Hormonal Control of Growth Factor Receptor Expression

PDFlib PLOP: PDF Linearization, Optimization, Protection Page inserted by evaluation version www.pdflib.com – [email protected]

Hormonal Control of Growth Factor Receptor Expression” MICHELE DE BORTOLT, PIERA MAGGIORA,h DANIELA CAPELLO, SUSANNA ANTONIOTTI,b SILVIA SAVIOZZI, MARIA LUISA SAPEI, AND CLAUD10 DATI Department of Animal Biology Laboratory of Molecular Cell Biology University of Turin 10123 Turin, Italy

INTRODUCTION Hormone-dependent breast cancer represents a paradigm for the role of hormones in cancer development. The primary role of estrogens in breast cancer development and progression is firmly established by a wide collection of clinical, experimental, and biological data. Estrogens are physiologic mitogens for mammary cells, playing a fundamental role in the ductal and lobulo-alveolar development of the mammary gland. During the first steps of malignant transformation, cells exploit this mitogenic action, which accompanies the progressive accumulation of genetic alterations, such as erbB-2 amplification and p53 deletion.’.* Homogeneous expression of estrogen receptors (ER) is always seen in nonmalignant atypic hyperproliferative diseases of the breast, and three out of four in situ ductal carcinomas possess ER.3.4 Invasive cancers can thereafter become independent from estrogens, likely through the acquisition of further genetic change^,^ yet about one-third of invasive breast carcinomas are responsive to antiestrogenic therapy,6testifying that even fully neoplastic cells can require an estrogenic stimulus to proliferate and invade. Estrogen stimulates mammary cell growth by diverse and complementary mechanisms. DNA synthesis occurs early after treatment of the cells with estrogen, preceded by transcriptional activation of several “early genes,” including transcriptional regulators such as fos, jun (AP-I), m y c , and myb. In addition, estrogen profoundly influences cell-cell communication and stromalepithelial interaction, by increasing autocrine and paracrine positive growth factor (e.g., TGF-a, IGFs) as well as repressing negative growth factor (e.g., TGF-P) secretion (reviewed in reference 7). In this report, we describe an additional way by which hormones can control cell growth, that is, by modulating the expression of (oncogenic) growth factor receptor expression.

a

This work was funded in part by AIRC grants. Recipients of an AIRC fellowship. 336

DE BORTOLI ef of.: HORMONAL CONTROL

337

THE erbB-2 TYROSINE KINASE RECEPTOR ONCOGENE The erbB-2 oncogene, also known as neu or HER-2, encodes a 185-kDa transmembrane protein whose primary structure classifies it as a tyrosine kinase growth factor receptor of the EGF receptor (EGFR) family.8 erbB-2 was originally identiHere, a single point fied as the transforming oncogene of a rat neurobla~toma.~ mutation in the transmembrane region conferred the protein with constitutive kinase activity. This mode of activation has not been found in human cancers. Instead, amplification of the erbB-2 oncogene is frequently observed in human adenocarcinomas of the breast, ovary, lung, pancreas, and stomach, where it appears to behave as a genuine oncogene; that is, it increases tumor growth rate and metastatic capability. Extensive reviews on erbB-2 have been recently published.lO.l’erbB-2 has remained for several years an “orphan” receptor. In 1992, peptide ligands capable of binding to and activating erbB-2 were independently cloned by different These ligands, called NDF (neu differentiation factor) or HRG (heregulin), were found identical to factors known as GGF (glial growth factors) and ARIA (acetylcholine receptor inducing activity). The ten different variants identified arise from differential splicing of one or two transcripts from a single gene, called neuregulin (reviewed in reference 14). Not all the cells expressing erbB-2, though, respond to NDFs, suggesting that some cooperating molecule is needed for erbB-2 activation by NDFs. Studies with recombinant erbB-2 proteins have in fact demonstrated that erbB-2 alone does not make a functional NDF r e ~ e p t 0 r . I ~ The successive discovery that two further members of the EGFR family, erbB-3 and erbB-4, also bind and are activated by NDFs,I6,l7together with reconstitution experiments in insect cells, led to the current understanding of the system,’* as follows: erbB-2 forms high-affinity NDF receptors in a heterodimeric arrangement with either erbB-3 or erbB-4, whereas homodimers formed by erbB-3 or erbB-4 alone represent NDF receptors with variable affinity. It is interesting to note that, even though erbB-2 homodimers do not bind NDFs and erbB-2 does not appear to be an absolute requirement to form NDF receptors in artificial systems, its expression is necessary to obtain responses to NDF in breast cancer cells.19 This model also has important implications for the intracellular signaling pathways that are activated in response to NDFs. In fact, erbB-2 is the most-active kinase of the family, whereas erbB-3 lacks tyrosine kinase activity, but is the sole member of the family capable of binding the SH2-containing substrate PI-3-kinase.I8 erbB-2 also heterodimerizes with the EGFR, giving aform of high-affinity EGF receptor.*O Thus, erbB-2 is part of a receptor network, whose composition presumably reflects the relative level of expression of the different genes in each individual cell.

erbB-2 IN BREAST CANCER Amplification of the erbB-2 gene was found in 25-30% of breast cancers, associated with poor clinical outcome, by Slamon et al. in 1987.21Since then, an impressive number of papers have reported erb B-2 amplification and overexpression in 2640% of human primary breast cancers and its association with high nuclear grade, high S-phase fraction, negativity for steroid receptors, and shorter overall and disease-free patient survival. Due to its association with many negative prognostic factors, it is still questioned if erbB-2 can have an independent prognostic value, in particular for node-negative breast cancer (for reviews, see refer-

338

ANNALS NEW YORK ACADEMY OF SCIENCES

ences 22 and 23). erbB-2 gene amplification is usually accompanied by overexpression of the erbB-2 protein. However, from the examination of a number of primary breast carcinoma specimens and breast cancer cell lines, it has become clear that there is no strict quantitative correlation between gene copy number and the level of erbB-2 expression. Several cases were also found showing erbB-2 overexpression in the absence of gene a m p l i f i c a t i ~ n . ~These ~ - ~ ~ results imply the existence of mechanisms controlling erbB-2 expression in breast cancer cells other than gene amplification. This fact, together with the inverse relationship of erbB-2 amplification to steroid receptor status, led us to examine the possible regulation of erbB-2 by hormones.

ESTROGENS INHIBIT erbB-2 EXPRESSION IN ER+ BREAST CANCER CELLS Treatment of ER+ breast cancer cells, cultured in an estrogen-free medium, with 10 nM 17P-estradiol leads to a progressive decrease of erbB-2 rnRNA and protein levels, which is appreciable already 5-6 hours after the start of the treatment. The erbB-2 expression level keeps decreasing up to 5 to 6 days of treatment, reaching an overall inhibition of 70-80%.27,28Inhibition of erbB-2 expression by estrogen was observed not only in uirro, but also using xenografts of human breast cancer cells in nude mice.29In both model systems, the effect of estrogens was limited to ER+ cells and was completely reversed by a n t i e ~ t r o g e n s It . ~also ~~~~ has been reported that estrogen-activated estrogen receptors inhibit erbB-2 expression in cells carrying multiple copies of the erbB-2 gene.3’ These results provided the first conceptual framework to understand the inverse relationship of steroid receptors to erbB-2 amplification in breast carcinomas; that is, in the presence offunctional ER, the amplification of erbB-2 may not be selected as a dominant oncogenic function, its expression being consistently inhibited by estrogens. In fact, very high levels of expression seem necessary for erbB-2 to function as an oncogene.32 As a second consideration, these results might alert about the use of tamoxifen whenever erbB-2 amplification is present in the tumor. This has also been warned for by clinical studies showing that tumors with erbB-2 amplification respond very poorly to tamoxifen treatment.33 Whereas the above-mentioned results from xenografts are clear-cut about the stimulatory effect of tamoxifen on erbB-2 expresion,'^ measurements made in patients of breast cancer were definitely less straightforward on this subject. Le Roy et al.34have measured the erbB-2 mRNA levels in tumors from two groups of patients, receiving or not a two-week treatment with tamoxifen, before tumor resection. In tumors from tamoxifen-treated patients, the erbB-2 level was lower than in tumors from untreated patients, but only in ER-negative tumors (!). Clearly, the action of tamoxifen in uiuo is not restricted to a direct antiestrogenic effect on tumor cells. Effects on stromal-epithelial interaction are known (e.g., stimulation of TGF-P) and this may account for the abovedescribed results. On the other hand, Johnston et have measured the erbB-2 protein levels by imrnunohistochemistry in ER+ breast tumors from patients pretreated with tamoxifen and have observed a significant increase of the erbB-2 level. However, erbB-2 immunoreactivity was largely cytoplasmic, suggesting either that the newly synthesized erbB-2 protein is not correctly processed or that it is rapidly utilized and, consequently, internalized in tumor cells from tamoxifentreated patients.

DE BORTOLI ct al.: HORMONAL CONTROL

-3975

-3236

-2205

-1391

339

+326

I I

rl

intmn I(7.5 Kbp) +1

SmaI PstI -673 -391

ATG

I I .1 This done integrated in T47D.3A

CAT gene CAT gene CAT gene

I I I

CAT eene

I I

CAT gene

I

CAT pene

FIGURE 1. Map of the 5' side of the human erbB-2 gene, showing the location of the first exon and intron, the transcriptional starting site, and several restriction sites used to produce a set of progressive deletant constructs. The 1.2-kb fragment, amplified by PCR,fused to CAT, and stably transfected into T47D cells for the studies summarized in TABLE is also mapped along with other constructs.

erbB-2 EXPRESSION IN MAMMARY CELLS IS CONTROLLED BY MULTIPLE FACTORS ACTING AT DIFFERENT MOLECULAR LEVELS Examination of erbB-2 expression in the developing rat mammary gland during pregnancy and lactation led to a quite singular result: while the level of immunoblotting-detectable erbB-2 protein increases dramatically during pregnancy, peaks just after delivery, and keeps high in lactating glands,27the mRNA level, measured by Northern blot, varies only to a limited extent, peaking at middle pregnancy and returning to basal levels in lactating glands; this result was confirmed more recently by in situ techniques (Dati et al., submitted). This implies that erbB-2 expression is controlled at some posttranscriptional level in the differentiating mammary cells. Results described above are consistent with data obtained on the normal mouse mammary epithelial cell line HC11, which can be induced to differentiate and to express caseins in vitro by treatment with dexamethasone, insulin, and p r ~ l a c t i n The . ~ ~ erbB-2 protein level is low in cells proliferating under EGF + insulin stimulus, but rapidly increases when the cells reach confluence and stop growing, and can be further increased by the differentiating hormone

ANNALS NEW YORK ACADEMY OF SCIENCES

340

mixture. Pulse-chase experiments showed that the erbB-2 protein half-life in confluent and differentiated cells is about fivefold that of proliferating cells, where it is rapidly internalized to the endosomal compartment and degraded.j7 On the basis of these results, we have examined the effects of several growth-modulatory agents on different parameters of erbB-2 metabolism, that is, the steady-state level of protein and mRNA and the transcriptional activity of the erbB-2 gene promoter.3s To this purpose, a 1.2-kb fragment of the human erbB-2 gene, including the transcriptional promoter, was amplified by PCR on the basis of the published sequencej9 and was cloned into the reporter vector pBLCAT3, upstream of the bacterial chloramphenicol acetyl transferase (CAT) gene (FIGURE 1). By cotransfection with the pSV2neo plasmid, T47D cell derivatives were obtained carrying the erbB-2 promoter-CAT construct stably integrated. As shown in TABLE1, some of the tested factors showed a concordant action on the three parameters measured. First, estrogens inhibited erbB-2 protein and mRNA expression and erbB-2 promoter activity to comparable extents. Progesterone was a slight stimulator and DBcAMP was a strong stimulator at either level. In breast cancer cells, confluence led to a strong enhancement of erbB-2 promoter activity and erbB-2 protein expression, which was in contrast with HCI 1 cells, where the erbB-2 mRNA level was unchanged by confl~ence.~'This may flag a difference between normal and neoplastic mammary cells. Other factors, like TPA and retinoic acid, showed discordant results, suggesting perhaps effects at different metabolic levels. EGF strongly reduced the erbB-2 protein level, but did not decrease (rather it slightly stimulated) erbB-2 mRNA expression and erbB-2 promoter activity. If one looks just at the resulting level of the erbB-2 protein in cells treated with the different factors, one conclusion seems quite reasonable, that is, that erbB-2 protein level is low in actively proliferating cells, while conditions that arrest cell growth lead to enhanced erbB-2 levels. However, comparison of the mechanisms by which estrogens and EGF downregulate the erbB-2 protein level in breast cancer cells ruled out the possibility of a common, growthrelated, regulatory mechanism.4 EGF and estrogen have a comparable mitogenic effect on T47D and ZR75.1 human breast cancer cells. Both induce, at concentra-

TABLE I. Effects of Various Agents on the erbB-2 Protein and mRNA Levels

and on the erbB-2 Promoter Activity in Breast Cancer Cells" Treatment

Growth

Promoter

RNA

Protein

4 , Estradiol I? V vv EGF T-P Prolactin 5. 1 Progestin t tt n.a. Insulin t Retinoic acid 1 t -1 TPA V t CAMP V t t t Cell density V n.a. +I? erbB-2 protein was assayed by immunoblotting and erbB-2 mRNA by Northern blotting. Transcriptional activity of the 1.2-kb erbB-2 promoter was evaluated in stable derivatives of T47D human breast cancer cells, carrying an integrated 1.2-kb erbB-2 promoter-CAT 1). n.a. = not analyzed. (Modifiedfrom reference 38, with permission.) construct (see FIGURE

vv

**

DE BORTOLI er al.: HORMONAL CONTROL

CM

341

SM

p185

FIGURE 2. Effect of a three-day treatment of ZR75.1 cells with 10 nM 17P-estradiol and 10 ng/mL EGF on the level of erbB-2 protein and mRNA, as measured by immunoblotting and Northern blotting, respectively. Estrogen effect is visible only by culturing the cells in estrogen-deprived media (SM) [DMEM without phenol red with 10% dextran-coated, charcoal-stripped fetal calf serum (FCS)]. EGF effect is visible also in estrogenic media (CM) (DMEM with phenol red and 10% untreated FCS). (Reprinted from reference 40, with permission .)

tions consistent with the affinities of their respective receptors, comparable downregulation of the erbB-2 protein. In contrast to estrogens, EGF did not induce a parallel decrease of erbB-2 mRNA; rather, it enhanced it by 20-30%, that is, to an extent comparable to the effect seen on the human erbB-2 promoter (FIGURE 2).38 We showed that EGF induces a rapid tyrosine phosphorylation of erbB-2, which is accompanied by activation of its kinase. In HCll cells, it has been shown that EGF-induced erbB-2 phosphorylation is followed by rapid cointernalization of EGFR and erbB-2 and d e g r a d a t i ~ n In . ~ ~breast cancer cells that overexpress both receptors, a direct proof of heterodimerization has also been ~ b t a i n e d . ~From ' these indications, it can be concluded that EGF downregulation of the erbB-2 protein level is due to the direct interaction of EGFR and erbB-2, leading to rapid erbB-2 degradation.

ANNALS NEW YORK ACADEMY OF SCIENCES

342

ESTROGENIC REPRESSION OF erbB-2 IS MEDIATED BY cis ELEMENT(S) WITHIN ITS PROMOTER Conversely, downregulation of erbB-2 by estrogen is clearly due to transcriptional repression. The ultimate proof of this was obtained by “run-on” analysis, showing that the endogenous erbB-2 gene transcription rate in nuclei from ZR75.1 cells treated with estrogens is one-third of that in untreated cells.40Therefore, we decided to localize the cis elements in the erbB-2 promoter that mediate estrogen inhibition in order to get insights into the transcription factors and, consequently, the metabolic pathways implicated in this response. An extended 5’ fragment of the human erbB-2 gene was isolated from a human genomic library in EMBL3. A 4-kb fragment extending upstream of the transcriptional starting site was sub-

E2P.PP.CAT

+

+

RSV.CAT

+

Treatment

CAT activity

SM

0.097 2 0.038

+

Ei. 1

k k l 1 I :::1 I 17fl-Estradiolin SM

0.042 f 0.012

CM

0.115 2 0.023

I EGF in CM

0.451 & 0.099

FIGURE 3. Transcriptional response to estrogen and EGF of a 220-bp proximal fragment of the human erbB-2 promoter (FIGURE 4) fused to the CAT gene (EZP.PP.CAT), in transient transfection in T47D cells. Here, 25 pg of pE2P.PP.CAT and 5 pg of the estrogen receptor expression vector pHEO were transfected on sparse T47D cells by the calcium phosphate method. Treatment with 10 nM 17p-estradiol or 10 ng/mL EGF was started immediately. Cells were lysed 60 hours after transfection and CAT activity was evaluated by I4C-chloramphenicol acetylation and TLC. Values represent the mean and standard deviation of three independent experiments. The Rous sarcoma virus promoter, fused to CAT (RSV.CAT), was used as control. f.i. = fold induction. (Reprinted from reference 40, with permission.)

DE BORTOLI et al.: HORMONAL CONTROL

343

............ FP3. ............

-422

..........pBLCAT3 ........CTGCAGGCAACCCAGGCGTCCCGGC Pst I

- 3 1 2 GCTAGGAGGGACGACCCAGGCCTGCGCGAAGAGAGGGAGAA?iGTGAAGCT AP 2 FP2 - 3 2 2 GGGAGTTGCCGACTCCCAGACTTCGTTGGAATGCAGTTGGAGGGGGCGAG

.....

.....

...........

...........

E 1A

.............F P l . . . ......... - 2 7 2 CTGGGAGCGCGCTTGCTCCECACAGGAGAAGGAGGAGGTGGAGGAGG

5'FWA -222 AGGGCTGCTTGAGGAAGTATAAGAATGAAGTTGTGAAGCTGAGATTCCCC .)

-172

TCCATTGGGACCGGAGAAACCAGGGGAGCCCCCCGGGCAGCCGCGCGCCC

- 1 2 2 CTTCCCACGGGGCCCTTTACTGCGCCGCGCGCCCGGCCCCCACCCCTCGC AP2 -12

AGCACCCCGCGCCCCGCGCCCTCCCAGCCGGGTCCAGCCGGAGCCATGGG

-22

GCCGGAGCCGCAGTGAGCACCATGGAGCTGGCGGC

.... exon

I.....

FIGURE 4. Nucleotide sequence of the human erbB-2 promoter and untranslated leader. The initiation codon ATG is shown in bold, as well as the adenine at -178, the major transcriptional start site. TATA and CAAT boxes are bold and underlined. The sequence of the first exon is underlined, as well as potential regulatory elements throughout the promoter. The footprinted sequences FPl, FP2, and FP3, reported in reference 44, are shown by dots. A TCI-TCII element at -323 to -316 is also dotted. The Pst I site at -397 was used for cloning into pBLCAT3. The E2P.PP.CAT construct includes sequences from -397 to -178, to which a BamHI site was added for subcloning.

cloned into the pBLCAT3 vector, and several 5' deletants were produced (FIGURE1). These constructs were analyzed in transient transfection in T47D and ZR75.1 cells (Antoniotti et a / . , in preparation). By this method, we observed that the repressing effect of estrogens is entirely contained in the shorter construct (E2P.PP.CAT) (FIGURE3), which contains the 220 bp directly upstream of the transcriptional starting site, at nucleotide - 178 from the initiator codon ATG. Accordingly, it has been shown that a corresponding fragment of the rat neu gene promoter is fully repressed by the estrogen-activated estrogen r e ~ e p t o r . ~ ' This 220-bp fragment of the human erbB-2 promoter (E2P.PP) does not contain sequences similar to the consensus ERE element. This is not surprising because transcriptional repression by steroid receptors is usually mediated by interaction with other transcription factors, as exemplified in the case of GR/AP-l (for review, see reference 42). Examination of the nucleotide sequence reveals several potential regulatory elements (FIGURE4), including AP-2, E4TF1, k-enhancer, myb consensus sequences, an SV40 TCI-TCII motif, and others, in addition to the basal

ANNALS NEW YORK ACADEMY OF SCIENCES

344

elements TATA, CAAT, Oct-1, and Spl. A comparison of the human, rat, and mouse erbB-2 promoters has been published.43The proximal region of the three promoters is extremely conserved. Curiously, however, the mouse and rat promoters lack the TATA box and have multiple transcriptional start sites. This may reflect an important difference in the regulation of rodent versus human neul erbB-2 genes. The constructs described in FIGURE 1 were engineered to contain a BamHI site at the transcriptional start site, for cloning into the pBLCAT3 plasmid. In order to verify that this introduced sequence was not responsible for estrogen repression, we prepared a further reporter construct, carrying sequences from -397 (Pst I site) to +1 (ATG) of the human erbB-2 promoter, cloned into the Xho I site of pBL3CAT. This construct was equally repressed by estrogens, demonstrating that the cloning procedures did not introduce abnormal sensitivity in our constructs (not shown). In addition, we can conclude that sequences in the untranslated leader do not influence transcriptional regulation of the ~ r b B - 2 promoter by estrogens. The promoter region of human erbB-2 binds three major protein complexes in covering sequences breast cancer cells, as demonstrated by footprinting from -404 to -378 (FP3), from -297 to -273 (FP2), and from -257 to -230 4 and 5). These sites are therefore the most likely targets of (FP1) (FIGURES regulation. In order to further localize the negative estrogen response element in the erbB-2 promoter, we have produced further deletants of the E2P.PP.CAT 5 , show that removal of construct. Preliminary results, summarized in FIGURE the distal fragment of E2P.PP.CAT can abolish estrogenic repression. This approximately 70-bp fragment contains a canonic AP-2 element, besides unperfect Spl sequences. In addition, the above-described FP3 region44contains a binding site

Construct

Response to estrogen

CAT

FPI

-CAT

.c

TATA

-

TATA

-

-CAT

FIGURE 5. Map of deletant constructs obtained from the minimal E2P.PP.CAT erbB-2 promoter reporter vector. Positions of the footprinted sequences are indicated, as reported in reference 44.A summary of their response to estrogenic treatment, in transient transfection in ZR75.1 cells, is shown. Transfections and CAT evaluation were as described in the legend to FIGURE 3.

DE BORTOLI et at.: HORMONAL CONTROL

345

for the OB2.1 transcription factor, which has been recently identified as the developmentally regulated AP-2 factor.45 It may be important to note that AP-2 can mediate transcriptional responses to either CAMP-dependent or C-type protein kinases.& Mutants of these potential elements are being analyzed in our laboratory and will allow localization of the erbB-2 estrogen-dependent repressor.

SUMMARY In this report, we have discussed a series of results obtained in our laboratory that, together with data by other authors, demonstrate that the expression of the erbB-2 tyrosine kinasc receptor oncogene in breast cancer cells is regulated by multiple factors and hormones, which modulate their growth and differentiation. In particular, we have shown that estrogens specifically inhibit erbB-2 expression by transcriptional repression, which is exerted through a sequence within the erbB-2 gene promoter. Estrogens control mammary cell growth directly, by inducing early gene expression, and indirectly, by increasing autocrine growth factor production or decreasing growth inhibitors. The data presented here suggest that mammary cells respond to estrogen also by modifying the receptor array on their surface, thus setting their own sensitivity to the different autocrine and paracrine factors. As a first consequence, the modulation of erbB-2 expression level by antiestrogen may represent a point to consider when selecting breast cancer patients for hormonal therapy, in those (few) cases where estrogen receptor positivity accompanies erbB-2 amplification. On the other hand, antiestrogen-induced upregulation of erbB-2 may improve tumor targeting of drugs designed to interact or interfere with erbB-2, such as humanized antibodies, immunotoxins, or engineered ligands. These possibilities should be tested in appropriate model systems in the future.

ACKNOWLEDGMENTS Part of the work described here was obtained in collaboration with Daniela Taverna and Nancy E. Hynes (FMI, Basel, Switzerland), whose contributions are gratefully acknowledged. REFERENCES 1. BARNES, D. M. 1993. c-erbB-2 amplification in mammary carcinoma. J. Cell. Biochem. SUPPI. 17G: 132-138. 2. POLLER,D. N., E. C. ROBERTS,J. A. BELL,C. W. ELSTON,R. W. BLAMEY & I. 0. ELLIS.1993. p53 protein expression in mammary ductal carcinoma in situ: relationship to immunohistochemical expression of estrogen receptor and c-erbB-2 protein. Hum. Pathol. 24: 463-468. 3. BARNES,R. & S. MASOOD.1990. Potential value of hormone receptor assay in carcinoma in situ of breast. Am. J. Clin. Pathol. 94:533-537. 4. NENCI,I., E. MARCHETTI & P. QUERZOLI. 1988. Commentary on human mammary preneoplasia: the estrogen receptor promotion hypothesis. J. Steroid Biochem. 30: 105-106.

ANNALS NEW YORK ACADEMY OF SCIENCES

346 5.

6.

7. 8. 9. 10. 11.

12.

13.

14. 15.

16.

17. 18.

19. 20. 21. 22. 23. 24.

VIJVER,M. J. 1993. Molecular genetic changes in human breast cancer. Adv. Cancer Res. 61:25-56. TRIALISTS’ COLLABORATIVE GROUP.1992. Systemic treatment EARLYBREASTCANCER of early breast cancer by hormonal, cytotoxic, or immune therapy: 133 randomised trials involving 31 ,000 recurrences and 24,000 deaths among 75,000 women. Lancet 339: 71-85. DICKSON, R. B., E. W. THOMPSON & M. E. LIPPMAN.1990. Regulation of proliferation, invasion, and growth factor synthesis in breast cancer by steroids. J. Steroid Biochem. Mol. Biol. 37: 305-316. 1990. Signal transduction by receptors with tyrosine ULLRICH,A. & J. SCHLESSINCER. kinase activity. Cell 61: 203-212. BARCMANN, C. I., M. C. HUNG& R. A. WEINBERG.1986. Multiple independent activation of the neu oncogene by a point mutation altering the transmembrane domain of p185. Cell 4 5 649-657. DOUGALL,W. C., X. QIAN,N. C. PETERSON,M. J. MILLER,A. SAMANTA & M. 1. GREENE.1994. The neu-oncogene: signal transduction pathways, transformation mechanisms, and evolving therapies. Oncogene 9: 2109-2123. JARDINES,L., M. WEISS, B. FOWBLE & M. GREENE.1993. Neu (c-erbB-2/HER2) and the epidermal growth factor receptor (EGFR) in breast cancer. Pathobiology 61: 268-282. S. S. BACUS,Y. Luo, G. TRAIL.S. H u , WEN, D., E. PELES,R. CUPPLES,S. SUCGS, S . M. SILBICER,R. BENLEVY,R. A. KOSKI,H. S. L u & Y. YARDEN.1992. Neu differentiation factor: a transmembrane glycoprotein containing an E G F domain and an immunoglobulin homology unit. Cell 69: 559-572. R. W. AKITA,W. J. HENZEL,J. LEE, J. K. HOLMES,W. E., M. X. SLIWKOWSKI, PARK,D. YANSURA,N. ABADI,H. RAAB,G. D. LEWIS.H. M. SHEPARD,W. J. KUANC,W. I. WOOD,D. V. GOEDDEL& R. L. VANDLEN.1992. Identification of heregulin, a specific activator of p185 erbB-2. Science 256 1205-1210. PELES,E. & Y. YARDEN.1993. Neu and its ligands: from oncogene to neural factors. BioEssays 15: 815-824. TZAHAR, E.,G. LEVKOWITZ, D. KARUNAGARAN, L. YI, E. PELES,S . LAW,D. CHANG, N. LIU,A. YAYON,D. WEN& Y. YARDEN.1994. erbB3 and erbB4 function as the respective low and high affinity receptors of all neu differentiation factor/heregulin isoforms. J. Biol. Chern. 269 25226-25233. CARRAWAY, K. L., M. X. SLIWKOWSKI, R. AKITA, J. V. PLATKO,P. M. GUY, A. NUIJENS,A. J. DIAMONTI,R. L. VANDLEN, L. C. CANTLEY & R. A. CERIONE. 1994. The erbB3 gene product is a receptor for heregulin. J. Biol. Chem. 269: 1430314306. G. W. CARLTON, V. M. ROTHWELL PLOWMAN, G. D., J. M. GREEN,J.M. CULOUSCOU, & S. BUCKLEY. 1993. Heregulin induces tyrosine phosphorylation of HER4/p180ebB4. Nature 366: 473-475. CARRAWAY, K. L. & L. C. CANTLEY. 1994. A neu acquaintance for erbB3 and erbB4: a role for receptor heterodimerization in growth signaling. Cell 7 8 5-8. GRAUSPORTA, D., R. R. BEERLI& N. E. HYNES.1995. Single-chain antibody-mediated intracellular retention of erbB2 impairs neu differentiation factor and epidermal growth factor signaling. Mol. Cell. Biol. 1 5 1182-1 191. WADA,T., X. QIAN& M. I. GREENE.1990. Intermolecular association of the p185neu protein and E G F receptor modulates E G F receptor function. Cell 61: 1339-1347. SLAMON,D. J., G. M. CLARK,S. G. WONC, W. J. LEVIN,A. ULLRICH& W. L. MCGUIRE.1987. Human breast cancer: correlation of relapse and survival with amplification of the HER-2lneu oncogene. Science 235: 177-182. PERREN, T. J. 1991. c-erbB-2 oncogene as a prognostic marker in breast cancer. Br. J. Cancer 63: 328-332. HYNES,N. E. 1993. Amplification and overexpression of the erbB2 gene in human tumors: its involvement in tumor development, significance as a prognostic factor, and potential as a target for cancer therapy. Semin. Cancer Biol. 4: 19-26. M. GIAI, DATI, C., R. MURACA,0. TAZARTES,S. ANTONIOTTI,I. PERROTEAU, VAN DE

DE BORTOLI ef al.: HORMONAL CONTROL

25.

26. 27. 28. 29.

30. 31. 32. 33. 34. 35.

36. 37. 38. 39. 40.

347

P. CORTESE,P. SISMONDI, G . SAGLIO& M. DE BORTOLI.1991. c-erbB-2 and ras expression levels in breast cancer are correlated and show a cooperative association with unfavorable clinical outcome. Int. J. Cancer 47: 833-838. SLAMON, D. J., W. GODOLPHIN,L. A. JONES,J. A. HOLT, S. G . WONG,D. E. KEITH, J. UDOVE,A. ULLRICH& M. F . PRESS.1989. Studies W. J . LEVIN,S. G. STUART, of the HER-Zlneu proto-oncogene in human breast and ovarian cancer. Science 244: 707-712. & C. R. KING. 1987. Overexpression KRAUS,M.H., N. C. POPESCU,S. C. AMSBAUGH of the E G F receptor-related proto-oncogene erbB-2 in human mammary tumor cell lines by different molecular mechanisms. EMBO J. 6: 605-610. DATI, C., S. ANTONIOTTI,D. TAVERNA,1. PERROTEAU& M. DE BORTOLI.1990. Inhibition of c-erbB-2 oncogene expression by estrogens in human breast cancer cells. Oncogene 5: 1001-1006. 1990. Hormonal READ,L. R., D. KEITH,D. J. SLAMON& B. S. KATZENELLENBOGEN. modulation of HER-2/neu proto-oncogene messenger ribonucleic acid and p185 protein expression in human breast cancer cell lines. Cancer Res. 5 0 3947-3951. WARRI,A. M., A. M. LAINE,K. E . MAIASUO,K. K. ALITALO& P. L. HARKONEN. 1991. Estrogen suppression of erbB-2 expression is associated with increased growth rate of ZR-75-1 human breast cancer cells in v i m and in nude mice. Int. J. Cancer 4 9 616-623. ANTONIOTTI,S., P. MAGGIORA,C. DATI & M. DE BORTOLI.1992. Tamoxifen upregulates c-erbB-2 expression in estrogen-responsive breast cancer cells in uitro. Eur. J. Cancer 28: 318-321. RUSSEL,K. S. & M. C. HUNG)1992. Transcriptional repression of the neu protooncogene by estrogen-stimulated estrogen receptors. Cancer Res. 52: 6624-6629. PIERCE,J. H., P. ARNSTEIN,E . DIMARCO,J . ARTRIP,M. H. KRAUS,F. LONARDO, P. P. DI FIORE& S. A. AARONSON. 1991. Oncogenic potential of erbB-2 in human mammary epithelial cells. Oncogene 6 1189-1 194. BORG, A., B. BALDETORP,M. FERNO,D. KILLANDER,H. OLSON, S . RYDEN& H. SIGURDSSON. 1994. erbB2 amplification is associated with tamoxifen resistance in steroid-receptor positive breast cancer. Cancer Lett. 81: 137-144. J. SIMONY LE ROY, S., C. ESCOT,J. P. BROUILLET,C. THEILLET,T. MAUDELONDL, LAFONTAINE, H . PUJOL& H. ROCHEFORT.1991. Decrease of c-erbB-2 and c-myc RNA levels in tamoxifen-treated breast cancer. Oncogene 6: 43 1-437. J. SALTER, N . M. SACKS,J. A. MCKINNA, JOHNSTON,S. R. D., K. A. MCLENNAN, M. BAUM,I. E. SMITH& M. DOWSETT.1993. Tamoxifen induces the expression of cytoplasmic c-erbB2 immunoreactivity in estrogen-receptor positive breast carcinomas in v i v a Breast 2: 93-99. DOPPLER,W., B. GRONER& R. K. BALL.1989. Prolactin and glucocorticoid hormones synergistically induce expression of transfected p-casein gene promoter constructs in a mammary epithelial cell line. Proc. Natl. Acad. Sci. U.S.A. 86: 104-108. W. HOECK& N. E. HYNES.1992. Surface expression KORNILOVA, E. S., D. TAVERNA, of erbB-2 protein is post-transcriptionally regulated in mammary epithelial cells by epidermal growth factor and by the culture density. Oncogene 7: 51 1-519. TAVERNA,D., S. ANTONIOTTI,P. MAGGIORA,C. DATI, M. DE BORTOLI& N. E. HYNES.1994. erbB2 expression in estrogen receptor positive breast tumor cells is regulated by growth modulatory reagents. Int. J. Cancer 5 6 522-528. HUDSON,L. G., A. P. ERTL & G . N. GILL. 1990. Structure and inducible regulation of the human c-erbB2/neu promoter. J. Biol. Chem. 265: 4389-4393. ANTONIOTTI,S., D. TAVERNA,P. MAGGIORA,M. L. SAPEI, N . E . HYNES& M. DE BORTOLI.1994. Oestrogen and E G F down-regulate erbB2 oncogene protein expression in breast cancer cells by different mechanisms. Br. J. Cancer 70: 1095-1101.

41. 42.

GOLDMAN,R., R. BENLEVY,E . PELES& Y. YARDEN.1990. Heterodimerization of the erbB-l and erbB-2 receptors in human breast carcinoma cells: a mechanism for receptor transregulation. Biochemistry 2 9 11024-1 1028. WAHLI,W. & E. MARTINEZ.1991. Superfamily of steroid nuclear receptors: positive and negative regulators of gene expression. FASEB J . 5: 2243-2246.

348

ANNALS NEW YORK ACADEMY OF SCIENCES

43. WHITE, M. & M. C. HUNG. 1992. Cloning and characterization of the mouse neu promoter. Oncogene 7: 677-684. 44. HOLLYWOOD, D. P. & H . C. HURST. 1993. A novel transcription factor, OB2-1, is required for overexpression of the proto-oncogene c-erbB-2 in mammary tumor lines. EMBO J. 12: 2369-2375. & H. C. HURST.1995. The developmentally regulated 45. BOSHER,J. M., T. WILLIAMS transcription factor AP-2 is involved in c-erbB2 overexpression in human mammary carcinoma. Proc. Natl. Acad. Sci. U.S.A. 92: 744-747. 46. IMAGAWA,M., R . CHIU& M. KARIN.1987. Transcription factor AP-2 mediates induction by two different signal-transduction pathways: protein kinase C and CAMP. Cell 51: 251-260.