., Maiorino, M., and Gregolin, C. (1985) Biochim. Biophys. Acta 839, 62–72. Tomas, J. P., Maiorino, M., Ursini, F., and Girotti, A. W. (1990) J. Biol. Chem. 265, 454–461. Flohe´, L. (1989) in Glutathione: Chemical, Biochemical and Medical Aspects (Dolphin, D., Poulson, R., and Avramovic, O., Eds.), pp. 643–731, Wiley, New York. Godeas, C., Sandri, G., and Panfili, E. (1994) Biochim. Biophys. Acta 1191, 147–150. Roveri, A., Mariorino, M., Nisii, C., and Ursini, F. (1994) Biochim. Biophys. Acta 1208, 211–221. Imai, H., Sumi, D., Hanamoto, A., Arai, M., Sugiyama, A., Chiba, N., Kuchino, Y., and Nakagawa, Y. (1995) J. Biochem. 118, 1061–1067. Imai, H., Sumi, D., Sakamoto, H., Hanamoto, A., Arai, M., Chiba, N., and Nakagawa, Y. (1996) Biochem. Biophys. Res. Commun. 222, 432–438. Hartl, F. U., Pfanner, N., Nicholson, D. W., and Neupert, W. (1989) Biochim. Biophys. Acta 988, 1–45. Imanaka, T., Shiina, Y., Takano, T., Hashimoto, T., and Osumi, T. (1996) J. Biol. Chem. 271, 3706–3713. Mihara, K., and Omura, T. (1995) Methods in Enzymology 260, 302–310. Esworthy, R. S., Doan, K., Doroshow, J. H., and Chu, F. F. (1994) Gene 144, 317–318. Sunde, R. A., Dyer, J. A., Moran, T. V., Evenson, J. K., and Sugimoto, M. (1993) Biochem. Biophys. Res. Commun. 193, 905–911. Pushpa-Rekha, T. R., Burdsall, A. L., Oleksa, L. M., Chisolm, G. M., and Discoll, D. M. (1995) J. Biol. Chem. 270, 26993–26999. von Heijne, G. (1986) EMBO J. 5, 1335–1342. Pak, Y. K., and Weiner, H. (1990) J. Biol. Chem. 265, 14298–14307.
439
AID
BBRC 5514
/
690d$$$381
09-26-96 10:34:11
bbrca
AP: BBRC
