Veterinary Immunology and Immunopathology 102 (2004) 379–388 www.elsevier.com/locate/vetimm
Immune responses in rainbow trout Oncorhynchus mykiss induced by a potential probiotic bacteria Lactobacillus rhamnosus JCM 1136 A. Panigrahia, V. Kirona,*, T. Kobayashib, J. Puangkaewa, S. Satoha, H. Sugitac a
Department of Marine Biosciences, Tokyo University of Marine Science and Technology, Minato, Tokyo 108-8477, Japan b Graduate School of Marine Science and Technology, Tokyo University of Marine Science and Technology, Minato, Tokyo 108-8477, Japan c Department of Marine Science and Resources, Nihon University, Fujisawa, Kanagawa 252-8510, Japan Received 23 December 2003; received in revised form 10 June 2004; accepted 3 August 2004
Abstract This study was undertaken to examine the effect of supplementing a suggested probiotic bacteria Lactobacillus rhamnosus JCM 1136 in feed on immune response and gut flora composition of rainbow trout Oncorhynchus mykiss. The probiotic bacteria were incorporated into a commercial feed to constitute two experimental diets containing either 109 or 1011 colony forming unit of live bacteria/g of feed while a third diet without the bacterial supplement served as the control diet. The diets were offered to rainbow trout (75 g average weight) in triplicate tanks for 30 days. Fish were sampled at 10, 20 and 30 days after commencement of the feeding trial to determine the proportion of the given probiont in the gut microflora composition and the nonspecific humoral and cellular immune responses on the 30th day. The relative proportion of the probiont increased with the feeding duration in the intestine, but not in the stomach. The proportion of L. rhamnosus in the stomach corresponded to the intake levels while no such relation existed in the intestine. The serum lysozyme and complement activities were significantly greater in fish fed the higher level of probiont compared with the control fish. The phagocytic activity of head kidney leucocytes also showed similar tendencies. These observations indicate the potential immuno-regulatory role of probiotic organisms in rainbow trout. # 2004 Elsevier B.V. All rights reserved. Keywords: Rainbow trout; Probiotic; Lactobacillus rhamnosus; Phagocytosis; Complement; Lysozyme
Abbreviations: ATCC, American Type Culture Collection; ANOVA, analysis of variance; BA, blood agar; dpf, days of probiotic feeding; 8C, degree centigrade; JCM, Japan Collection Of Microorganisms; LAB, lactic acid bacteria; MRS, Man Rogosa and shape; NBT, nitroblue tetrazolium; OD, optical density; g, times gravity; RaRBC, rabbit red blood cells; TSA, tryptic soy agar; PA, phagocytic activity; PI, phagocytic index * Corresponding author. Present address: Department of Fisheries and Natural Sciences, Bodø University College, N-8049 Bodø, Norway. Tel.: +47 755 17 399; fax: +47 755 17 349. E-mail address:
[email protected] (V. Kiron). 0165-2427/$ – see front matter # 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.vetimm.2004.08.006
380
A. Panigrahi et al. / Veterinary Immunology and Immunopathology 102 (2004) 379–388
1. Introduction Lactic acid bacteria (LAB) are gram positive, nonspore forming cocci or rods which produce lactic acid as their main metabolic product. The use of these potentially probiotic cultures stimulate the growth of preferred microorganisms, outcompetes potentially harmful bacteria, and reinforce the organism’s natural defense mechanisms. Furthermore, LAB have been found to exhibit a range of physiological, nutritional and therapeutic effects including immunomodulation (Gill, 1998), antibiotic resistance characteristics (Charteris et al., 1998) and other functional aspects like antagonistic and antimutagenic properties (Saarela et al., 2000). The introduction of a selected bacterial strain such as the LAB into the food chain or as diet supplementation has been proposed as an alternative mode of improving the health status. The role of LAB in inducing overall immunity has been extensively investigated and reviewed in endothermic animals (Jonsson and Conway, 1992; Salminen et al., 1996; Herich et al., 1999). The wide use of chemotherapeutic agents has lead to the occurrence of resistant bacteria in the aquatic environment (Smith et al., 1994). Hence the use of probiotics i.e., a live microbial feed supplement which benefit the host by modifying the host-associated or ambient microbial community, by enhancing the host response towards disease, by ensuring improved use of feed or enhancing its nutritional value, or by improving the quality of its ambient environment (Vershuere et al., 2000), in aquaculture is being encouraged. The exact mode of action of the probiotic bacteria has not been fully elucidated, nevertheless it is thought to produce inhibitory compounds, compete for chemicals or available energy, or for adhesion sites besides enhancing immune responses. Very little is known about the relative importance of these mechanisms and perhaps the reports of Villamil et al., 2002 and Rengpipat et al., 2000 are the only ones that have examined the immune responses in aquatic animals following probiotic supplementation. On the other hand, during the last decade the application of probiotics taking advantage of its pathogen control potential has been increasing in aquaculture. Sugita et al. (2002) suggested that about 1–10% of intestinal bacteria isolated from both marine and freshwater fish exhibit antibacterial activity against
fish pathogenic bacteria and can play a role in probiotic treatment of fish. Again, the dietary introduction of a probiotic bacteria Lactobacillus rhamnosus ATCC 53103 could reduce mortality of fish challenged with a virulent strain of Aeromonas salmonicida (Nikoskelainen et al., 2001a). In the present study, a different strain of the same species which is fit for human consumption is taken to elucidate the immune responses when included in the diets of fish. The study aimed to determine if certain innate immune functions of rainbow trout Oncorhynchus mykiss are influenced by the probiotic supplementation of L. rhamnosus JCM 1136 (=ATCC 7469). Concurrent observations were also made on the changes in the composition of the gut flora during and after the probiotic feeding.
2. Materials and methods 2.1. Bacterial procurement, growth and harvest A bacterial strain Lactobacillus rhamnosus JCM 1136, was obtained from Japan Collection of Microorganisms (JCM), Institute of Physical and Chemical Research (Riken), Japan. The bacterium was cultured in MRS broth (De Man et al., 1960) by cultivating for 48 h at 30 8C and subsequently preserved in 50% glycerol at 80 8C and kept as stab culture for further use. A pure colony was taken for inoculation of seed cultures of 50 ml each and incubated at 30 8C for 24 h before mass culture in MRS broth. After one day of culture, the bacteria were harvested by centrifuging at 16,500 g for 10 min and washing three times with sterile peptone water (NaCl, 0.85% and Polypeptone, 0.1%). 2.2. Probiotic supplementation Commercial rainbow trout feed (Nippon Formula Feed, Yokohama, Japan) was taken as the basal diet for the supplementation of probiont L. rhamnosus JCM 1136. The required amount of bacterial suspension was sprayed into the feed slowly, mixing part by part in a drum mixer, after which it was air dried under sterile conditions for 12 h. The probiotic feed was stored at 20 8C and the daily requirement was kept at
A. Panigrahi et al. / Veterinary Immunology and Immunopathology 102 (2004) 379–388
4 8C. The viability of the incorporated bacterial cells into feed was assessed by spreading onto triplicate plates of TSA (Becton, Dickinson and Company, Le Pont de Claix, France), MRS agar (MERCK, Darmastadt, Germany) and BA, blood agar (Nissui, Tokyo, Japan). The colony count was taken after incubation at 30 8C for 48 h. The bacterial count of the feed was taken at this point and twice during the trial and averaged 2.45 109 and 1.07 1011 CFU g 1 (taken as 109 and 1011 CFU g 1 for the study); henceforth referred to as low density feed (low LAB) and high density feed (high LAB) respectively. The commercial feed sprayed with sterilized diluent alone served as the control diet. 2.3. Feeding trial The feeding experiment was conducted in 60 l tanks arranged in a flow-through system, each treatment in triplicate. Each tank was stocked with 15 juvenile rainbow trout (average weight = 75 g), that had been reared on a commercial pellet ration. The fish were fed on the control and the two probiotic feeds, two times daily until satiation, for a period of 30 days. 2.4. Microbiological aspects 2.4.1. Bacterial counts The bacterial count of the rearing water was taken 1 h after feeding, for several times, to determine the total plate count (TPC) and LAB count employing TSA for former and BA and MRS media for the later respectively. The stomach and anterior portion of intestine of the experimental fish was sampled after being anesthetized with 300 ppm 2-phenoxy ethanol (Wako Pure Chemical Industries Ltd., Osaka, Japan) initially and at 10, 20 and 30 days of probiotic feeding (dpf) for analyzing the total bacterial count and the probiont count. The bacterial identification was primarily based on colony and cell morphology, Gram staining and biochemical characteristics. It was further confirmed through the polymerase chain reaction (PCR) as described below and biochemical testing using API 50 CH strips (BioMerieux, Marcyl’Etoile, France). The inoculation of API 50 CH strips was performed
381
according to manufacturer’s instructions and incubated at 30 8C. 2.4.2. Identification of the LAB by species-specific PCR In order to confirm whether the probiotic strain delivered through the feed was recovered in the gut, feces or water, the respective cultures were identified based on the rRNA genes as described by Amann et al. (1995). Specific identification of L. rhamnosus JCM 1136 was carried out by direct amplification of 20–30 colonies randomly selected from the MRS plates within 30–300 colonies. The oligonucleotide primer taken for this study was the one described by Song et al. (2000) with a forward primer CTAGCGGGTGCGACTTTGTT and a reverse primer GCGATGCGAATTTCTATTATT procured from Invitrogen Life Technology (Tokyo, Japan). The PCR was carried out on a PC 707 PCR thermal cycler (ASTEC, Fukuoka, Japan). The ratio between the number of colonies, which gave positive amplicons with these strain specific primers, and the total number of colonies analyzed by PCR was calculated and related to the number of LAB colonies on that plate. 2.5. Immunological aspects 2.5.1. Sample preparation Sampling was scheduled after 30 days of probiotic treatment. A total of eight fish were taken from each treatment for blood samples after a 24 h starvation period. Blood was drawn from the caudal vein of individual fish after anesthetizing as described before. The plasma and serum samples were separated using standard procedures and stored at 80 8C prior to analysis. The plasma samples were used for total immunoglobulin analysis and the serum samples for determining lysozyme and alternative complement activity. To collect leucocytes from head kidney, the organ was aseptically removed from the fish and the cells were separated and enriched according to the techniques of Chung and Secombes (1988). The macrophage-rich cell suspension was adjusted to 2 106 and 2 107 cell ml 1 in L-15 medium (Leibovitz; Sigma-Aldrich, Tokyo, Japan) penicillin-streptomycin solution (P/S; Sigma) for assaying phagocytosis and superoxide production, respectively.
382
A. Panigrahi et al. / Veterinary Immunology and Immunopathology 102 (2004) 379–388
2.5.2. Cellular assays 2.5.2.1. Phagocytosis. Phagocytic activity (PA) of leucocytes was determined as described by Puangkaew et al. (2004). Briefly, a 300 ml volume of the leucocyte suspension in L-15 medium (SigmaAldrich) containing 2 106 cell ml 1 was seeded into duplicate chambers of an eight chamber slide (Lab-Tek Nalge Nunc International Co. Ltd., Illinois, USA). The cells were incubated at 15 8C for 2 h and the non-adherent cells were removed by careful washing with L-15 medium. The cells were further incubated for 1 h at 15 8C after adding 300 ml of fluorescent latex beads (2 mm; Sigma) to each chamber to maintain the cells to beads ratio of 1: 10. The latex beads were opsonised by incubating 2 107 cells ml 1 with the serum of the corresponding fish. After adequate washing, the cells were fixed with methyl alcohol and stained with Diff Quick solution (Kokusai Shiyaku Co. Ltd., Hyougo, Japan). The PA was expressed as the percentage of phagocytising cells quantified from 300 adherent cells observed under a microscope. The phagocytic index (PI) was expressed as the average number of particle beads ingested by each phagocytic cell.
obtained by lysing of 100 ml of RaRBC with 3.4 ml of distilled water and measuring the optical density of haemolysate at 414 nm against distilled water. The test serum was appropriately diluted and different volumes ranging from 0.1 to 0.25 ml were made up to 0.25 ml total volume before being allowed to react with 0.1 ml of RaRBC in test tubes. After incubation at 20 8C for 90 min with occasional shaking, 3.15 ml of a saline solution was added to each tube and were centrifuged at 1600 g for 10 min at 4 8C. The optical density of the supernatant was measured at 414 nm using a DU 640 spectrophotometer (Beckman Instruments Inc., California, USA). A lysis curve was obtained by plotting the percentage of haemolysis against the volume of serum added. The volume yielding 50% haemolysis was determined and in turn used for assaying the complement activity of the sample (ACH50 value = units ml 1).
2.5.2.2. Superoxide anion production. The superoxide anion production (O2 ) by the head kidney leucocytes was determined as the reduction of nitroblue tetrazolium (NBT) following the method described by Puangkaew et al. (2004). In brief, 15 ml of 2 107 cell ml 1 isolated leucocytes were mixed with 15 ml of L-15 containing 1 mg ml 1 NBT (Sigma) and 5 mg ml 1 zymosan (Sigma). After incubation for 1 h at 15 8C, 400 ml of N,N- dimethylformamide (Wako) was added and the tubes centrifuged at 3000 g for 10 min at 4 8C. The optical density of the supernatant was measured at 540 nm with a Multiskan microplate reader (Labsystems Oy, Helsinki, Finland).
2.5.3.2. Lysozyme activity. Lysozyme activity in serum was determined according to the method of Demers and Bayne (1997) based on the lysis of the lysozyme sensitive Gram positive bacterium, Micrococcus lysodeikticus (Sigma). The dilutions of hen egg white lysozyme (Sigma) ranging from 0–20 mg ml 1 (in 0.1 M phosphate citrate buffer, pH 5.8) were taken as the standard. This along with the undiluted serum sample (25 ml) was placed into wells of a 96-well plate in triplicate. One hundred and seventyfive microlitres of M. lysodeikticus suspension (75 mg ml 1) prepared in the same buffer was then added to each well. After rapid mixing, the change in turbidity was measured every 30 s for 5 min at 450 nm at approximately 20 8C using a microplate reader. With the help of a computer application software, Delta SOFT 3 (Biometalics Inc., New Jersey, USA) the equivalent unit of activity of the sample as compared to the standard were determined and expressed as mg ml 1 serum.
2.5.3. Humoral assays 2.5.3.1. Alternative complement activity. The complement activity (alternate pathway) was assayed following the procedure of Yano (1992) by using rabbit red blood cells (RaRBC). Briefly, the RaRBC were washed and adjusted to 2 108 cell ml 1 in 0.01 M ethylene glycol tetraacetic acid–magnesium– gelatin veronal buffer. The 100% lysis value was
2.5.3.3. Total immunoglobulin. Plasma total Ig was analyzed as per the method of Siwicki and Anderson (1993). Briefly, the total protein content in plasma was measured using a micro protein determination method (C-690; Sigma), prior to and after precipitating down the Ig molecules employing a 12% solution of polyethylene glycol (Sigma). The difference in protein content gave the Ig content.
A. Panigrahi et al. / Veterinary Immunology and Immunopathology 102 (2004) 379–388
2.6. Statistical analysis
383
bacterial count in water ranged from 32 to 97% (Table 1).
One way analysis of variance (ANOVA; SYSTAT 8.0 software, SPSS Inc., Chicago, IL, USA) was used to determine whether significant variation between the treatments existed. Differences between means were determined and compared by Tukey’s test. All tests used a significance level of P = 0.05.
3. Results 3.1. General observation The experimental fish exhibited normal behavior under both the low and high densities of probiotic feeding. After acclimatization, acceptance of the probiotic feed was as good as that of the control feed. The GRAS (generally regarded as safe) nature of this bacterial strain was evident since no deleterious effects including mortality occurred during the course of the experiment, even when L. rhamnosus were fed at the high level of 1011 CFU g 1. Longevity of probiotics in the digestive tract was for only few days after the withdrawal of the experimental feed. In the span of a week very few members of this strain were traced in the intestine and they disappeared completely by the end of the second week.
3.2.2. Intestine The LAB offered in the feed could be traced in good numbers in the intestine and it ranged from 1.2 106 to 3.0 107 CFU g 1 at 10 dpf and 7.2 106 to 2.0 108 CFU g 1 at 20 dpf and from 3.8 107 to 3.9 108 CFU g 1 at 30 dpf for the low density group. Similarly, for the high density group it was 1.7 107 to 2.4 108, 8.8 106 to 6.1 107 and 3.6 108 to 9.4 108 CFU g 1 at 10, 20 and 30 dpf, respectively. The proportion of LAB increased with feeding (Fig. 1a). However, the level of probiont in feed had no clear influence over the settling rates of LAB in the intestine. 3.2.3. Stomach The LAB and TP count of the stomach ranged from 3.6 105 to2.8 107 CFU g 1 at10 dpfand1.5 106 to 3.0 107 CFU g 1 at 20 dpf and from 4.6 106 to 1.9 107 CFU g 1 at 30 dpf in the low density fed group. Similarly, for the high density group it was 6.9 107 to 2.7 109, 1.4 109 to 2.7 109 and 8.1 107 to 1.9 109 CFU g 1 at 10, 20 and 30 dpf, respectively. The proportion of LAB in the stomach contents generally corresponded to the level of probiont offered in the feed, but the counts did not indicate any relationship to the number of feeding days (Fig. 1b).
3.2. Microbiological aspects
3.3. Cellular immunological responses
3.2.1. Ambient water The density of L. rhamnosus in the rearing water reflected the probiotic level in the feed with the maximum level below within 105 CFU ml 1. No L. rhamnosus was detected in the ambient water of the control tanks and the total load in the control tank was also less compared to that of the probiotic tanks. The proportion of given probiont in the total
3.3.1. Phagocytosis After one month of feeding the control diet no significant effect on the PA of head kidney leucocytes was seen. Comparing the three treatments, the PA of the groups fed with high and low density of probiont was significantly greater (P < 0.05) than that of control group. However, between the levels of probiotic feeding, there was no significant difference
Table 1 Range of the total bacterial count and the LAB count in the rearing water during the feeding term (CFU ml 1) Treatments
Control (103)
Low LAB (103)
High LAB (104)
Total bacterial counta LAB counta
0.827 0.516 Nd
1.790 0.861 1.741 0.860
1.907 0.780 1.80 0.671
Nd = not detected. a Mean S.D.
384
A. Panigrahi et al. / Veterinary Immunology and Immunopathology 102 (2004) 379–388
Fig. 1. Proportion of L. rhamnosus among the total intestinal flora (a) and the total stomach flora (b) of rainbow trout after being fed two levels (low LAB, high LAB) of probiont L. rhamnosus (JCM 1136) for 10, 20 and 30 days respectively. The sampling was scheduled 18h after offering the last ration for each term.
in the rate of phagocytosis (Fig. 2). On the other hand, the PI of the probiotic fed and control group did not show a difference and the mean number of beads ingested by phagocytic cells were 4.49 0.42, 4.48
0.3 and 4.71 1.3 respectively for the control, low LAB and high LAB groups. 3.3.2. Super oxide anion production Super oxide anion production (OD 540 nm 102) ranged from 4.7 to 6.0 in the control group while the values were 5.7 to 8.4 in the low density group and between 4.4 and 7.7 in the high density group. The differences between the groups were not statistically significant (P > 0.05). 3.4. Humoral immunological response
Fig. 2. Phagocytic activity of the head kidneyleucocytes from rainbow trout fed on a low (low LAB) and a high (high LAB) density of L. rhamnosus and a control diet for 30 days. Data shown as mean with standard deviation as error bars; significant difference (P < 0.05) between groups is indicated by unlike letters on the bars (n = 6).
3.4.1. Complement activity The alternative complement activity (ACH 50) in the serum was found to be significantly (P < 0.05) greater in the high LAB fed group but only marginally enhanced in low LAB group compared with that of the control group (Fig. 3a).
A. Panigrahi et al. / Veterinary Immunology and Immunopathology 102 (2004) 379–388
Fig. 3. Serum alternative complement activity (ACH 50; a), serum lysozyme activity (b) and plasma Ig level (c) of rainbow trout fed on a low (low LAB) and high (high LAB) density of L. rhamnosus and a control diet for 30 days. Data shown as mean with standard deviation as error bars; significant difference (P < 0.05) between groups is indicated by unlike letters on the bars (n = 8).
3.4.2. Lysozyme activity The serum lysozyme activity was higher in the fish groups fed the probiont for 30 days, but a significant change (P < 0.05) was recorded only when the bacterial density was high (Fig. 3b). 3.4.3. Immunoglobulin level After 30 days of feeding, the plasma total Ig level in the LAB fed fish was found to be higher compared to the control fish (Fig. 3c). However, there was no significant difference (P > 0.05) between the treatments.
4. Discussion Prior to probiotic feeding, L. rhamnosus were not detected in the stomach or intestine of rainbow trout, or in the rearing water. The relative proportion of L. rhamnosus in the intestinal flora of rainbow trout
385
fed LAB containing diets increased with the feeding span using both the densities, implying that the intestine tends to harbor greater number of the probionts. However, this proportion is a function of the total flora which can change dynamically in aquatic animals. With the increase in the level of probiotics in feed, the proportion did not vary in the intestine. Most microbes are transient in aquatic animals, unlike the constant habitat and resident flora in the gastrointestinal tract of man and terrestrial livestock. Being poikilothermic, change in temperature may be one of the primary factors influencing the microbiota of fish (Lesel, 1990). Similarly salinity and osmotic balance can also influence the microflora of aquatic animals (Ringo and Strom, 1994). In contrast, the stomach did not show any trend in the relative proportion of L. rhamnosus found with duration of feeding. The stomach environment may not be suitable for the probiont to settle and grow. However, the greater number of probiont in the diet gets reflected in stomach. The probiotic strain employed in this study is acid and bile tolerant as it survives passage through the gastrointestinal tract and possibly remains both in the intestinal and other mucosal surface of the fish. Since the given probiont was isolated from fecal material, this indicates that the strain could persist throughout the GI tract and is low pH and bile resistant. Nikoskelainen et al. (2001b) has characterized L. rhamnosus ATCC 53103 and L. bulgaricus as better probionts based on the mucus adhesion, mucus penetration, bile resistance and suppression of fish pathogen growth. The population level of probiotic organism recorded in the intestine in the present study is in agreement with the previous studies by Gildberg and Mikkelsen (1998) and Robertson et al. (2000). The introduction of freeze-dried C. divergens into the diet resulted in high number of this strain in the intestine of Atlantic salmon, which upon challenge was outnumbered by A. salmonicida, but re-established again when the infection pressure declined (Gildberg et al., 1995). In the present study the L. rhamnosus was found to persist up to 7 days after withdrawal of the LAB containing diets though the numbers were drastically reduced (data not shown). However, 2 weeks after withdrawal of the probiotic feed, the L. rhamnosus could not be traced in the stomach and intestine samples. It has been suggested that Carno-
386
A. Panigrahi et al. / Veterinary Immunology and Immunopathology 102 (2004) 379–388
bacterium sp. may multiply in the gut of rainbow trout juveniles fed pellets impregnated with it, and its persistance was confirmed three days after withdrawal of the probiotic feed. Strains isolated from the turbot Scophthalmus maximus intestine showed greater capacity for adhesion and growth in fish intestinal mucus than did the pathogen and again the bacteria isolated from skin were found to be poorly adhesive (Olsson et al., 1992). Although some trend in the intestinal colonization was observed with respect to the feeding span, considering the dynamic gut environment and constraints of in vivo studies in aquatic animals, it can be said that the influence of these LAB on intestinal bacteria is poorly understood. Since the impact of the introduced microorganisms on the composition of gut micro flora forms the basis of the probiotic concept and determines its effect, these aspects deserve further attention. Despite many reports (Gill, 1998; Tannock, 1997; Pouwels et al., 1998), the stimulation of the immune system by probiotic LAB has not been clearly explained in higher vertebrates. In fish little has been done in terms of studying, how the immune system is affected upon probiotic stimulation. The Lactobacillus strain adopted for this study succeeded in improving certain immunological parameters compared to the control fish. For example, a higher percentage of cells were phagocytic in the probiotic fed group compared to that of the control, indicating that an enhanced response could be envisaged against pathogenic microorganisms. This is in general agreement with the previous study of Nikoskelainen et al. (2001a) that protection for rainbow trout against furunculosis is achieved by a similar probiont fed for 51 days. Probiotics have been shown to activate macrophages in mice (Perdigon et al., 1986, 1988) and man (Schiffrin et al., 1997). They also enhance humoral immune responses to some specific antigens (Perdigon et al., 1990; Yasui et al., 1992; Majamaa et al., 1995). Many studies in fish have shown that phagocytosis spreading and respiratory burst activity increases in vitro by the addition of substances such as glucan, muramyl dipeptide and mitogens (Chung and Secombes, 1988), but the present paper is one of the few reports showing an effect in response to probiotic feeding. Since a difference in activity between the two LAB densities was not recorded, potentially the low density of the
probiont would be sufficient to elicit the phagocytic abilities of the leucocytes. As immunomodulators, probionts may enhance phagocytic activity and increase the production of reactive oxygen metabolites by macrophages. Superoxide anion along with hydroxyl radicals and nitric oxides are induced reactive oxygen species, which are associated with enhanced microbial killing capacity of macrophages. However, in the present study no significant effect in the oxidative burst capacity of the head kidney leucocytes of the probiotic fed fish could be observed, but for a marginal increment. The complement system may have effector mechanisms like direct killing of microorganisms by lysis, opsonization of microorganisms by phagocytosis, chemotactic attraction to the site of inflammation and activation of leucocytes, processing of immune complexes and induction of specific antibody responses by augmentation of the localization of antigens to B lymphocytes and antigen presenting cells. In the present study, the activation of alternative pathway of complement system in the high LAB group may be attributed to the supplemented probionts, confirming the benefit for the non-specific innate immunity of this fish. Lysozyme, being an enzyme with antibacterial activity, can split peptidoglycan in bacterial cell walls especially of the gram positive species and can cause lysis of the cells (Chipman and Sharon, 1969). Lysozyme concentrations in fish have been reported to increase after injection of a bacterial product (Chen et al., 1996) and in response to bacterial infection (Moyner et al., 1993). Fletcher and White (1976) reported increased value of lysozyme with activation of immune system. Modulation of lysozyme activity in fish related to a probiont has not been reported yet. In the present study both the LAB fed groups showed elevated level of lysozyme activity, but the group receiving the higher density was observed to have significantly higher lysozyme activity compared to that of the control indicating activation of the immune system. Immunoglobulins are well recognized to provide disease protection in animals and human beings and some studies have also shown the effect of lactic acid bacteria on enhancing factors like Ig. Krieg et al. (1995) reported proliferation of murine B-cell and Ig secretion in vitro and in vivo by bacterial DNA and
A. Panigrahi et al. / Veterinary Immunology and Immunopathology 102 (2004) 379–388
synthetic oligonucleotides. The oral administration of lactic acid bacteria has been found to increase Ig A in intestine and protect mice against Salmonella typhimurium (Perdigon et al., 1990). Though we did not examine the specific antibody response, we observed that probiotic feeding resulted in higher total Ig levels in rainbow trout, however the differences were not significant from the control. Gatesoupe (1999) defined probiotics as microbial cells that are administered in such a way as to enter the gastrointestinal tract and to be kept alive, with the aim of improving health. The heightened immune response with supplementation of L. rhamnosus as observed in the present study can be related to the generally improved health status of rainbow trout. It can be concluded that the probiont L. rhamnosus JCM 1136 elicits the fundamental non specific immune parameters like phagocytosis, lysozyme and complement activities in rainbow trout. Besides, the gut colonization is influenced by the level and duration of feeding. This study indicates that probiotics in aquaculture can be effectively employed to help fish protect themselves, thus promoting safe farming that would be less dependent on chemotherapy to combat diseases.
Acknowledgements This work was partly supported by the Japanese Ministry of Education, Culture, Sports, Science and Technology (MEXT) and internal research funds for advanced research from the Tokyo University of Marine Science and Technology.
References Amann, R.L., Ludwig, W., Schleifer, K.H., 1995. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol. Rev. 59, 143–169. Charteris, W.P., Kelly, P.M., Morelli, L., Collins, J.K., 1998. Antibiotic susceptibility of potentially probiotic Lactobacillus species. J. Food Prot. 61, 1643–1643. Chen, S.C., Yoshida, T., Adams, A., Thompson, K.D., Richards, R.H., 1996. Immune response of rainbow trout to extracellular products of Mycobacterium sp. J. Aquat. Anim. Health. 8, 216– 222. Chipman, D.M., Sharon, N., 1969. Mechanism of lysozyme action. Science 165, 454–465.
387
Chung, S., Secombes, C.J., 1988. Analysis of events occurring within teleost macrophages during respiratory burst. Comp. Biochem. Physiol. 89B, 539–544. De Man, J.C., Rogosa, M., Sharpe, M.E., 1960. A medium for the cultivation of lactobacilli. J. Appl. Bacteriol. 23, 130– 135. Demers, N.E., Bayne, C.J., 1997. The immediate effects of stress on hormones and plasma lysozyme in rainbow trout. Dev. Comp. Immunol. 21, 363–373. Fletcher, T., White, A., 1976. The lysozyme of plaice (Pleuronectes platessa L.). Experientia 29, 1283–1285. Gatesoupe, F.J., 1999. The use of probiotics in aquaculture. Aquaculture 180, 147–165. Gildberg, A., Mikkelsen, H., 1998. Effect of supplementing the feed to Atlantic cod (Gadus marhua) fry with lactic acid bacteria and immuno-stimulating peptides during a challenge trial with Vibrio anguillarum. Aquaculture 167, 103–113. Gildberg, A., Johansen, A., Bogwald, J., 1995. Growth and survival of Atlantic salmon (Salmo salar) fry given diet supplemented with fish protein hydrolysate and lactic acid bacteria during a challenge trial with Aeromonas salmonicida. Aquaculture 138, 23–34. Gill, H.S., 1998. Stimulation of the immune system by lactic culture. Int. Dairy J. 8, 535–544. Herich, R., Bomba, A., Nemcova´ , R., Gancarcikova´ , S., 1999. The influence of short-term administration and continuous administration of Lactobacillus casei on basic haematological and immunological parameters in gnotobiotic piglets. Food Agric. Immunol. 11, 287–295. Jonsson, E., Conway, P., 1992. Probiotics for pigs. In: Fuller, R. (Ed.), Probiotics. The Scientific Basis. Chapman and Hall, London, pp. 259–316. Krieg, A.M., Yi, A.K., Matson, S., Waldschmidt, T.J., Bishop, G.A., Teasedale, R., Koretzky, G.A., Kinman, D.M., 1995. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 6, 374 (6522), 546–549. Lesel, R., 1990. Thermal effect on bacterial flora in the gut of rainbow trout and African catfish. In: Lesel, R. (Ed.), Microbiology in Poikilotherms. Elsevier, Amsterdam, pp. 33–38. Majamaa, H., Isolauri, E., Saxelin, M., Vasikari, T., 1995. Lactic acid bacteria in the treatment of acute rotavirus gastroenteritis. J. Pediatr. Gastroenterol. Nutr. 20, 333–339. Moyner, K., Roed, K.H., Sevatdal, S., Heum, M., 1993. Changes in non-specific immune parameters in Atlantic salmon, Salmo salar L., induced by Aeromonas salmonicida infection. Fish Shellfish Immunol. 3, 253–265. Nikoskelainen, S., Ouwehand, A.C., Bylund, G., Salminen, S., 2001a. Protection of rainbow trout (Oncorhynchus mykiss) from furunculosis by Lactobacillus rhamnosus. Aquaculture 198, 229–236. Nikoskelainen, S., Salminen, S., Bylund, G., Ouwehand, A.C., 2001b. Characterization of the properties of human and dairy derived probiotics for prevention of infectious diseases in fish. Appl. Environ. Microbiol. 67, 2430–2435. Olsson, J.C., Westerdahl, A., Conway, P.L., Kjelleberg, S., 1992. Intestinal colonization potential of turbot (Scophthalmus maximus) and dab (Limanda limanda) associated bacteria with
388
A. Panigrahi et al. / Veterinary Immunology and Immunopathology 102 (2004) 379–388
inhibitory effect against Vibrio anguillarum. Appl. Environ. Microbiol. 58, 551–556. Perdigon, G., Nader de Macas, M.E., Alvarez, S., Oliver, G., Pesce de Ruiz Holgado, A., 1986. Effect of peritonially administered lactobacilli on macrophage activation in mice. Infect. Immun. 53, 404–410. Perdigon, G., Nader de Macas, M.E., Alvarez, S., Oliver, G., Pesce de Ruiz Holgado, A., 1988. Systemic augmentation of the immune response in mice by feeding fermented milks with Lactobacillus casei and Lactobacillus acidophilus. Immunology 63, 17–23. Perdigon, G., Alvarez, S., Nader de Macas, M.E., Roux, M.E., Pesce de Ruiz Holgado, A., 1990. The oral administration of lactic acid bacteria increases the mucosal intestinal immunity in response to enteropathogens. J. Food Protect. 53, 404–410. Pouwels, P.H., Leer, R.J., Shaw, M., den Bak-Glashouwer, M.J.H., Tielen, F.D., Smith, E., Martinez, B., Jore, J., Conway, P.L., 1998. Lactic acid bacteria as antigen delivery vehicles for oral immunization purposes. Int. J. Food Microbiol. 41, 155– 167. Puangkaew, J., Kiron, V., Somamoto, T., Okamoto, N., Satoh, S., Takeuchi, T., Watanabe, T., 2004. Nonspecific immune response of rainbow trout (Oncorhynchus mykiss. Walbaum) in relation to different status of vitamin E and highly unsaturated fatty acids. Fish Shellfish Immunol. 16, 25–39. Rengpipat, S., Rukpratanporn, S., Piyatirativivorakul, S., Menasveta, P., 2000. Immunity Enhancement in Black Tiger Shrimp (Penaeus monodon) by a probiont bacterium (Bacillus S11). Aquaculture 191, 271–288. Ringo, E., Strom, E., 1994. Microflora of Arctic charr, Salvelinus alpinus (L.): gastrointestinal microflora of free living fish and effect of diet and salinity on intestinal microflora. Aquacult. Fish. Manage. 25, 623–629. Robertson, P.A.W., O’Down, C., Burrells, C., Williams, P., Austin, B., 2000. Use of Carnobacterium sp. as a probiotic for Atlantic salmon (Salmo salar L.) and rainbow trout (Oncorhynchus mykiss Walbaum). Aquaculture 185, 235–243. Saarela, M., Mogensen, G., Fonden, R., Matto, J., Mattila-Sandholm, T., 2000. Probiotic bacteria: safety, functional and technological properties. J. Biotechnol. 84, 197–215. Salminen, S., Isolauri, E., Salminen, E., 1996. Probiotics and stabilization of the gut mucosal barrier. Asia Pac. J. Clin. Nutr. 5, 53–56.
Schiffrin, E.J., Brassart, D., Servin, A., Rochat, F., Donnet-Hughes, A., 1997. Immune modulation of blood leucocytes in humans by lactic acid bacteria: criteria for strain selection. Am. J. Clin. Nutr. 66, 515–520. Siwicki, A.K., Anderson, D.P., 1993. Nonspecific defense mechanisms assay in fish. II. Potential killing activity of neutrophils and macrophages, lysozyme activity in serum and organs and total immunoglobulin level in serum. In: Disease Diagnosis and Prevention Methods. FAO-project GCP/INT/JPA, IFI Olsztyn, Poland, pp. 105–112. Smith, P., Hiney, M.P., Samuel, O.B., 1994. Bacterial resistance to antimicrobial agents used in fish farming: A critical evaluation of method and meaning. Annu. Rev. Fish Dis. 4, 273–313. Song, Y.L., Kato, N., Cheng-Xu, L., Matsumiya, Y., Kato, H., Watanabe, K., 2000. Rapid identification of 11 human intestinal Lactobacillus species by multiplex PCR assays using group and species specific primer from the 16S-23S r RNA intergenic spacer region and its flanking 23r RNA. FEMS Microbiol. Lett. 187, 167–173. Sugita, H., Okano, R., Suzuki, Y., Iwai, D., Mizukami, M., Akiyama, N., Matsuura, S., 2002. Antibacterial ability of intestinal bacteria from larval and juvenile Japanese flounder against fish pathogen. Fish. Sci. 68, 1004–1011. Tannock, G.W., 1997. Modification of the normal microbiota by diet, stress, antimicrobial agents, and probiotics. In: Mackie, R.I., Withe, B.A., Isaacson, R.E. (Eds.), Gastrointestinal Microbiology, Gastrointestinal Microbes and Host Interactions, vol. 2. Chapman and Hall Microbiology Series International Thomson Publishing, New York, pp. 434–465. Villamil, L., Tafalla, C., Figueras, A., Novoa, B., 2002. Evaluation of immunomodulatory effect of lactic acid bacteria in turbot (Scophthalmus maximus). Clin. Diagn. Lab. Immunol. 9, 1318– 1323. Vershuere, L., Rombaut, G., Sorgeloos, P., Verstraete, W., 2000. Probiotic bacteria as biological control agents in aquaculture. Microbiol. Mol. Biol. Rev. 64, 655–671. Yano, T., 1992. Assay of hemolytic complement activity. In: Stolen, J.S., Fletcher, T.C., Anderson, D.P., Hattari, S.L., Rowley, A.F. (Eds.), Techniques in Fish Immunology. SOS publications, FairHaven, NewJersey, pp. 131–141. Yasui, H., Nagaoka, N., Mike, A., Hayakawa, K., Ohwaki, M., 1992. Detection of Bifidobacterium strains that induce large quantities of IgA. Microb. Ecol. Health Dis. 5, 155–162.
