Gene 332 (2004) 29 – 34 www.elsevier.com/locate/gene
Identification of genes expressed in response to phytoplasma infection in leaves of Prunus armeniaca by messenger RNA differential display Vincenzo Carginale a, Giovanna Maria a, Clemente Capasso a, Elena Ionata a, Francesco La Cara a, Maria Pastore b, Assunta Bertaccini c, Antonio Capasso a,* a
CNR Institute of Protein Biochemistry, Via P. Castellino 111, I-80131 Naples, Italy b Fruit Tree Research Institute-MIPAF, Caserta, Italy c DISTA, Plant Pathology, Alma Mater Studiorum, University of Bologna, Italy
Received 3 October 2003; received in revised form 22 January 2004; accepted 13 February 2004 Received by M. D’Urso Available online 9 April 2004
Abstract The messenger RNA (mRNA) differential display technique was applied to the identification and isolation of genes whose transcription was altered in leaves of Prunus armeniaca infected by European stone fruit yellows (ESFY) phytoplasma belonging to ribosomal subgroup 16SrX-B. Four genes whose steady-state levels of expression significantly changed in response to phytoplasma infection were isolated and identified. The results obtained show that two group of genes are affected by phytoplasma infection in apricot leaves. The first group comprises genes that are up-regulated by phytoplasma presence: in particular, a gene encoding the heat-shock protein HSP-70, a gene encoding a metallothionein (MT) and another homologous to the EST 673 cDNA clone of P. armeniaca, whose function was unknown. The other gene identified in our analysis is down-regulated by phytoplasma presence. It encodes a protein having homology to an amino acid transporter of Arabidopsis thaliana. Our findings demonstrate the usefulness of mRNA differential display approach for the detection of plant metabolic pathways affected by phytoplasma infection. D 2004 Elsevier B.V. All rights reserved. Keywords: HSP70; Metallothionein; Amino acid transport; Stress response
1. Introduction Phytoplasmas (formerly termed mycoplasmalike organisms) are small (200 – 800 Am), pleomorphic prokaryotes of the class Mollicutes characterized by small genomes (530 – 1350 kbp), with low G + C content (23 – 29 mol%), limited number of metabolic pathways, only one or two ribosomal RNA operons, a small number of tRNA, and the absence of a cell wall. They are responsible of plant diseases worldwide Abbreviations: Bp, base pairs; cDNA, DNA complementary to RNA; DDRT-PCR, differential display reverse transcription polymerase chain reaction; DNase, deoxyribonuclease; dNTP, deoxyribonucleoside triphosphate; EMBL, European Molecular Biology Laboratory; MMLV, moloney murine leukemia virus; Oligo(dT), oligodeoxyribonucleotide thymidine; RNase, ribonuclease; RT, reverse transcriptase; SDS, sodium dodecyl sulphate; SSC, 0.15 M NaCl/0.015 M Na3-citrate, pH 7.6; UV, ultraviolet. * Corresponding author. Tel.: +39-81-6132289; fax: +39-81-6132248. E-mail address:
[email protected] (A. Capasso). 0378-1119/$ - see front matter D 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2004.02.030
in more than 300 species representing 98 families, including ornamental plants and many important food, vegetable and fruit crops (Lee et al., 2000; Garnier et al., 2001; Seemu¨ller et al., 2002). Phytoplasma infections are the most limiting factors for production of many important crops all over the world, resulting in significant economic damage. Phytoplasmas are localized in phloem sieve elements and transmitted from plant to plant by phloem sap-sucking insect vectors such as leafhoppers, planthoppers or psyllids (Hanboonsong et al., 2002; Shaw et al., 1993). Plants infected by phytoplasmas exhibits diverse and severe symptoms such as leaf yellowing, growth aberrations (proliferations, internode shortening, stunting), flower malformations (size reduction, virescence, phyllody) and generalized decline (Chang, 1998; Chang and Lee, 1995). At tissue level, phytoplasma infection can cause anatomical aberrations such as extensive phloem necrosis and excess formation of phloem tissue, resulting in swollen veins (Lee et al., 2000). Biochemical analyses on
30
V. Carginale et al. / Gene 332 (2004) 29–34
phytoplasma-infected tobacco plants indicated that soluble carbohydrates and starch accumulate in source leaves, while sink organs showed a marked decrease in sugar levels (Lepka et al., 1999; Maust et al., 2003). The disorders induced in diseased plants vary with the phytoplasma and the stage of infection. The molecular mechanisms involved in symptom development are largely unknown and, currently, the interactions between phytoplasmas and their host plant species are poorly understood. Due to inability in culturing phytoplasmas in vitro, our knowledge about their physiology, biochemistry and molecular biology is limited. Only recently, by the introduction of molecular methods into plant mycoplasmology, it has become possible to determine the phylogenetic and taxonomic relationships of the phytoplasmas to each other and to other prokaryotes (Lee et al., 1998, 2000; Seemu¨ller et al., 1998). Initial knowledge was achieved about phytoplasma/ plant interaction in polyphenol production, sugar and amino acid transportation and comprehensive differences in gene expression were reported mainly in the experimental host plant periwinkle (Catharanthus roseus L.) (Lepka et al., 1999; Musetti et al., 2000; Jagoueix-Eveillard et al., 2001). The European stone fruit yellows (ESFY) phytoplasma belonging to ribosomal subgroup 16SrX-B is a prokaryotic pathogen that infects most or all kinds of stone fruits in Europe and is known to cause apricot chlorotic leaf roll, leptonecrosis and decline of Japanese plum (Prunus salicina), as well as yellows and decline diseases of peach, almond, European plum (Prunus domestica) and flowering cherry (Prunus serrulata) (Lorenz et al., 1994; Marcone et al., 1996). This organism is closely related to other important fruit tree phytoplasmas, apple proliferation (AP), pear decline and peach yellows leaf roll, forming with them a distinct phylogenetic cluster, the AP group (Seemu¨ller et al., 1998). The differential display technique (DDRT-PCR) has been developed as a tool to detect and characterize altered gene expression in eukaryotic cells under various conditions (Liang and Pardee, 1992; Carginale et al., 2002). It is applicable to a number of biological systems and recently has been applied to the study of plant –pathogen interactions (Jagoueix-Eveillard et al., 2001). In the present report, we have used DDRT-PCR to identify genes that are up- or down-regulated in leaves of Prunus armeniaca infected by ESFY (16SrX-B) phytoplasma.
2. Materials and methods 2.1. Inoculation of ESFY (16SrX-B) phytoplasma to apricot trees Apricot trees (P. armeniaca, var. Brusca) used in this study were maintained in an insect-proof environment. Five trees were grafted with phloem tissue infected by European stone fruit yellows (ESFY) phytoplasma belonging to ribosomal subgroup 16SrX-B. An equal number of trees was
grafted similarly with uninfected tissue and used as controls. For differential display analysis, samples were collected one year after grafting and tested by nested PCR to verify ESFY presence (Pastore et al., 2001). 2.2. Isolation of RNA Total RNA was isolated from 0.5 g frozen leaves of control and phytoplasma-infected samples of P. armeniaca using the RNAqueous-Midi kit (Ambion). After removal of contaminating DNA using the DNA-free kit (Ambion), the concentration and purity of RNA samples were determined by UV absorbance spectrophotometry. 2.3. Differential display RT-PCR Differential Display (Liang and Pardee, 1992) was performed using the Delta Differential Display Kit (Clontech Laboratories) according to the manufacturer’s instructions. DNA-free total RNA (5 Ag) isolated from pooled leaves of control and phytoplasma-infected samples was reverse-transcribed in 10 Al of RT buffer (50 mM Tris –HCl, pH 8.3, 6 mM MgCl2, 75 mM KCl), containing 1 mM of each dNTP, 0.1 AM cDNA synthesis primer (oligo-dT) and 200 units of MMLV-reverse transcriptase. The samples were incubated at 42 jC for 60 min, then at 75 jC for 10 min to inactivate the reverse transcriptase. Each cDNA sample obtained was diluted 1:4 (dilution A) and 1:16 (dilution B) and stored at 20 jC for subsequent PCR reactions. Amplification of cDNA fragments was performed in 20 Al PCR reactions, each in the presence of 1 of the 90 possible combinations of arbitrary upstream (designed as ‘‘P’’) and downstream (designed as ‘‘T’’) primers supplied by the manufacturer. The sequences of P and T primers used in these reactions are reported in Table 1. Each Table 1 Primers used in differential display Primer designation
Sequence
P1 P2 P3 P4 P5 P6 P7 P8 P9 P10 T1 T2 T3 T4 T5 T6 T7 T8 T9
ATTAACCCTCACTAAATGCTGGGGA ATTAACCCTCACTAAATCGGTCATAG ATTAACCCTCACTAAATGCTGGTGG ATTAACCCTCACTAAATGCTGGTAG ATTAACCCTCACTAAAGATCTGACTG ATTAACCCTCACTAAATGCTGGGTG ATTAACCCTCACTAAATGCTGTATG ATTAACCCTCACTAAATGCTGTATG ATTAACCCTCACTAAATGTGGCAGG ATTAACCCTCACTAAAGCACCGTCC CATTATGCTGAGTGATATCTTTTTTTTTAA CATTATGCTGAGTGATATCTTTTTTTTTAC CATTATGCTGAGTGATATCTTTTTTTTTAG CATTATGCTGAGTGATATCTTTTTTTTTCA CATTATGCTGAGTGATATCTTTTTTTTTCC CATTATGCTGAGTGATATCTTTTTTTTTCG CATTATGCTGAGTGATATCTTTTTTTTTGA CATTATGCTGAGTGATATCTTTTTTTTTGC CATTATGCTGAGTGATATCTTTTTTTTTGG
V. Carginale et al. / Gene 332 (2004) 29–34
reaction mixture contained 1 Al first-strand cDNA, 1 PCR buffer (50 mM Tris – HCl, pH 8.3, 10 mM KCl, 5 mM (NH4)2SO4, 2 mM MgCl2), 50 AM dNTPs, 2 ACi [a-33P]dATP (Amersham Pharmacia Biotech), 1 AM of P primer, 1 AM of T primer and 1 unit of FastStart Taq DNA polymerase (Roche). Reactions were carried out in a DNA Thermocycler Express (Hybaid) with the following parameters: 1 cycle at 94 jC for 4 min, 40 jC for 5 min, 72 jC for 5 min; 2 cycles at 94 jC for 1 min, 40 jC for 1 min, 72 jC for 5 min; 30 cycles at 94 jC for 30 s, 58 jC for 30 s, 72 jC for 2 min, and a final elongation step at 72 jC for 7 min. The PCR products obtained from dilutions A and B of each first-strand cDNA produced from RNA of control and phytoplasma-infected plants were size-fractionated in parallel by denaturing electrophoresis in 6% polyacrylamide/8 M urea gels. After electrophoresis, gels were dried into Whatman 3MM paper and exposed to Fuji X-ray film for autoradiography. Differentially expressed cDNA bands were excised from dried gels and incubated in 40 Al of 10 mM tricine, pH 9.5, containing 0.2 mM EDTA at 100 jC for 5 min. The eluted cDNA was reamplified in a 50 Al PCR reaction using the same pair of primers used in the differential display reaction. PCR reaction conditions were similar to those described above, with the exception of the three initial rounds for nonspecific annealing, the omission of [a-33P]dATP and the increase of dNTPs concentration to 0.2 mM. Reamplified cDNAs were resolved by agarose-gel electrophoresis and then purified using Qiaquick gel-extraction kit (Qiagen). 2.4. Subcloning and sequencing of differential display products Gel-purified cDNAs were subcloned into a pCR4-TOPO vector using the TOPO TA Cloning kit (Invitrogen). DNA inserts were sequenced bidirectionally by the dideoxynucleotide method (Sanger et al., 1977) using the T7 sequencing kit (Amersham Pharmacia Biotech).
31
SDS at 42 jC for 5 min, followed by two washes with 0.1 SSC, 0.1% SDS at 42 jC for 15 min. For detection and quantification of the radioactive signals, the filter was exposed to a PhosphorImager apparatus (Storm Imaging System, Amersham Pharmacia Biotech). After images were obtained, membrane was boiled twice in 0.1% SDS for 15 min to remove the bounded probe. Equal loading of RNA was verified by staining the membrane, after UV crosslinking, with 0.02% (w/v) methylene blue in 0.3% sodium acetate (pH 5.5) for 3 min. After washing in 0.2 SSC in 0.1% SDS for 15 min at room temperature, the membrane was ready for hybridization (Sambrook and Russell, 2001). 2.6. Sequence analysis The homology search of genes against the EMBL Nucleotide Sequence Databases was performed by onlinebased FASTA program available at European Bioinformatics Institute (EBI).
3. Results 3.1. Identification of differentially expressed mRNAs in phytoplasma-infected plants The differential display technique was used to compare mRNA expression pattern of control and phytoplasmainfected samples of P. armeniaca in order to identify genes whose transcription is up- or down-regulated by phytoplasma presence. A total of ten 5V-arbitrary primers were used. Each of the 5V-primers was paired with one of the nine 3V-oligo(dT) primers (Table 1) and used to amplify cDNAs obtained by reverse transcription of total RNA from control and phytoplasma-infected plants. To prevent isolation of ‘‘false positives’’, all amplification experiments were performed on two different dilutions of each cDNA sample.
2.5. Northern blot analysis Total RNA (15 Ag) from pooled leaves of control and phytoplasma-infected samples was size-fractionated by electrophoresis through a denaturing 2.2 M formaldehyde/1.5% (w/v) agarose gel (Sambrook and Russell, 2001), transferred by capillary blotting into nylon membrane (Immobilon Ny+, Millipore) and fixed by UV cross-linking. The differentially expressed cDNA fragments were labelled with [af32P]dCTP (Amersham Pharmacia Biotech) using the random-priming labelling kit (Amersham Pharmacia Biotech) and used as a probe for Northern hybridization. Membrane was prehybridized for 30 min at 42 jC in UltraHyb buffer (Ambion). Hybridization was then performed in the presence of labelled probe at 42 jC for 16 h in the same buffer. Membrane was washed twice with 2 SSC, 0.1% (w/v)
Fig. 1. Representative differential display autoradiograph of mRNA from control and phytoplasma-infected samples. Total RNA from control and phytoplasma-infected samples was reverse-transcribed and amplified with the primer combination as indicated on top of figure. PCR reactions were performed on two different dilutions of each cDNA sample to minimize artifacts. Arrows indicate the position of cDNA bands that were recovered from the gels and further analysed.
32
V. Carginale et al. / Gene 332 (2004) 29–34
Table 2 Sizes of the differentially expressed cDNA fragments and primer combinations used in DDRT-PCR Clone
Size of PCR product (bp)
Primers used in PCR
DDa DDc DDd DDg
411 505 251 192
P9/T8 P7/T5 P10/T7 P1/T2
Only cDNA bands whose levels of expression were affected by phytoplasma presence in both dilutions were selected for further analysis. Fig. 1 shows a representative differential display gel. A total of five differentially expressed cDNA bands were identified and successfully extracted from the dried polyacrylamide gels, reamplified and cloned. Four of them were successively confirmed by Northern blot to be regulated by phytoplasma infection. Three of these cDNA bands showed an increase in band intensity in phytoplasmainfected samples, whereas the other cDNA bands showed decreased band intensity in the phytoplasma-infected samples. The cloned cDNA fragments ranged in size from 192 to 505 bp (Table 2). 3.2. Northern blot analysis Northern blot analysis was performed to confirm that the differentially expressed cDNA fragments represented mRNAs whose steady-state level of expression changed following phytoplasma infection. Using total RNA from control and phytoplasma-infected samples and radioactive-
Table 3 Identification of differentially expressed cDNAs by FASTA analysis Clone
Sequence homology
Effect of phytoplasma infection
EMBL accession no.
DDa DDc DDd DDg
hsp70 gene a. a. transporter EST 673 cDNA clone metallothionein
+
SOC70A AAF23206 CB819681 AF028013
+ +
ly labelled cDNA fragments as probes for hybridization, it was shown that in phytoplasma-infected samples the expression levels of DDc showed a 1.74-fold decrease, whereas a 1.75-, 1.95- and 3-fold increase was observed for DDa, DDg and DDd, respectively (Fig. 2). The clone DDb did not significantly change its level of expression in phytoplasma-infected samples; hence, it was considered to be a false positive. 3.3. Identification of cDNA clones The nucleotide sequences of the differentially expressed cDNA clones were determined and compared with those in EMBL Nucleotide Sequence Databases to identify putative proteins that are encoded by these mRNAs. The results of FASTA analyses summarized in Table 3 allowed us to identify DDa clone as the product of the hsp70 gene (E = 1.5e 43); DDc, DDd and DDg clone show significant homology to an amino acid transporter of Arabidopsis thaliana (E = 1.3e 24), the EST 673 cDNA clone of P. armeniaca (E = 1.5e 26) and metallothionein of Prunus avium (E = 2e 28), respectively.
Fig. 2. Northern blot analyses of total RNA from control and phytoplasma-infected samples hybridized with 32P-labelled cDNA probes obtained from the differential display band DDa, DDc, DDd and DDg. Equal loading of RNA was verified by methylene blue staining of the filter. Quantification of signal was obtained by ImageQuant Analysis Software (Amersham Pharmacia Biotech) and compared to that of control value, which was set to 100%. Each bar is the average of three distinct measurements.
V. Carginale et al. / Gene 332 (2004) 29–34
4. Discussion The molecular mechanisms involved in the interaction between pathogenic phytoplasmas and their plant hosts are largely unknown, and only recently genes involved in pathogenicity have begun to be identified (Garnier et al., 2001). Using the DDRT-PCR technique, we have identified a number of plant genes whose expression is altered following phytoplasma infection. We isolated cDNA bands produced from mRNAs of phytoplamainfected apricot plants showing different intensity with respect to cDNA bands of control plants. Only five of the numerous bands obtained from 90 PCR reactions appeared to be differentially expressed, and of these four were successively validated by Northern blot analysis and identified by comparison with sequences available in data banks. The results of our investigations show that two groups of genes are affected by phytoplasma infection in apricot leaves. The first group comprises genes that are up-regulated following infection: a gene encoding the heat-shock protein HSP70, a gene encoding a metallothionein (MT) and another homologous to the EST 673 cDNA clone of P. armeniaca. Unfortunately, the function of the EST 673 cDNA clone is unknown. Various studies have elucidated HSP70 chaperone function under stress conditions and in protein metabolism. HSP70 binds and release unfolded/non-native proteins, thereby helping polypeptides undergo productive folding. HSP70 can prevent aggregation of denatured proteins and refold stress-denatured protein (Yul Sung et al., 2001). It is found in all groups of living organisms and is known to be expressed in response to a variety of stress conditions, including heavy metals (Carginale et al., 2002). Transcriptional induction is mediated by the binding of a transcriptional activator, heat shock factor, to a short DNA regulatory sequence present in the promoter region of the gene, the heat shock element. The activation of hsp70 transcription by phytoplasma infection confirms that hsp70 gene may be induced by stress-generating factors other than temperature. There have been several reports of an increase in hsp70 gene expression in plants in response to virus infection (Aranda et al., 1996; Escaler et al., 2000; Havelda and Maule, 2000). At the moment, it is not clear how plant pathogens can increase the steady-state level of hsp70 mRNA. It has been reported that hsp70 gene expression is controlled by different regulatory pathways during thermal stress and virus replication (Aranda et al., 1999). Metallothioneins are low-molecular-weight, cysteinerich heavy metal-binding proteins, widely occurring in animal and plant tissues, which participate in an array of protective stress responses (Robinson et al., 1993; Carginale et al., 1998). Although the ultimate role of MTs has not been firmly established, several lines of evidence suggest their participation in detoxification of heavy metals and homeostasis of oligoelements such as copper and zinc.
33
MTs can also have a significant role against oxidative stress-inducing agents, as they are potent scavengers of free hydroxyl radicals (Palmiter, 1998). Several plant MT genes have been cloned and some results show that these genes are induced by senescence, mechanical wounding and viral pathogens (Butt et al., 1998; Choi et al., 1996). Plants undergo oxidative stresses when exposed to wounding or pathogen infection (Baker and Orlandi, 1995) and reactive oxygen species produced during those stresses affect disease resistance as well as disease symptom development (Tzeng and De Vay, 1993). A possible role of the phytoplasma-induced MT gene may be to reduce the concentration of free metal ions in the cell and preventing an increase in reactive oxygen species produced in stressed plants. During pathogen attack, it is likely that macromolecule degradation results in the release of metal ions from enzymes. MT may have a role in the sequestering and transport of metal ions from infected tissues to developing areas of the plant. The other gene identified in our analysis is down-regulated by phytoplasmal infection. It encodes a protein presenting homology to an amino acid transporter of A. thaliana. The uptake and transport of inorganic nitrogen is essential for plant growth. Inorganic nitrogen taken up by the root system is rapidly incorporated into amino acids in roots and shoots and subsequently is distributed via the vascular tissue to supply all growing organs. Thus at various places in the plant, transporters for amino acids are required, e.g. for loading of the phloem in leaves, loading of the xylem in roots, and transfer of amino acids between the two vascular system (Fischer et al., 1998; Okumoto et al., 2002). Several tissues, including developing leaves, meristems and reproductive organs, must import amino acids to support growth and development. Amino acid transport also plays a key role in leaf senescence. Senescence is a well-controlled process during which the plant recycles materials as much as possible from the cells before necrosis eventually occurs. In rice, as much as 60% of the amino acids delivered to the developing seeds are derived from amino acids recovered from senescing leaves (Ortiz-Lopez et al., 2000). Senescence-like symptoms, chlorosis or yellowing, are commonly observed in phytoplasma-infected plants (Butt et al., 1998). The fact that the expression level of an amino acid transporter gene is reduced following phytoplasma infection suggests that the alteration of the amino acid transport may be an important factor for disease symptom development. Our work shows the efficacy of the differential display technique in the identification of the plant metabolic pathways affected by phytoplasma infection.
Acknowledgements This research is funded by Italian Ministry for Education, University and Scientific Research (MIUR).
34
V. Carginale et al. / Gene 332 (2004) 29–34
References Aranda, M.A., Escaler, M., Wang, D., Maule, A.J., 1996. Induction of HSP70 and polyubiquitin expression associated with plant virus replication. Proc. Natl. Acad. Sci. U. S. A. 39, 15289 – 15293. Aranda, M.A., Escaler, M., Thomas, C.L., Maule, A.J., 1999. A heat shock transcription factor in pea is differentially controlled by heat and virus replication. Plant J. 20, 153 – 161. Baker, C.J., Orlandi, E.W., 1995. Active oxygen species in plant pathogenesis. Annu. Rev. Phytopathol. 33, 299 – 321. Butt, A., Mousley, C., Morris, K., Beynon, J., Can, C., Holub, E., Greenberg, J.T., Buchanan-Wollastone, V., 1998. Differential expression of a senescence-enhanced metallothionein gene in Arabidopsis in response to isolates of Peronospora parasitica and Pseudomonas syringae. Plant J. 16, 209 – 221. Carginale, V., Scudiero, R., Capasso, C., Capasso, A., Kille, P., di Prisco, G., Parisi, E., 1998. Cadmium-induced differential accumulation of metallothionein isoforms in the Antarctic icefish which exhibits no basal protein but high endogenous mRNA levels. Biochem. J. 332, 475 – 481. Carginale, V., Capasso, C., Scudiero, R., Parisi, E., 2002. Identification of cadmium-sensitive genes in the Antarctic fish Chionodraco hamatus by messenger RNA differential display. Gene 299, 117 – 124. Chang, C.J., 1998. Pathogenicity of aster yellows phytoplasma and Spiroplasma citri on periwinkle. Phytopathology 88, 1347 – 1350. Chang, C.J., Lee, I.-M., 1995. In: Singh, R.P., Kohmoto, K. (Eds.), Pathogenesis of diseases associated with mycoplasma-like organisms. Elsevier, New York, pp. 237 – 246. Choi, D., Kim, H.M., Yun, H.K., Park, J.A, Kim, W.T., Bok, S.H., 1996. Molecular cloning of a metallothionein-like gene from Nicofiana Glufinosa L. and its lnduction by wounding and tobacco mosaic virus infection. Plant Physiol. 112, 353 – 359. Escaler, M., Aranda, M.A., Thomas, C.L., Maule, A.J., 2000. Pea embryonic tissues show common responses to the replication of a wide range of viruses. Virology 267, 318 – 325. Fischer, W.-N., Andre´, B., Rentsch, D., Krolkiewicz, S., Tegeder, M., Breitkreuz, K., Frommer, W.B., 1998. Amino acid transport in plants. Trends Plant Sci. 3, 188 – 195. Garnier, M., Foissac, X., Gaurivaud, P., Laigret, F., Renaudin, J., Saillard, C., Bove´, J.M., 2001. Mycoplasmas, plants, insect vectors: a matrimonial triangle. C. R. Acad. Sci. 324, 923 – 928. Hanboonsong, Y., Choosai, C., Panyim, S., Damak, S., 2002. Transovarial transmission of sugarcane white leaf phytoplasma in the insect vector Matsumuratettix hiroglyphicus (Matsumura). Insect Mol. Biol. 11, 97 – 103. Havelda, Z., Maule, J., 2000. Complex spatial responses to cucumber mosaic virus infection in susceptible Cucurbita pepo cotyledons. Plant Cell 12, 1975 – 1985. Jagoueix-Eveillard, S., Tarendau, F., Guolter, K., Danet, J.L., Bove´, J.M., Garnier, M., 2001. Catharanthus roseus genes regulated differentially by mollicute infections. Mol. Plant-Microb. Interact. 14, 225 – 233. Lee, I.-M., Gundersen-Rindal, D.E., Davis, R.E., Bartoszyk, I.M., 1998. Revised classification scheme of phytoplasmas based on RFLP analyses of 16S rRNA and ribosomal protein gene sequences. Int. J. Syst. Bacteriol. 48, 1153 – 1169.
View publication stats
Lee, I.-M., Davis, R.E., Gundersen-Rindal, D.E., 2000. Phytoplasma: phytopathogenic Mollicutes. Annu. Rev. Microbiol. 54, 221 – 255. Lepka, P., Stitt, M., Moll, E., Seemu¨ller, E., 1999. Effect of phytoplasmal infection on concentration and translocation of carbohydrates and amino acids in periwinkle and tobacco. Physiol. Mol. Plant Pathol. 55, 59 – 68. Liang, P., Pardee, A.B., 1992. Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 257, 967 – 971. Lorenz, K.-H., Dosba, F., Poggi-Pollini, C., Llacer, G., Seemu¨ller, E., 1994. Phytoplasma diseases of Prunus species in Europe are caused by genetically similar organisms. Z. Pflanzenkr. Pflanzenschutz 101, 567 – 575. Marcone, C., Ragozzino, A., Seemu¨ller, E., 1996. European stone fruit yellows phytoplasma as the cause of peach vein enlargement and other yellows and decline diseases of stone fruits in southern Italy. J. Phytopathol. 144, 559 – 564. Maust, B.E., Espadas, F., Talavera, C., Aguilar, M., Santamarı´a, J.M., Oropeza, C., 2003. Changes in carbohydrate metabolism in coconut palms infected with the lethal yellowing phytoplasma. Phytopathology 93, 976 – 981. Musetti, R., Favali, A., Pressacco, L., 2000. Histopathology and polyphenol content in plants infected by phytoplasmas. Cytobios 102, 133 – 147. Okumoto, S., Schmidt, R., Tegeder, M., Fischer, W.N., Rentsch, D., Frommer, W.B., Koch, W., 2002. High affinity amino acid transporters specifically expressed in xylem parenchyma and developing seeds of Arabidopsis. J. Biol. Chem. 277, 45338 – 45346. Ortiz-Lopez, A., Chang, H.C., Bush, D.R., 2000. Amino acid transporters in plants. Biochim. Biophys. Acta 1465, 275 – 280. Palmiter, R.D., 1998. The elusive function of metallothioneins. Proc. Natl. Acad. Sci. U. S. A. 95, 8428 – 8430. Pastore, M., Tian, J., Simeone, A.M., Paltrinieri, S., Piccirillo, P., Bertaccini, A., 2001. Transmission by patch-grafting of ESFY phytoplasma to apricot (Prunus armeniaca L) and Japanese plum (Prunus salicina Lindl). Acta Hortic. 550, 339 – 344. Robinson, N.J., Tommey, A.M., Kuske, C., Jackson, P.J., 1993. Plant metallothionein. Biochem. J. 295, 1 – 10. Sambrook, J., Russell, D.W., 2001. Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York. Sanger, F., Nicklen, S., Coulson, A.R., 1977. DNA sequencing with chainterminating inhibitors. Proc. Natl. Acad. Sci. U. S. A. 74, 5463 – 5467. Seemu¨ller, E., Marcone, C., Lauer, U., Ragozzino, A., Goschl, M., 1998. Current status of molecular classification of the phytoplasmas. J. Plant Pathol. 80, 3 – 26. Seemu¨ller, E., Garnier, M., Schneider, B., 2002. Mycoplasmas of plants and insects. In: Razin, S., Herrmann, R. (Eds.), Molecular Biology and Pathogenicity of Mycoplasmas. Kluwer Academic/Plenum, New York, pp. 91 – 115. Shaw, M.E., Kirkpatrick, B.C., Golino, D.A., 1993. The beet leafhoppertransmitted virescence agent causes tomato big bud disease in California. Plant Dis. 77, 290 – 295. Tzeng, D.D., De Vay, J.E., 1993. Role of oxygen radicals in plant disease development. Adv. Plant Pathol. 10, 1 – 34. Yul Sung, D., Vierling, E., Guy, C.L., 2001. Comprehensive expression profile analysis of the Arabidopsis Hsp70 gene family. Plant Physiol. 126, 789 – 800.
