Immunogenicity and protective efficacy of orally or intranasally administered recombinant Lactobacillus casei expressing ETEC K99

Vaccine 28 (2010) 4113–4118

Contents lists available at ScienceDirect

Vaccine journal homepage: www.elsevier.com/locate/vaccine

Immunogenicity and protective efficacy of orally or intranasally administered recombinant Lactobacillus casei expressing ETEC K99 Chun-Hua Wei a , Jian-Kui Liu a , Xi-Lin Hou a , Li-Yun Yu a,b,∗ , Jong-Soo Lee c , Chul-Joong Kim d a

College of Animal Science and Technology, Heilongjiang Bayi Agricultural University, Daqing, Heilongjiang Province, 163319, China College of Life Science and Technology, Heilongjiang Bayi Agricultural University, Daqing, Heilongjiang Province, 163319, China Department of Molecular Microbiology and Immunology, Keck School of Medicine, University of Southern California, Harlyne J. Norris Cancer Research Tower, 1450 Biggy Street, Los Angeles, California 90033, USA d National Lab of Oral Vaccine, College of Veterinary Medicine, Chungnam National University, Daejeon 305-764, Republic of Korea b c

a r t i c l e

i n f o

Article history: Received 9 January 2009 Received in revised form 26 May 2009 Accepted 31 May 2009 Available online 17 June 2009 Keywords: Lactobacillus casei K99 adhesive fimbriae Mucosal immunization

a b s t r a c t In an effort to develop a safe and effective vaccine for the prevention of enterotoxigenic Escherichia coli (ETEC) K99 infections, we have developed a surface antigen display system using pgsA (poly-␥-glutamate synthetase A) as an anchoring matrix. The recombinant fusion proteins comprised of pgsA and fimbriae protein of ETEC K99 were stably expressed on Lactobacillus casei. Surface localization of the fusion protein was verified by immunoblotting, immunofluorescence microscopy and flow cytometry. Specific Pathogen Free (SPF) BALB/c mice orally or intranasally vaccinated with recombinant L. casei resulted in high levels of serum immunoglobulin G (IgG) and mucosal IgA against ETEC K99, as demonstrated by enzyme-linked immunosorbent assays using purified fimbriae peptides. The serum antibody isotypes elicited were predominantly IgG1 and IgG2a. Vaccinated SPF BALB/c mice were evaluated by oral challenge with standard-type ETEC C83912 after the last booster immunization. More than 80% of immunized mice survived regardless of the immune route. The antibody titers elicited following oral immunization were lower than those following intranasal immunization but the protective efficacy was in the same order of magnitude. These results indicate that mucosal immunization with recombinant L. casei expressing ETEC K99 fimbriae protein on its surface provides an effective means for eliciting a protective immune response against the ETEC K99. Crown Copyright © 2009 Published by Elsevier Ltd. All rights reserved.

1. Introduction Enterotoxigenic Escherichia coli (ETEC) strains can produce fatal diarrhea in neonatal calves. These organisms possess at least two known virulence factors: production of enterotoxins, which produce diarrhea by a mechanism of villous hypersecretion [1], and surface antigens such as pili or fimbrial adhesins, which facilitate colonization of the small intestine. The K99 pilus antigen is one of the major adherence factors found on ETEC of neonatal calves [2,3]. Conventional vaccines against bovine ETEC have been shown to provide varied immunity, and the effectiveness of these vaccines has been described only in anecdotal reports [4]. Limited protection with purified K99 fimbriae or formalin-inactivated ETEC has been demonstrated [5–7], but the need for an efficacious vaccine against bovine ETEC still exists [4]. The development of effective

∗ Corresponding author at: College of Life Science and Technology, Heilongjiang Bayi Agricultural University, Daqing 163319, China. Tel.: +86 4596819292; fax: +86 4596819290. E-mail addresses: [email protected], [email protected] (L.-Y. Yu).

strategies for the mucosal delivery of vaccine antigens has received considerable attention over the past decade, because this route of administration has the potential to elicit local immune responses at mucosal surfaces, the major portals of entry to the body for many pathogens [8]. The key effector molecule of the mucosal immune response is secretory immunoglobulin A (sIgA), which can play a key role in protecting against infection by inhibiting viral infectivity and bacterial colonization and by neutralizing the activity of microbial toxins [9–12]. For mucosal immunization, lactic acid bacteria (LAB) are more attractive as delivery vehicles than other live-vaccine vectors (e.g., Shigella, Salmonella, and Listeria) [13–16] because LAB are considered safe, they exhibit adjuvant properties, and they are weakly immunogenic [17–20]. In addition, extracellularly accessible antigens expressed on the surfaces of bacteria are better recognized by the immune system than those that are intracellular [14]. For surface display of antigens on LAB, we have developed an expression vector using the pgsA gene product as an anchoring matrix. The pgsA is a synthetase complex (PGS system) of Bacillus subtilis [21], and functions as a fusion partner for expression of heterologous antigens on the surface of L. casei [22]. The K99 fimbriae

0264-410X/$ – see front matter. Crown Copyright © 2009 Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.vaccine.2009.05.088

4114

C.-H. Wei et al. / Vaccine 28 (2010) 4113–4118

were inserted into the vector pLA, then expressed on the surface of L. casei. Intranasal and oral vaccination of mice with the live recombinant L. casei elicited high levels of systemic serum antibodies and local mucosal immunity against the antigen K99 fimbriae. The results of this study suggest a potential use for the surface expression system to construct ETEC K99 and against other diarrhea pathogens and respiratory system diseases that are transmitted mucosally. 2. Materials and methods 2.1. Bacterial strains and growth conditions E. coli C83912 isolated from a calf with intestinal infection in Japan was purchased from China Center of Veterinary Culture Collection (CVCC), Beijing, China. E. coli XL1-Blue was used for construction of the expression vectors. The bacteria was cultivated in Luria-Bertani medium or on Luria-Bertani agar plates and grown at 37 ◦ C. L. casei was grown at 37 ◦ C in MRS broth (Difco Laboratories, Detroit, Mich.) where appropriate antibiotics were added. For L. casei, chloramphenicol was used at final concentrations of 10 ␮g/ml, in case of E. coli, ampicillin, 100 ␮g/ml. 2.2. Plasmids and transformation The minimal surface display plasmid, pLA-K99 were constructed. The 498 bp DNA fragment encoding the fimbriae protein of K99 was amplified with 5 CGCGGATCCATGAAAAAGACTCTGA3 and 5 CGCAAGCTTTTACATATAAGTGACT3 , digested by BamHI and HindIII, and inserted into the vector pLA which mainly includes HCE constitutive promoter and pgsA-tag gene. The resulting plasmid, in which the fusion protein of the pgsA-K99 was expressed as described previously [23], was designated pLA-K99. L. casei isolated from Chinese food. Transformation of L. casei was performed by electroporation. The sample was subjected to a 2.2kV, 200-, 25-␮F electric pulse in a 0.2-cm cuvette, using a Gene Pulser (Bio-Rad, Richmond, Calif.). As a negative control, L. casei was transformed with an empty shuttle vector to generate pLA/ L. casei. 2.3. Immunoblotting, immunofluorescence microscopy and flow cytometry The recombinant L. casei cells were grown at 37 ◦ C. Protein extractions were performed as previously described [5]. For immunodetection of fusion proteins, mouse anti-pgsA (1:1000) and mouse anti-K99 (1:800) were used. Horseradish peroxidaseconjugated anti-mouse immunoglobulin G (IgG) was used as a secondary antibody. After washing the membranes with PBS containing 0.05% Tween 20 (PBS-T), the membranes were treated with Streptavidin-HRP complex (Vectastain ABC Kit, Vector Lab, USA) following the manufacturer’s instructions. Visualization of immunobinding was carried out with diaminobenzidine (DAB) solution (Vector Lab, USA). For immunofluorescence microscopy, cells labeled with anti-K99 polyclonal antibodies and FITC conjugated anti-mouse antibodies were examined using a Carl Zeiss Axioskop 2 fluorescence microscope. Photographs were taken with an Axiocam high-resolution camera using identical exposure times. For flow cytometry, L. casei cells were cultured in MRS broth (Difco) overnight at 37 ◦ C. The cell pellets were sequentially incubated with mouse anti-K99 polyclonal antibodies (1:800) and FITC-conjugated anti-mouse IgG secondary antibodies (1:5000; Sigma, St. Louis, MO). Finally, 3 × 104 cells were analyzed with FACS Calibur (Becton Dickinson, Oxnard, CA) equipped with CellQuest software.

2.4. Immunization of mice SPF mice (BALB/c, female, five weeks old) were obtained from Vital River Laboratories, Beijing, China. These animals were raised and used according the animal protocols approved by the Institutional Animal Care and Use Committee (IACUC). Animals were placed in individual cages with autoclaved food and water available ad libitum. All animals were housed in asepsis room. Mice were acclimated to the new environment for one week after arrival prior to immunization. To study the possibility of the surface-displayed ETEC K99 proteins to induce the mucosal immunity in mice, the method of Jong-Soo Lee [22] was employed. BALB/c mice (45 per group in 4 groups) were immunized orally or intranasally with an equal amount of live L. casei that express recombinant K99 protein from plasmid pLA-K99. L. casei harboring the parental plasmid pLA was used as a negative control. For the oral route, 5 × 109 pLA-K99/L. casei cells in 100 ␮l suspension were administered daily via intragastric lavage on days 0–4, 7–11, 21–25 and 49–53. For the intranasal route, 2 × 109 pLA-K99/L. casei cells in 20 ␮l suspension were administered into nostrils of lightly anesthetized mice on days 0–2, 7–9, 21 and 49. 2.5. Sampling Blood samples were collected from the tail vein on days 0 (preimmune), 14, 28, 42, 56, 70 and 84. Sera were prepared from the blood and stored at −20 ◦ C until they were analyzed. Fecal samples were collected every week. Fecal pellets (100 mg) were suspended in 0.5 ml PBS. After centrifugation at 15,000 × g for 5 min, the supernatants were collected and tested for IgA by ELISA. To obtain intestinal lavage samples, 7 mice were sacrificed on days 56, 70 or 84. Following the method of Wu and Russell [24], gut lavage fluids were obtained by flushing the excised small intestine with 3 ml of PBS containing 50 mM EDTA and 0.1 mg/ml of soybean trypsin–chymotrypsin inhibitor (Sigma). The contents were collected and retained on ice for processing, whereupon the fluids were vortexed and centrifuged at 650 × g for 10 min at 4 ◦ C. A 30 ␮l volume of 100 mM phenylmethylsulfonyl fluoride (PMSF) (Sigma) was added to the supernatants before they were vortexed and spun at 27,000 × g for 20 min at 4 ◦ C. A further 20 ␮l of PMSF, 100 ␮l of fetal bovine serum (FBS), and 20 ␮l of 1% sodium azide (Sigma) were added to the supernatants before they were dispensed into aliquots and frozen. Lung lavage fluids were obtained post mortem by inserting a nylon cannulain to the exposed trachea, which was tied in place. A hypodermic needle and syringe were attached and used to inject and withdraw 0.7 ml of 2 mM PMSF in PBS three times. The fluid samples were retained on ice before centrifugation at 27,000 × g for 20 min at 4 ◦ C, and the supernatants were then stored in aliquots at −20 ◦ C. The vaginal fluids were obtained by washing the vagina three times with 0.5 ml of ice-cold saline containing protease inhibitors. Samples were centrifuged at 2500 × g for 20 min at 4 ◦ C, and the supernatants were stored at −20 ◦ C until they were analyzed. 2.6. ELISA Antibody titers in serum, fecal samples, lung lavage, intestinal lavage and vaginal fluids were determined by an enzyme-linked immunosorbent assay (ELISA) as previously described [22]. ELISA was performed three times for each serum sample. End point titers were defined as the maximum dilutions giving an A450 measurement of 0.1. This cutoff value represents the mean optical density plus 2 standard deviations of 10 normal mouse serum samples tested at 1:50 dilution. Statistical comparison was made using the Mann–Whitney U-test.

C.-H. Wei et al. / Vaccine 28 (2010) 4113–4118

4115

Fig. 2. Representative immunofluoresence images of control cells harboring pLA and recombinant L. casei cells expressing pgsA-K99. Bright-field images are shown on the left.

Fig. 1. Detection of pLA-K99 expressed in Lactobacillus casei by Western Blot with anti-K99 (a) and anti-pgsA (b) polyclonal antibodies. Lane 1 shows whole-cell lysates of standard-type (parental vector); lane 2 shows the recombinant L. casei. Protein bands of 59 kDa, corresponding to the expected size of pgsA-K99 were detected.

nificantly greater intensity of fluorescence signals than the control cells. This result is consistent with the data shown in Fig. 3. 3.2. Systemic and mucosal immunogenicities of hybrid proteins expressed on L. casei

2.7. K99 adhesive fimbriae challenge experiment The challenge experiment against intranasal or oral immunity was performed at when intranasal or oral immunity was at 3 week and 9 week after the last immunization, with 200 ␮l of C83912 which had a titer of 2 × 103 LD50 ml−1 (6 × 1011 CFU). Deaths were recorded and surviving mice were maintained for 20 days post challenged. The healthy mice without signs of diarrhea were judged protected. The difference in survival was calculated by the log rank test with SPSS software. 3. Results 3.1. Expression of pgsA-K99 fusion protein on the cell surface The pgsA-K99 fusion protein was analyzed by Western blotting. Fig. 1 shows the analysis of the whole-cell lysate of L. casei cells harboring the plasmid pLA-K99. The respective molecular sizes of the pgsA and ETEC K99 proteins were approximately 41 kDa and 18 kDa, therefore giving the pgsA-K99 fusion protein was an approximate size of 59 kDa. A clear band of the fusion protein was observed at the estimated molecular size, indicating the successful expression of the fusion protein. To determine cellular localization of the recombinant protein on the surface of L. casei was verified by immunofluorescence microscopy and flow cytometric analysis (Figs. 2 and 3, respectively). Immunofluorescence labeling of the cells was performed using mouse anti-K99 antibody as the primary antibody and FITCconjugated goat anti-mouse IgG as the secondary antibody. As shown in Fig. 2, the green fluorescence of the immunostained pgsA-K99 fusion protein was observed on L. casei cells harboring the plasmid pLA-K99, whereas cells harboring the control plasmid pLA were not immunostained. The results indicated that ETEC K99 was displayed on the cell surface of the recombinant L. casei cells. In most of the cells, green fluorescence was localized around the septa of cells (Fig. 2). Flow cytometry was used to quantitatively analyze the cell surface display of ETEC K99 (Fig. 3). The cell surfacedisplayed pgsA-K99 was stained with the primary and secondary antibodies that are similar to those used for immunofluorescence, and L. casei cells harboring the plasmid pLA were used as a control for flow cytometry. The cells displaying pgsA-K99 showed a sig-

In order to characterize the immunogenicity of ETEC K99 surface-displayed on L. casei, BALB/c mice (45 per group in 4 groups) were orally or intranasally administrated with 5 × 109 cells/dose or 2 × 109 cells/dose of the recombinant live L. casei. L. casei harboring the parental plasmid pLA was used as a negative control. Serum samples were used for evaluating the systemic immune response by indirect ELISA. During the first two series of immunization, very low levels of IgG against ETEC K99 were detected (Fig. 4a, day 14). Higher IgG levels were detected shortly after the third immunization (day 28, p < 0.01). After the fourth immunization, further increase in IgG titer was observed (day 56, p < 0.01). Similar antibody response pattern was observed for intranasal and oral immunizations. At the end of immunization, the mean serum IgG titers in both experimental groups were over 1000 times higher than those in the control groups. There were no significant differences in the antibody titers between the oral- and intranasal-inoculation groups.

Fig. 3. Fluorescence-activated cell sorter histograms of control cells harboring pLA (filled) and recombinant (open) L. casei cells. The cells were probed with mouse antiK99 polyclonal antibodies, followed by biotin-conjugated anti-mouse IgG antibody and fluorescein isothiocyanate-conjugated streptavidin.

4116

C.-H. Wei et al. / Vaccine 28 (2010) 4113–4118

Fig. 4. Systemic anti-K99 response following mucosal immunization. Groups of 45 mice were immunized orally (rhombus) or intranasally (square) with pLA-K99/L. casei. Control sera were derived from vaccinated mice with parental plasmid pLA. (a) Kinetics of anti-K99 serum IgG response. ELISA was performed in triplicates using purified fimbriae peptides, and titers are defined as the reciprocal of the maximum dilution of sera yielding an absorbance equal to that of pre-immune samples. (b) Isotype profiles of anti-K99 serum antibodies. Serum samples collected on day 84 post immunization were used. End point titers were calculated as the reciprocals of serum dilutions yielding the same optical density as the 1/50 dilution of pooled pre-immune sera. The data are presented as means ± standard deviations. Statistical comparisons between groups were made by the Mann–Whitney U-test.

To better characterize antibody responses against K99 protein fragments, the levels of antigen-specific IgG subclasses (IgG1, IgG2a, IgG2b, and IgG3) and other antibody isotypes (IgA and IgM) were assessed by indirect ELISA. Pooled immune sera collected on day 84 after the first inoculation were used. Both intranasally and orally immunized mice developed K99 protein-specific antibodies that were predominantly IgG1 and IgG2a, with moderate levels of IgG2b (Fig. 4b). The mean titers of these subtypes were significantly different from the baseline titers in the control group (p < 0.01). In contrast, no significant differences were observed for IgA and IgM isotypes. To assess mucosal immune responses, K99-specific IgA levels in intestinal, vaginal and bronchoalveolar lavage fluids were determined by indirect ELISA. Fluids collected on days 56, 70 and 84 after the first inoculation was examined using purified fimbriae peptides. Both intranasal and oral immunizations elicited K99-specific

Fig. 5. Anti-K99 mucosal IgA antibody responses. Intestinal, vaginal and lung lavage fluids, harvested from mice sacrificed 56, 70 or 84 days post immunization, were analyzed by ELISA in triplicates. Absorbance 450 nm of samples from animals immunized orally (a) or intranasally (b) are shown. Fluids from control animals are shown as white bars. The error bars represent standard deviations.

mucosal IgA responses at the site of inoculation, as well as the remote mucosal site (Figs. 5 and 6). The fecal IgA was showed lower level than that of intestinal lavages. The reason may be IgA level in fecal could not accurately reflect the level in intestine, but both of

Fig. 6. Anti-K99 mucosal IgA antibody responses. Fecal samples collected every week post immunization were analyzed by ELISA in triplicates. Absorbance 450 nm of samples from animals immunized orally (rhombus) or intranasally (square) and control animals (triangle) are shown. The error bars represent standard deviations.

C.-H. Wei et al. / Vaccine 28 (2010) 4113–4118

4117

(data not showed). More than 90% of immunized mice survived regardless of the immune route. In order to prove that protection of mice was due to specific immunity and not to a nonspecific cellular immune response mediated by the presence of the vaccine strain in the host organs, the same experiment with a longer time interval between the last booster immunization and the challenge was repeated. Groups of 12 mice vaccinated as described above were orally challenged with 2 × 103 LD50 of C83912 on day 114 (9 week after the vaccine strain had been cleared from the immunized mice). More than 80% of immunized mice survived regardless of the immune route (Fig. 7b). The systemic antibody responses elicited via mucosal routes were therefore protected. 4. Discussion

Fig. 7. Survival of BALB/c mice immunized with pLA-K99/L. casei following a subsequent challenge with the parental standard-type strain. Survival of immunized mice is represented with solid lines, while that of control mice is shown with dashed lines. (a) Twelve mice per group were challenged orally with 6 × 1011 CFU of C83912 on day 75. (b) Twelve mice per group were challenged orally with 6 × 1011 CFU of C83912 on day 114. More than 80% survived after challenged with C83912 (2 × 103 LD50 ), 100% mortality were observed for the group immunized with a control pLA/L. casei (group 1: oral vaccinated; group 2: oral control; group 3: intranasal control; group 4: intranasal vaccinated).

them had the similar trend. Not surprisingly, greater antibody titers were detected at the locality of immunization. In contrast, only background levels of antibodies were detected in control animals. 3.3. Efficacy of the ETEC K99 fimbriae protein expressed in the recombinant live L. casei On day 75 (3 week after the last booster immunization) 12 immunized mice per group were orally challenged with 2 × 103 LD50 (6 × 1011 CFU) of C83912. The post infection survival rates of vaccinated and naive mice are compared in Fig. 7a. While 100% of control mice died after challenge with the C83912 strain. All the mice developed diarrhea in the control group after challenged. These died animals were dissected and the intestines appeared severe pathologic changes, which the E. coli C83912 were isolated

With many pathogens, the initial infection occurs mainly at the mucosal tissues. Therefore, it is important to develop vaccines that elicit protective immune responses to prevent the infection and replication of the pathogens at the mucosa via mucosal immunization [25]. The use of lactic acid bacteria as a live vehicle for the delivery of antigens for mucosal immunization or other therapeutic molecules has been proposed. However, only a few systems have been described previously as using L. casei strains as a carrier for expressing heterologous bacterial antigens in a form that can be presented to and processed by the immune system of the mammalian host [26–29]. In this study, the results indicated that L. casei harboring pLA did not show the antigenic properties, but L. casei harboring pLA-K99 could be recognized by specific antiserum. Furthermore, the recombinant plasmid pLA-K99 in L. casei has good segregational and structural stability without showing any structural rearrangement. IgA is the predominant antibody at the mucosal surface, as it is produced locally at a level that exceeds all of the other immunoglobulins [30,31]. Therefore, an efficient ETEC oral vaccine will have to induce a specific mucosal IgA response. We evaluated the immunogenicity of pLA-K99 by using BALB/c mice as an animal model. The recombinant pLA-K99/L. casei was shown elicit both mucosal and systemic immune responses after oral or intranasal administration. Oral immunization was more effective in eliciting protective immunity than the intranasal route. There may be three possible reasons to explain this phenomenon. Firstly, the challenge route is oral administration, the specific mucosal IgA can prevent colonization of ETEC in the small intestine, but K99-specific IgA levels in intestinal fluids following intranasally immunization were lower than those following orally immunization. Secondly, a higher dose of L. casei was administered for oral immunization (5 × 109 versus 2 × 109 organisms). Thirdly, the immunization schedules, which were optimized for each route, were slightly different. For oral immunization, animals were immunized for five consecutive days during the third and fourth immunization periods (days 21 to 25 and 49 to 53). In contrast, animals were immunized nasally only once on days 21 and 49. However, these differences in the immunization regimen do not fully explain the disparity in the protective immunity levels since similar, if not greater, levels of serum antibodies were detected using ELISA in intranasally immunized animals than that in those immunized orally (Fig. 4). An alternative explanation could be that the antigens are processed and/or presented differently to immune cells in the two mucosal compartments. Protective immunity against ETEC depends mainly on the induction of secretory IgA antibody response at the lumen of the small intestine, a Th2-dependent immune response [32,33]. The results clearly demonstrate that oral immunization of BALB/c mice with the pLA-K99/L. casei, was sufficient to elicit elevated IgA responses in serum and mucosal tissues as well as increases in systemic IgG

4118

C.-H. Wei et al. / Vaccine 28 (2010) 4113–4118

antibody responses to the ETEC K99 fimbriae. In the present study, mucosal antibody responses elicited by L. casei immunization were investigated over a time course of 28 days in order to determine whether mucosal antibody responses could be detected at more than one mucosal site and also to discover if such responses were sustained or merely transient. While we observed increase in IgG2a and IgG2b antibody responses in serum, dramatic increase in IgG1 K99 fimbriae specific antibody titers were also noted. IgG1 and IgG2a seem to play an important role in neutralization of exotoxins produced by ETEC K99 like neutralization of exotoxins produced by C. diphtheriae and Clostridium tetani [34]. This observation would suggest that T helper 2 (Th2) cell mechanisms may be contributing to this immune response. This idea of Th2-type involvement is further suggested by the sustained increases in IgA antibody responses. Thus, oral or intranasal administration of recombinant L. casei displaying ETEC K99 antigens on the surface induced both systemic and mucosal immune responses against the ETEC fimbriae. In conclusion, we have demonstrated that ETEC K99 fimbriae protein exposed on the surface of non-pathogenic strain L. casei that resists gastric acidity, and delivered orally to animals, elicits both systemic and mucosal immune responses. An ideal multipurpose recombinant vaccine vehicle should be capable of inducing systemic responses relevant for protection against a variety of pathogens and should also elicit IgA at mucosal surfaces to prevent the entry of pathogens into the body. We and others have shown that L. casei has the potential to act as an effective mucosal delivery system for bacterial and viral antigens. The present study also shows that L. casei immunization induces mixed IgG subclass and T-helper responses, allowing the induction of protection against a variety of infectious agents and potentially at several mucosal surfaces. However, before recombinant LAB can be used in humans, it is necessary to increase the potency of this system (i.e., to obtain high-level antibody responses to a variety of antigens with fewer doses) and to demonstrate protective-level immune responses in different animal models. It is also necessary to construct strains for human or animal that will meet the safety requirements of the regulatory bodies. The existing food grade expression systems should be further developed for this purpose [35]. Acknowledgements This project was supported by Ministry of Human Resources and Social Security of the People’s Republic of China (returnee project) and the 11th Five-Year-Plan in Key Science and Technology Research of agricultural bureau in Heilongjiang province of China (HNKXIV08-06-03, HNKXIV-08-07) and the Key Science and Technology Research of Daqing in Heilongjiang province, China (SGG2006-011). References [1] Moon HW. Mechanisms in the pathogenesis of diarrhea: a review. J Am Vet Med Assoc 1978;172(4):443–8. [2] Gaastra W, de Graaf FK. Host-specific fimbrial adhesions of noninvasive enterotoxigenic Escherichia coli strains. Microbiol Rev 1982;46:129–61. [3] Guinee PAM, Jansen WH, Agterberg CM. Detection of the K99 antigen by means of agglutination and immunoelectrophoresis in Escherichia coli isolates from calves and its correlation with enterotoxigenicity. Infect Immun 1976;13:1369–77. [4] Moon HW, Bunn TO. Vaccines for preparing enterotoxigenic Escherichia coli infections in farm animals. Vaccine 1993;11:213–9. [5] Acres SD, Isaacson RE, Babiuk LA, Kapitany RA. Immunization of calves against enterotoxigenic colibacillosis by vaccinating dams with purified K99 antigen and whole-cell bacterins. Infect Immun 1979;25:121–6. [6] Evans DG, Graham DY, Evans Jr DJ. Administration of purified colonization factor antigens (CFA/I, CFA/II) of enterotoxigenic Escherichia coli to volunteers. Response to challenge with virulent enterotoxigenic Escherichia coli. Gastroenterology 1984;87:934–40. [7] Nagy B. Vaccination of cows with a K99 extract to protect newborn Calves against experimental enterotoxic colibacillosis. Infect Immun 1980;27:21–4.

[8] Eriksson K, Holmgren J. Recent advances in mucosal vaccines and adjuvants. Curr Opin Immunol 2002;14:666–72. [9] Brandtzaeg P. Role of secretory antibodies in the defence against infections. Int J Med Microbiol 2003;293:3–15. [10] Michetti PM, Mahan J, Slauch JM, Mekalanos JJ, Neutra MR. Monoclonal secretory immunoglobulin A protects mice against oral challenge with the invasive pathogen Salmonella typhimurium. Infect Immun 1992;60:1786–92. [11] Taylor HP, Dimmock NJ. Mechanism of neutralization of influenza virus by secretory IgA is different from that of monomeric IgA or IgG. J Exp Med 1985;161:198–209. [12] Winner 3rd L, Mack J, Weltzin R, Mekalanos JJ, Kraehenbuhl JP, Neutra MR. New model for analysis of mucosal immunity: intestinal secretion of specific monoclonal immunoglobulin A from hybridoma tumors protects against Vibrio cholerae infection. Infect Immun 1991;59:977–82. [13] Friedman RS, Frankel FR, Xu Z, Lieberman J. Induction of human immunodeficiency virus (HIV)-specific CD8+ T-cell responses by Listeria monocytogenes and a hyperattenuated Listeria strain engineered to express HIV antigens. J Virol 2000;74:9987–93. [14] Lee JS, Shin KS, Pan JG, Kim CJ. Surface-displayed viral antigens on Salmonella carrier vaccine. Nat Biotechnol 2000;18(6):645–8. [15] Shata MT, Hone DM. Vaccination with a Shigella DNA vaccine vector induces antigen-specific CD8+ T cells and antiviral protective immunity. J Virol 2001;75:9665–70. [16] Shata MT, Reitz MS, DeVico AL, Lewis GK, Hone DM. Mucosal and systemic HIV-1 Env-specific CD8+ T-cells develop after intragastric vaccination with a Salmonella Env DNA vaccine vector. Vaccine 2001;20:623–9. [17] Mannam P, Jones KF, Geller BL. Mucosal vaccine made from live, recombinant Lactococcus lactis protects mice against pharyngeal infection with Streptococcus pyogenes. Infect Immun 2004;72:3444–50. [18] Robinson K, Chamberlain LM, Schofield KM, Wells JM, Le Page RWF. Oral vaccination of mice against tetanus with recombinant Lactococcus lactis. Nat Biotechnol 1997;15:653–7. [19] Seegers JF. Lactobacilli as live vaccine delivery vectors: progress and prospects. Trends Biotechnol 2002;20:508–15. [20] Shaw DM, Gaerthe B, Leer RJ, Van der Stap JG, Smittenaar C, Heijne den BakGlashouwer M, et al. Engineering the microflora to vaccinate the mucosa: serum immunoglobulin G responses and activated draining cervical lymph nodes following mucosal application of tetanus toxin fragment C-expressing lactobacilli. Immunology 2000;100:510–8. [21] Ashiuchi M, Nawa C, Kamei T, Song JJ, Hong SP, Sung MH, et al. Physiological and biochemical characteristics of poly gamma-glutamate synthetase complex of Bacillus subtilis. Eur J Biochem 2001;268(20):5321–8. [22] Lee JS, Poo H, Han DP, Hong SP, Kim K, Cho MW, et al. Mucosal immunization with surface-displayed severe acute respiratory syndrome coronavirus spike protein on Lactobacillus casei induces neutralizing antibodies in mice. J Virol 2006;80(8):4079–87. [23] Hou XL, Yu LY, Liu JZ, Wang GH. Surface-displayed porcine epidemic diarrhea viral (PEDV) antigens on lactic acid bacteria. Vaccine 2007;26:24–31. [24] Wu HY, Russell MW. Induction of mucosal immunity by intranasal application of a streptococcal surface protein antigen with the cholera toxin B subunit. Infect Immun 1993;61:314–22. [25] Medina E, Guzman CA. Use of live bacterial vaccine vectors for antigen delivery: potential and limitation. Vaccine 2001;19:1573–80. [26] Grangette C, Muller-Alouf H, Goudercourt D, Geoffroy MC, Turneer M, Mercenier A. Mucosal immune responses and protection against tetanus toxin after intranasal immunization with recombinant Lactobacillus plantarum. Infect Immun 2001;69:1547–53. [27] Pouwels PH, Leer RJ, Boersma WJ. The potential of Lactobacillus as a carrier for oral immunization: development and preliminary characterization of vector systems for targeted delivery of antigen. J Biotechnol 1996;44:183–92. [28] Reveneau N, Geoffroy MC, Locht C, Chagnaud P, Mercenier A. Comparison of the immune responses induced by local immunizations with recombinant Lactobacillus plantarum producing tetanus toxin fragment C in different cellular locations. Vaccine 2002;20:1769–77. [29] Scheppler L, Vogel M, Zuercher AW, Zuercher M, Germond JE, Miescher SM, et al. Recombinant Lactobacillus johnsonii as a mucosal vaccine delivery vehicle. Vaccine 2002;20:2913–20. [30] Brandtzaeg P. Distribution and characteristics of mucosal immunoglobulinproducing cells. In: Pearay OL, Metecky H, editors. Handbook of mucosal immunology. Boston, MA: Academic Press; 1994. p. 251–79. [31] Kilian M, Russel MW. Functions of mucosal immunoglobulins. In: Ogra PL, Mestecky J, Lamm ME, Strober W, McGhee JR, Bienenstock J, editors. Handbook of mucosal immunology. San Diego, CA: Academic Press; 1994. p. 127–43. [32] Murray PD, McKenzie DT, Swain SL, Kagnoff MF. Interleukin 5 and interleukin 4 produced by Peyer’s patch T cells selectively enhance immunoglobulin A expression. J Immunol 1987;139:2669–74. [33] Alves AM, Lasaro MO, Almeida DF, Ferreira LCS. Immunoglobulin G subclass responses in mice immunized with plasmid DNA encoding the CFA:I fimbria of enterotoxigenic Escherichia coli. Immunol Lett 1998;62:145–9. [34] Masanori I, Yoko Y, Satoshi K, Tooru T, Keiko M, Jun-ichi M, et al. Induction of systemic and mucosal antibody responses in mice immunized intranasally with aluminium-non-adsorbed diphtheria toxoid together with recombinant cholera toxin B subunit as an adjuvant. Vaccine 2000;18:743–51. [35] de Vos WM. Gene expression systems for lactic acid bacteria. Curr Opin Microbiol 1999;2:289–95.