APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Sept. 2005, p. 5593–5597 0099-2240/05/$08.00⫹0 doi:10.1128/AEM.71.9.5593–5597.2005 Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Vol. 71, No. 9
Identification of DNA Sequences Specific for Vibrio vulnificus Biotype 2 Strains by Suppression Subtractive Hybridization Chung-Te Lee,1 Carmen Amaro,3 Eva Sanjua´n,3 and Lien-I Hor1,2* Institute of Basic Medical Sciences1 and Department of Microbiology and Immunology,2 College of Medicine, National Cheng-Kung University, Tainan 701, Taiwan, Republic of China, and Departamento de Microbiologı´a y Ecologı´a, Facultad de Biologı´a, Universidad de Valencia, 46100 Valencia, Spain3 Received 20 October 2004/Accepted 4 April 2005
Vibrio vulnificus can be divided into three biotypes, and only biotype 2, which is further divided into serovars, contains eel-virulent strains. We compared the genomic DNA of a biotype 2 serovar E isolate (tester) with the genomic DNAs of three biotype 1 strains by suppression subtractive hybridization and then tested the distribution of the tester-specific DNA sequences in a wide collection of bacterial strains. In this way we identified three plasmid-borne DNA sequences that were specific for biotype 2 strains irrespective of the serovar and three chromosomal DNA sequences that were specific for serovar E biotype 2 strains. These sequences have potential for use in the diagnosis of eel vibriosis caused by V. vulnificus and in the detection of biotype 2 serovar E strains. Vibrio vulnificus is a gram-negative estuarine bacterium that produces diseases in humans and eels. In humans, this organism may cause serious wound infections and septicemia with a high mortality rate, particularly in people with underlying conditions such as alcoholism hemochromatosis, and liver cirrhosis (12, 25). In cultured eels, this species can cause the disease vibriosis, which was originally described in Japan in 1976 (20) and is one of the main causes of economic losses in brackish water eel culture in Europe (7, 16). The disease in its acute form is a primary septicemia characterized by external and internal hemorrhages affecting the major organs, such as the liver, kidney, spleen, and pancreas (6). Strains of V. vulnificus have been subdivided into three biotypes based primarily on differences in biochemical properties, such as indole production and cellobiose fermentation, as well as the epidemiological pattern and host range (10, 24). Biotype 2 comprises the strains virulent for eels (5, 22, 24), which can be further classified into different serovars (9, 17). Only one of these serovars, serovar E, is clearly related to both highly virulent epizootics and human infections (3). The mechanism of virulence of V. vulnificus biotype 2 in eel vibriosis remains unclear, although a few studies have been conducted with serovar E strains (2, 4). We hypothesized that the biotype 2 strains may have genetic information, which is absent from strains of other biotypes, that enables them to infect and cause vibriosis in eels. In this case, a genome comparison of biotypes to identify DNA sequences specific for the biotype 2 strains may help workers discover the virulence determinants of V. vulnificus for eels. Suppression subtractive hybridization (SSH), a technique originally developed to study gene expression in eukaryotes (15), has been successfully used to identify strain- or species-
specific DNA sequences in a variety of bacteria. In this technique, the DNA fragments derived from regions that are present in one strain, designated the tester, but absent in another strain, designated the driver, are not annealed when the genomic DNA fragments from the tester and driver are mixed, denatured, and reannealed. Such DNA fragments can then be amplified by PCR and cloned into a suitable vector for sequence determination. Some genomic islands implicated in the virulence of a number of bacteria have been identified in this way (1, 11, 13, 14, 18, 23, 26). The main objective of the present work was to identify V. vulnificus biotype 2-specific DNA sequences by SSH, from which potential virulence genes for eels might be identified and probes useful for rapid diagnosis of eel vibriosis might be developed. Genomic subtraction between V. vulnificus biotype 1 and biotype 2 strains. SSH was performed with a PCR-Select bacterial genome subtraction kit (Clontech, Palo Alto, CA). A serovar E strain, CECT4602, with high virulence for eels (5) was selected as the tester, and three clinical biotype 1 isolates, CS9133, YJ016, and ATCC 27562, were selected as the drivers (Table 1). The sizes of the subtraction products amplified after PCR ranged from 300 bp to 1,500 bp. These products were subsequently cloned into the pGEM-T easy vector in Escherichia coli DH5␣, and a total of 85 recombinant clones were obtained. The specificity of the DNA fragment in each clone was checked further with the tester, the drivers, and four more biotype 2 serovar E strains by Southern hybridization. Thirtythree clones were found to contain the biotype 2-specific DNA fragments. These clones were tested again by dot blot hybridization to exclude the clones that cross-hybridized with the randomly chosen clones. Finally, eight clones (designated CT005, CT010, CT012, CT023, CT025, CT051, CT061, and CT067) that contained different biotype 2-specific DNA fragments were identified (the results of Southern hybridization with CT005 are shown in Fig. 1). Characterization of the biotype 2-specific sequences. The nucleotide sequences of the biotype 2-specific DNA fragments
* Corresponding author. Mailing address: Department of Microbiology and Immunology, College of Medicine, National Cheng-Kung University, Tainan 701, Taiwan, Republic of China. Phone: 886-62353535, ext. 5635. Fax: 886-6-2082705. E-mail:
[email protected] .edu.tw. 5593
5594
LEE ET AL.
APPL. ENVIRON. MICROBIOL. TABLE 1. Sources, origins, and serovars of the V. vulnificus strains used in this study Strain(s)a
Source
Biotype 1 A2,k An4,k An5,k An6,k An7k CECT4867b,k CECT4609 CECT4608, PD-1, PD-3, PD-5, PD-12, VI CECT5167, KH-03,b N-87,b,k YN-03b,k L-49b,k G-83b,k CECT5165, JE,c,k MLT 362,c,k MLT 364,c,k MLT 404,c,k MLT406,c,k VV425,c,k VV1003c,k CG021, CG022, CG023, CG024, CG025, CG026, CG027, CG028, CG100,k CG106,k CG110,k CG111,k CG118k 94358d,k ATCC 33816, CECT5164, CECT5166, CECT5168, CECT5169, CECT529Ti CS9133i,k YJ001, YJ002, YJ003, YJ016i,k V4e,k 94-9-118,f 94-9-119 f 94-9-130f E-4b,k Biotype 3 1033,g,k 11028,g 12,g,k 162,g 32,g,k 58,g 3/97g Biotype 2 CECT897, CECT898, CECT4862 CECT4601, CECT4602,j CECT4603, CECT4604, CECT4605, CECT4607, CECT4864, CECT4917, CECT4998, CECT4999, CECT5139 ¨ 122f CECT4870, O CECT4868 CECT4863 CECT4865 CECT4866 CECT5762,h,k C1h,k CECT5763,h,k PD-2-47,h PD-2-50,h PD-2-51,h PD-2-55,h PD-2-56,h Riu 2h 90-2-11f 94-8-112f 94-9-123f CECT5198, CECT5343, CECT5768, CECT5769,k A10,k A11,k A12,k A13,k A14k 95-8-6,f 95-8-7f 95-8-161,f 95-8-162f 535,f 536f
Serovar
Country
Diseased eels Diseased eel Healthy eel Environment Patients Environment Environment Environment Environment
NAl NA NA NA NA NA NA NA NA
Spain Unknown Spain Spain Japan Japan South Korea United States Taiwan
Patient Patients Patient Patients Patient Patients Environment Environment
NA NA NA NA NA NA NA NA
Spain United States South Korea Taiwan Australia Denmark Denmark Unknown
Patients
NA
Israel
Diseased eels Diseased eels
E E
Japan Spain
Diseased eels Diseased eel Patient Diseased shrimp Patient Healthy eels Environment Diseased eel Patient Environment Diseased eels Diseased eels Diseased eels Diseased eels
E E E E E E E E E E A O3 O3:O4 NTm
Sweden Norway United States Taiwan Australia Spain Spain Denmark Denmark Denmark Spain Denmark Denmark Sweden
a CECT, Spanish Type Culture Collection, Valencia, Spain; ATCC, American Type Culture Collection, Manassas, VA. Strains from Denmark were purchased by J. L. Larsen and I. Dalsgaard from KVL (Denmark). b Supplied by S. I. Miyoshi, Faculty of Pharmaceutical Sciences, Okayama University, Okayama, Japan. c Supplied by M. L. Tamplin, USDA-ARS-ERRC, Wyndmoor, Pa. d Supplied by L. Torres, Department of Microbiology, Miguel Servet University Hospital, Zaragoza, Spain. e Supplied by L. Gibson, Department of Cell and Molecular Biology, The University of Technology, Sidney, Australia. f Supplied by J. L. Larsen and I. Dalsgaard from KVL, Denmark g Supplied by N. Bisharat (Nuffield Department of Clinical Laboratory Science, University of Oxford, United Kingdom). The source of the outbreaks was tilapia cultured in Israel. h See reference 21. i Strain used as a driver for SSH. j Strain used as the tester for SSH. k Strain tested for eel virulence as described by Amaro et al. (5) l NA, not applicable. m NT, nontypeable with the antisera against serovars A and E.
(designated seq5, seq10, seq12, seq23, seq25, seq51, seq61, and seq67 for clones CT005, CT010, CT012, CT023, CT025, CT051, CT061, and CT067, respectively) were determined. DNA sequences that exhibited high levels of homology with the identified biotype 2-specific sequences were then searched in the GenBank database by BLASTX. As shown in Table 2, four of these identified sequences exhibited significant amino acid sequence homology with other database entries; seq5 and seq10 exhibited significant amino acid sequence homology with a putative transposase of Vibrio anguillarum, and seq12 and seq67 exhibited significant amino acid sequence homology with
hypothetical proteins of Haemophilus influenzae and Vibrio parahaemolyticus, respectively. The biotype 2 serovar E and serovar O3 strains harbor plasmids with different molecular weights (8, 17, 19). We further determined the location of each identified biotype 2-specific sequence in the genome of CECT4602 by Southern hybridization using total DNA and plasmid DNA, respectively, as the templates. The DNA sequence was considered to be located in the plasmid if the probe derived from it hybridized with both the plasmid and total DNA. In contrast, the DNA sequence was considered to be located in the chromosome if
BIOTYPE 2 V. VULNIFICUS-SPECIFIC DNA SEQUENCES
VOL. 71, 2005
FIG. 1. Southern hybridization to examine the specificity of a cloned sequence. The genomic DNAs were prepared from biotype 1 strains CS9133, ATCC 27562, and YJ016 (lanes A to C) and biotype 2 serovar E strains CECT4602, CECT4601, CECT4604, CECT4605, and ATCC 33147 (lanes D to H). They were digested with HindIII and then probed with 32P-labeled plasmid DNA that was extracted from the subtractive clone CT005. Lane M contained a 1-kb Plus DNA ladder (Invitrogen).
the probe derived from it hybridized with the total DNA but not with the plasmid. seq5, seq10, seq12, seq25, and seq51 were found to be located in the plasmid, while seq23, seq61, and seq67 were found in the chromosome (Table 2). We then examined the plasmid profiles of eight serovar E strains, including CECT4602, and one biotype 2 serovar A strain and found that all the strains harbored at least one plasmid. The restriction patterns of plasmids of serovar E strains were similar, while the restriction pattern of the serovar A strain was significantly different (Fig. 2A). Nevertheless, all the biotype 2 strains tested (both serovar E and serovar A) had a common HindIII-restricted DNA fragment that hybridized with the probe derived from seq5, seq10, seq12, seq25, or seq51 (only the results for seq51 are shown in Fig. 2B). Distribution of the biotype 2-specific sequences in V. vulnificus and other species. The specificity of identified biotype 2-specific sequences was further tested with 111 strains of V. vulnificus (Table 1) and 37 strains of other species (listed below) by PCR using the primer pairs derived from these sequences (Table 3). All of the V. vulnificus strains except five biotype 2 strains and 21 biotype 1 strains that had been tested
5595
previously were first tested for virulence in juvenile European eels (average weight, 8 to 10 g) by a previously described method (5). As expected, all of the biotype 2 strains tested, irrespective of the serovar, were virulent for eels, while all biotype 1 and biotype 3 strains tested were avirulent. The strains of the other species tested are all fish pathogens or members of the normal fish microbiota. These strains belonged to the following species (one strain of each unless indicated otherwise): Vibrio aesturianus, Vibrio alginolyticus, Vibrio anguillarum, Vibrio campbellii, Vibrio harveyi/Vibrio carchariae (two strains), Vibrio cholerae, Vibrio cincinnatiensis, Vibrio diazotrophicus, Vibrio fischeri, Vibrio fluvialis, Vibrio furnissii (two strains), Vibrio mediterranei, Vibrio mimicus, Vibrio mytilii, Vibrio natriegens, Vibrio nereis, Vibrio nigripulchritudo, Vibrio ordalii, Vibrio orientalis, Vibrio parahaemolyticus, Vibrio proteolyticus, Vibrio salmonicida, Vibrio splendidus, Vibrio scophthalmi, Aeromonas allosaccharophila, Aeromonas encheleia, Aeromonas hydrophila, Aeromonas jandaei (two strains), Aeromonas sobria, Edwarsiella tarda, Photobacterium damselae, Plesiomonas shigelloides, Pseudomonas sp., and Shewanella putrefaciens. For PCRs, total DNA was isolated from an overnight bacterial culture and used as the template in a PCR. The reaction mixture (50 l) contained 200 ng DNA, each deoxynucleoside triphosphate at a concentration of 6.25 mM, 75 mM MgCl2, each primer at a concentration of 0.2 M, and 2.5 U of Taq polymerase (Amersham Biosciences, Buckinghamshire, England) in 1⫻ PCR buffer (Amersham Biosciences). The reaction started with 5 min of denaturation at 94°C, which was followed by 25 cycles of 30 s of denaturation at 94°C, 1 min of annealing at 55 to 65°C, and 1 min of extension at 72°C. An additional extension at 72°C for 10 min completed the reaction. None of the sequences was detected in any other species tested, including V. anguillarum and V. parahaemolyticus, which were shown to contain sequences highly homologous to seq5 and seq10 and to seq67, respectively (Table 2). This was probably because the primers either were derived from sequences that were not shared by these species or contained high number of mismatches, despite having been derived from the homologous regions. seq10, seq23, seq25, seq51, seq61, and seq67 were not detected in the biotype 1 and biotype 3 strains (Table 4). seq5 and seq12 turned out to be not specific for the biotype 2 strains; the former sequence was also detected in three biotype 3 strains, and the latter sequence was present in some
TABLE 2. Features of the biotype 2-specific DNA sequences Sequence
Length (bp)
Homologous protein
Species
E valuea
Locationb
seq5 seq10 seq12 seq23 seq25 seq51 seq61 seq67
291 1,198 742 600 626 1,401 805 671
Putative transposase Putative transposase Putative transposase None None None None Hypothetical protein
Vibrio anguillarum Vibrio anguillarum Haemophilus influenzae
1e-41 3e-46 3e-67
Vibrio parahaemolyticus
1e-69
Plasmid Plasmid Plasmid Chromosome Plasmid Plasmid Chromosome Chromosome
a
The E value indicates the probability of the match. A match with an E value of 1e-10 or less is considered significant. The lengths of the matches and the levels of identity are as follows: 95 amino acids and 85% for seq5; 125 amino acids and 44% and 151 amino acids and 38% for seq10; 245 amino acids and 51% for seq12; and 145 amino acids and 91% for seq67. b The location of each sequence was determined by Southern hybridization with a probe derived from each sequence, using purified plasmid DNA and total DNA of strain CECT4602 as the templates.
5596
LEE ET AL.
APPL. ENVIRON. MICROBIOL.
FIG. 2. Southern hybridization of plasmids of various biotype 2 strains probed with a biotype 2-specific sequence. (A) The plasmid DNA extracted from each strain was digested with HindIII, fractionated by electrophoresis on a 0.8% agarose gel, and visualized by staining with ethidium bromide. (B) Southern hybridization of the digested plasmid DNAs shown in panel A probed with the 32P-labeled PCR product amplified from seq51. Lanes A to I contained plasmid DNAs from biotype 2 strains CECT4601, CECT4602, CECT4604, CECT4605, ATCC 33147, CECT4603, CECT5198, CECT4607, and CECT4864. Most of these strains are serovar E strains; the only exception is CECT5198, which is a serovar A strain. The restriction fragment in panel A that was hybridized by the probe is indicated by an arrow.
biotype 1 strains and absent in several biotype 2 strains (data not shown). The plasmid-borne sequences seq10, seq25, and seq51 were biotype 2 specific since all biotype 2 strains, irrespective of the serovar, gave a positive reaction with the primer pairs derived from them (Table 4). This result suggests that the plasmids may be associated with virulence for eels. We are currently isolating derivatives of some biotype 2 strains that are cured of their plasmids, and we will test such strains for their virulence in eels. On the other hand, the primer pairs derived from seq23, seq61, and seq67, which were located on the chromosome, reacted only with serovar E strains (Table 4). In summary, by using SSH we identified the DNA sequences
of V. vulnificus that are specific for biotype 2 and biotype 2 serovar E strains. These sequences are potentially useful for developing a multiplex PCR method for the diagnosis of eel vibriosis caused by V. vulnificus and for the detection of biotype 2 serovar E strains. The sequences common to biotype 2 strains appeared to be plasmid borne, suggesting that the virulence of this bacterium in eels may be acquired by horizontal transfer of a virulence plasmid. Nucleotide sequence accession numbers. The GenBank accession numbers for the biotype 2-specific sequences are AY757304 (seq5), AY691407 (seq10), AY757305 (seq12), AY691410 (seq23), AY691408 (seq25), AY691409 (seq51), AY691411 (seq61), and AY691412 (seq67).
TABLE 3. Primer sequences derived from the tester-specific sequences obtained from SSH Primer
Derivation (sequence)
Sequence (5⬘–3⬘)
Length (bases)
Product size (bp)
VF05 VR05 VF10 VR10 VF12 VR12 VF23 VR23 VF25 VR25 VF51 VR51 VF61 VR61 VF67 VR67
seq5 seq5 seq10 seq10 seq12 seq12 seq23 seq23 seq25 seq25 seq51 seq51 seq61 seq61 seq67 seq67
AACCACATCCAAGACTCTCGCC ACTTAAACACCACTGTGCCTCC CATCACTCAACTTCTCGACTCC AGCATCTCACCACGACGAC CGTGTTGATTTTATCCGCCTCC ACTCTCTCCCGTTATCTGCC ACATAAGGGGGACGGAGAG CCCCGCCAAAACATAAACAG GCCAAGTGCTAATCCATCC TGCTCAAAGCCATACTCTCC GGACAGATACAAGGGCAAATGG AGAGATGGAAGAAACAGGCG CGCGCTTAGATTTGTCTCACC TGTTGTTCTTGCCCACTCTC AAAGCCACACAGACGGAC CACCGCTGAATATCACGAG
22 22 22 19 22 20 19 20 19 20 22 20 21 20 18 19
193 384 466 495 411 344 665 462
BIOTYPE 2 V. VULNIFICUS-SPECIFIC DNA SEQUENCES
VOL. 71, 2005 TABLE 4. Summary of the PCR results for V. vulnificus strains tested with primer pairs derived from various biotype 2-specific DNA sequences Biotype or serovar
10.
Primer pair derived from:
na seq10
seq25
seq51
seq23
seq61
seq67 11.
Eel avirulent Biotype 1 Biotype 3 Eel virulent (biotype 2) Serovar E Serovar A Serovar O3 Serovar O3/O4 Other serovarc
b
57 7
0 0
0 0
0 0
0 0
0 0
0 0
32 9 2 2 2
32 9 2 2 2
32 9 2 2 2
32 9 2 2 2
32 0 0 0 0
32 0 0 0 0
32 0 0 0 0
12. 13. 14.
a
Total number of strains tested. Number of strains that produced a PCR product of the predicted size. c Nontypeable with the antisera against serovars A and E. b
15.
This work was supported in part by grant NSC 89-2320-B-006-018 from the National Science Council, Taiwan, Republic of China, and by grant AGL2002-01291 from the Spanish Ministry of Science and Technology.
16. 17.
REFERENCES 1. Akopyants, N. S., A. Fradkov, L. Diatchenko, J. E. Hill, P. D. Siebert, S. A. Lukyanov, E. D. Sverdlov, and D. E. Berg. 1998. PCR-based subtractive hybridization and differences in gene content among strains of Helicobacter pylori. Proc. Natl. Acad. Sci. USA 95:13108–13113. 2. Amaro, C., B. Fouz, E. G. Biosca, E. Marco-Noales, and R. Collado. 1997. The lipopolysaccharide O side chain of Vibrio vulnificus serovar E is a virulence determinant for eel. Infect. Immun. 65:2475–2479. 3. Amaro, C., and E. G. Biosca. 1996. Vibrio vulnificus biotype 2, pathogenic for eels, is also an opportunistic pathogen for humans. Appl. Environ. Microbiol. 62:1454–1457. 4. Amaro, C., E. G. Biosca, B. Fouz, E. Alcaide, and C. Esteve. 1995. Evidence that water transmits Vibrio vulnificus biotype 2 infections to eels. Appl. Environ. Microbiol. 61:1133–1137. 5. Amaro, C., E. G. Biosca, C. Esteve, B. Fouz, and A. E. Toranzo. 1992. Comparative study of phenotypic and virulence properties in Vibrio vulnificus biotypes 1 and 2 obtained from a European eel farm experiencing mortalities. Dis. Aquat. Org. 13:29–35. 6. Biosca, E. G., C. Amaro, E. E. Alcaide, and E. Garay. 1991. First record of Vibrio vulnificus biotype 2 from diseased European eel, Anguilla anguilla L. J. Fish Dis. 14:103–109. 7. Biosca, E. G. 1994. Seroepizootiologı´a y virulencia de Vibrio vulnificus biotipo 2. Ph.D. thesis. Universidad de Valencia, Valencia, Spain. 8. Biosca, E. G., C. Amaro, J. L. Larsen, and K. Pedersen. 1997. Phenotypic and genotypic characterization of Vibrio vulnificus. Proposal for the substitution of the subspecific taxon biotype for serovar. Appl. Environ. Microbiol. 63:1460–1466. 9. Biosca, E. G., J. D. Oliver, and C. Amaro. 1996. Phenotypic characterization of Vibrio vulnificus biotype 2, a lipopolysaccharide-based homogeneous O-
18. 19. 20. 21. 22.
23.
24. 25. 26.
5597
serogroup within Vibrio vulnificus species. Appl. Environ. Microbiol. 62:918– 927. Bisharat, N., V. Agmon, R. Finkelstein, R. Raz, G. Ben-Dror, L. Lerner, S. Soboh, R. Colodner, D. N. Cameron, D. L. Wykstra, D. L. Swerdlow, J. J. Farmer III, et al. 1999. Clinical, epidemiological, and microbiological features of Vibrio vulnificus biogroup 3 causing outbreaks of wound infection and bacteremia in Israel. Lancet 354:1421–1424. Bogush, M. L., T. V. Velikodvorskaya, Y. B. Lebedev, L. G. Nikolaev, S. A. Lukyanov, A. F. Fradkov, B. K. Pliyev, M. N. Boichenko, G. N. Usatova, A. A. Vorobiev, G. L. Anderson, and E. D. Sverdlov. 1999. Identification and location of differences between Escherichia coli and Salmonella typhimurium genomes by suppressive subtractive hybridization. Mol. Gen. Genet. 262: 721–729. Bullen, J. J., P. B. Spalding, C. G. Ward, and J. M. Gutteridge. 1991. Hemochromatosis, iron and septicemia caused by Vibrio vulnificus. Arch. Intern. Med. 151:1606–1609. Centurion-Lara, A., C. Castro, and L. Barrett. 1999. Treponema pallidum major sheath protein homologue TprK is a target of opsonic antibody and the protective immune response. J. Exp. Med. 189:647–656. DeShazer, D., D. M. Waag, D. L. Fritz, and D. E. Woods. 2001. Identification of a Burkholderia mallei polysaccharide gene cluster by subtractive hybridization and demonstration that the encoded capsule is an essential virulence determinant. Microb. Pathog. 30:253–269. Diatchenko, L., Y. C. Lau, A. P. Campbell, A. Chenchik, F. Moqadam, B. Huang, S. Lukyanov, K. Lukyanov, N. Gurskaya, E. D. Sverdlov, and P. D. Siebert. 1996. Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc. Natl. Acad. Sci. USA 93:6025–6030. Høi, L. 1998. Vibrio vulnificus in Denmark: occurrence, isolation and characterization. Ph.D. thesis. The Royal Veterinary and Agricultural University, Frederiksberg, Denmark. Høi, L., I. Dalsgaard, A. DePaola, R. J. Siebeling, and A. Dalsgaard. 1998. Heterogeneity among isolates of Vibrio vulnificus recovered from eels (Anguilla anguilla) in Denmark. Appl. Environ. Microbiol. 64:4676–4682. Lai, Y. C., S. L. Yang, H. L. Peng, and H. Y. Chang. 2000. Identification of genes present specifically in a virulent strain of Klebsiella pneumoniae. Infect. Immun. 68:7149–7151. Lewin, A., B. Bert, A. Dalsgaard, B. Appel, and L. Høi. 2000. A highly homologous 68 kbp plasmid found in Vibrio vulnificus strains virulent for eels. J. Basic Microbiol. 40:377–384. Muroga, K., Y. Jo, and M. Nishibuchi. 1976. Pathogenic Vibrio isolated from cultured eels. I. Characteristics and taxonomic status. Fish Pathol. 11:141– 145. Sanjua ´n, E., and C. Amaro. 2004. A protocol for the specific isolation of Vibrio vulnificus serovar E (biotype 2) from environmental samples. Appl. Environ. Microbiol. 70:7024–7032. Song, Y. L., W. Chen, C. H. Shen, and H. H. Sung. 1990. Occurrence of Vibrio vulnificus infections in cultured shrimp and eel in Taiwan, p. 172–179. In Proceedings of the ROC-Japan Symposium on Fish Diseases. National Science Council, Taipei, Republic of China. Tinsley, C. R., and X. Nassif. 1996. Analysis of the genetic differences between Neisseria meningitidis and Neisseria gonorrhoeae: two closely related bacteria expressing two different pathogenicities. Proc. Natl. Acad. Sci. USA 93:11109–11114. Tison, D. L., M. Nishibuchi, J. D. Greenwood, and R. J. Seidler. 1982. Vibrio vulnificus biogroup 2: new biogroup pathogenic for eels. Appl. Environ. Microbiol. 44:640–646. Warnock, E. W., and T. L. MacMath. 1993. Primary Vibrio vulnificus septicemia. J. Emerg. Med. 11:153–156. Zhang, Y. L., C. T. Ong, and K. Y. Leung. 2000. Molecular analysis of genetic differences between virulent and avirulent strains of Aeromonas hydrophila isolated from diseased fish. Microbiology 146:999–1009.
